Salmonella Type III Secretion Effector SrfJ: A Glucosylceramidase Affecting the Lipidome and the Transcriptome of Mammalian Host Cells
Abstract
:1. Introduction
2. Results
2.1. Glucosylceramidase Activity of SrfJ
2.2. Effect of SrfJ on the Host Lipidome
2.3. Effect of SrfJ on the Host Transcriptome
2.4. Functions of Genes Differentially Expressed in the Presence of SrfJ
2.5. Secretion of CCL5 by Host Cells Is Modulated by SrfJ
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Plasmids
4.2. DNA Amplification with Polymerase Chain Reaction and Sequencing
4.3. Bacterial Culture
4.4. Mutagenesis
4.5. GST and 6His Fusion Proteins
4.6. Glucosylceramidase Assay
4.7. Cell Culture, Lysis, and Transfection
4.8. Infections of RAW264.7 Cells with Salmonella
4.9. Lipidomic Analysis
4.10. RNA Preparation, Gene Array Processing, and Statistics
4.11. Detection of CCL5 Secretion by ELISA
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Heuck, A.P.; Brovedan, M.A. Evolutionary Conservation, Variability, and Adaptation of Type III Secretion Systems. J. Membr. Biol. 2022, 255, 599–612. [Google Scholar] [CrossRef] [PubMed]
- Milne-Davies, B.; Wimmi, S.; Diepold, A. Adaptivity and Dynamics in Type III Secretion Systems. Mol. Microbiol. 2021, 115, 395–411. [Google Scholar] [CrossRef] [PubMed]
- Azimi, T.; Zamirnasta, M.; Sani, M.A.; Soltan Dallal, M.M.; Nasser, A. Molecular Mechanisms of Salmonella Effector Proteins: A Comprehensive Review. Infect. Drug Resist. 2020, 13, 11–26. [Google Scholar] [CrossRef] [PubMed]
- Ramos-Morales, F. Impact of Salmonella enterica Type III Secretion System Effectors on the Eukaryotic Host Cell. ISRN Cell Biol. 2012, 2012, 1–36. [Google Scholar] [CrossRef]
- Li, Q. Mechanisms for the Invasion and Dissemination of Salmonella. Can. J. Infect. Dis. Med. Microbiol. 2022, 2022, 2655801. [Google Scholar] [CrossRef]
- Vaughn, B.; Abu Kwaik, Y. Idiosyncratic Biogenesis of Intracellular Pathogens-Containing Vacuoles. Front. Cell. Infect. Microbiol. 2021, 11, 722433. [Google Scholar] [CrossRef]
- Jennings, E.; Thurston, T.L.M.; Holden, D.W. Salmonella SPI-2 Type III Secretion System Effectors: Molecular Mechanisms And Physiological Consequences. Cell Host Microbe 2017, 22, 217–231. [Google Scholar] [CrossRef]
- Herzog, M.K.-M.; Cazzaniga, M.; Peters, A.; Shayya, N.; Beldi, L.; Hapfelmeier, S.; Heimesaat, M.M.; Bereswill, S.; Frankel, G.; Gahan, C.G.M.; et al. Mouse Models for Bacterial Enteropathogen Infections: Insights into the Role of Colonization Resistance. Gut Microbes 2023, 15, 2172667. [Google Scholar] [CrossRef]
- Galán, J.E.; Curtiss, R. Cloning and Molecular Characterization of Genes Whose Products Allow Salmonella typhimurium to Penetrate Tissue Culture Cells. Proc. Natl. Acad. Sci. USA 1989, 86, 6383–6387. [Google Scholar] [CrossRef]
- Hensel, M.; Shea, J.E.; Gleeson, C.; Jones, M.D.; Dalton, E.; Holden, D.W. Simultaneous Identification of Bacterial Virulence Genes by Negative Selection. Science 1995, 269, 400–403. [Google Scholar] [CrossRef]
- Hapfelmeier, S.; Hardt, W.D. A Mouse Model for S. Typhimurium-Induced Enterocolitis. Trends Microbiol. 2005, 13, 497–503. [Google Scholar] [CrossRef] [PubMed]
- Knuff-Janzen, K.; Tupin, A.; Yurist-Doutsch, S.; Rowland, J.L.; Finlay, B.B. Multiple Salmonella-Pathogenicity Island 2 Effectors Are Required to Facilitate Bacterial Establishment of Its Intracellular Niche and Virulence. PLoS ONE 2020, 15, e0235020. [Google Scholar] [CrossRef]
- Kolodziejek, A.M.; Miller, S.I. Salmonella Modulation of the Phagosome Membrane, Role of SseJ. Cell. Microbiol. 2015, 17, 333–341. [Google Scholar] [CrossRef] [PubMed]
- Nawabi, P.; Catron, D.M.; Haldar, K. Esterification of Cholesterol by a Type III Secretion Effector during Intracellular Salmonella Infection. Mol. Microbiol. 2008, 68, 173–185. [Google Scholar] [CrossRef] [PubMed]
- Domingues, L.; Ismail, A.; Charro, N.; Rodríguez-Escudero, I.; Holden, D.W.; Molina, M.; Cid, V.J.; Mota, L.J. The Salmonella Effector SteA Binds Phosphatidylinositol 4-Phosphate for Subcellular Targeting within Host Cells. Cell. Microbiol. 2016, 18, 949–969. [Google Scholar] [CrossRef]
- Worley, M.J.; Ching, K.H.L.; Heffron, F. Salmonella SsrB Activates a Global Regulon of Horizontally Acquired Genes. Mol. Microbiol. 2000, 36, 749–761. [Google Scholar] [CrossRef]
- Fass, E.; Groisman, E.A. Control of Salmonella Pathogenicity Island-2 Gene Expression. Curr. Opin. Microbiol. 2009, 12, 199–204. [Google Scholar] [CrossRef]
- Cordero-Alba, M.; Bernal-Bayard, J.; Ramos-Morales, F. SrfJ, a Salmonella Type III Secretion System Effector Regulated by PhoP, RcsB, and IolR. J. Bacteriol. 2012, 194, 4226–4236. [Google Scholar] [CrossRef]
- Weber, M.; Fuchs, T.M. Metabolism in the Niche: A Large-Scale Genome-Based Survey Reveals Inositol Utilization To Be Widespread among Soil, Commensal, and Pathogenic Bacteria. Microbiol. Spectr. 2022, 10, e0201322. [Google Scholar] [CrossRef]
- Aguilera-Herce, J.; Zarkani, A.A.; Schikora, A.; Ramos-Morales, F. Dual Expression of the Salmonella Effector SrfJ in Mammalian Cells and Plants. Front. Microbiol. 2017, 8, 2410. [Google Scholar] [CrossRef]
- Loewus, F.A.; Kelly, S.; Neufeld, E.F. Metabolism of Myo-Inositol in Plants: Conversion to Pectin, Hemicellulose, D-Xylose, and Sugar Acids. Proc. Natl. Acad. Sci. USA 1962, 48, 421–425. [Google Scholar] [CrossRef] [PubMed]
- Huang, C. From Player to Pawn: Viral Avirulence Factors Involved in Plant Immunity. Viruses 2021, 13, 688. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Albert, J.; Yu, X.-J.; Beuzón, C.R.; Blakey, A.N.; Galyov, E.E.; Holden, D.W. Complementary Activities of SseJ and SifA Regulate Dynamics of the Salmonella typhimurium Vacuolar Membrane. Mol. Microbiol. 2002, 44, 645–661. [Google Scholar] [CrossRef]
- Kim, Y.-G.; Kim, J.-H.; Kim, K. Crystal Structure of the Salmonella enterica Serovar Typhimurium Virulence Factor SrfJ, a Glycoside Hydrolase Family Enzyme. J. Bacteriol. 2009, 191, 6550–6554. [Google Scholar] [CrossRef] [PubMed]
- Rohrhofer, J.; Zwirzitz, B.; Selberherr, E.; Untersmayr, E. The Impact of Dietary Sphingolipids on Intestinal Microbiota and Gastrointestinal Immune Homeostasis. Front. Immunol. 2021, 12, 635704. [Google Scholar] [CrossRef]
- Hays, W.S.; Wheeler, D.E.; Eghtesad, B.; Glew, R.H.; Johnston, D.E. Expression of Cytosolic Beta-Glucosidase in Guinea Pig Liver Cells. Hepatology 1998, 28, 156–163. [Google Scholar] [CrossRef] [PubMed]
- Kinoshita, M.; Matsumori, N. Inimitable Impacts of Ceramides on Lipid Rafts Formed in Artificial and Natural Cell Membranes. Membranes 2022, 12, 727. [Google Scholar] [CrossRef]
- Sharma, D.; Czarnota, G.J. Involvement of Ceramide Signalling in Radiation-Induced Tumour Vascular Effects and Vascular-Targeted Therapy. Int. J. Mol. Sci. 2022, 23, 6671. [Google Scholar] [CrossRef]
- Ge, S.X.; Jung, D.; Yao, R. ShinyGO: A Graphical Gene-Set Enrichment Tool for Animals and Plants. Bioinformatics 2020, 36, 2628–2629. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING Database in 2021: Customizable Protein-Protein Networks, and Functional Characterization of User-Uploaded Gene/Measurement Sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef]
- Zeng, Z.; Lan, T.; Wei, Y.; Wei, X. CCL5/CCR5 Axis in Human Diseases and Related Treatments. Genes Dis. 2022, 9, 12–27. [Google Scholar] [CrossRef]
- Walpole, G.F.W.; Grinstein, S.; Westman, J. The Role of Lipids in Host-Pathogen Interactions. IUBMB Life 2018, 70, 384–392. [Google Scholar] [CrossRef]
- Walpole, G.F.W.; Pacheco, J.; Chauhan, N.; Clark, J.; Anderson, K.E.; Abbas, Y.M.; Brabant-Kirwan, D.; Montaño-Rendón, F.; Liu, Z.; Zhu, H.; et al. Kinase-Independent Synthesis of 3-Phosphorylated Phosphoinositides by a Phosphotransferase. Nat. Cell. Biol. 2022, 24, 708–722. [Google Scholar] [CrossRef] [PubMed]
- Greene, A.R.; Owen, K.A.; Casanova, J.E. Salmonella Typhimurium Manipulates Macrophage Cholesterol Homeostasis through the SseJ-Mediated Suppression of the Host Cholesterol Transport Protein ABCA1. Cell. Microbiol. 2021, 23, e13329. [Google Scholar] [CrossRef] [PubMed]
- Kolodziejek, A.M.; Altura, M.A.; Fan, J.; Petersen, E.M.; Cook, M.; Brzovic, P.S.; Miller, S.I. Salmonella Translocated Effectors Recruit OSBP1 to the Phagosome to Promote Vacuolar Membrane Integrity. Cell. Rep. 2019, 27, 2147–2156.e5. [Google Scholar] [CrossRef] [PubMed]
- Auweter, S.D.; Yu, H.B.; Arena, E.T.; Guttman, J.A.; Finlay, B.B. Oxysterol-Binding Protein (OSBP) Enhances Replication of Intracellular Salmonella and Binds the Salmonella SPI-2 Effector SseL via Its N-Terminus. Microbes Infect. 2012, 14, 148–154. [Google Scholar] [CrossRef] [PubMed]
- Maceyka, M.; Spiegel, S. Sphingolipid Metabolites in Inflammatory Disease. Nature 2014, 510, 58–67. [Google Scholar] [CrossRef]
- Hannun, Y.A.; Obeid, L.M. Principles of Bioactive Lipid Signalling: Lessons from Sphingolipids. Nat. Rev. Mol. Cell. Biol. 2008, 9, 139–150. [Google Scholar] [CrossRef] [PubMed]
- Rolando, M.; Buchrieser, C. A Comprehensive Review on the Manipulation of the Sphingolipid Pathway by Pathogenic Bacteria. Front. Cell. Dev. Biol. 2019, 7, 168. [Google Scholar] [CrossRef]
- Schall, T.J.; Bacon, K.; Toy, K.J.; Goeddel, D.V. Selective Attraction of Monocytes and T Lymphocytes of the Memory Phenotype by Cytokine RANTES. Nature 1990, 347, 669–671. [Google Scholar] [CrossRef]
- Schmieger, H. Phage P22-Mutants with Increased or Decreased Transduction Abilities. Mol. Gen. Genet. 1972, 119, 75–88. [Google Scholar] [CrossRef] [PubMed]
- Maloy, S.R. Experimental Techniques in Bacterial Genetics; Jones and Bartlett Learning: Burlington, MA, USA, 1990; ISBN 0-86720-118-5. [Google Scholar]
- Hanahan, D. Studies on Transformation of Escherichia Coli with Plasmids. J. Mol. Biol. 1983, 166, 557–580. [Google Scholar] [CrossRef] [PubMed]
- Bullock, W.O.; Fernandez, J.M.; Short, J.M. XL1-Blue: A High Efficiency Plasmid Transforming RecA Escherichia coli Strain with Betagalactosidase Selection. Biol. Tech. 1987, 5, 376–379. [Google Scholar]
- Datsenko, K.A.; Wanner, B.L. One-Step Inactivation of Chromosomal Genes in Escherichia Coli K-12 Using PCR Products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [PubMed]
- Beutler, E.; Kuhl, W. The Diagnosis of the Adult Type of Gaucher’s Disease and Its Carrier State by Demonstration of Deficiency of Beta-Glucosidase Activity in Peripheral Blood Leukocytes. J. Lab. Clin. Med. 1970, 76, 747–755. [Google Scholar] [PubMed]
- Peters, S.P.; Lee, R.E.; Glew, R.H. A Microassay for Gaucher’s Disease. Clin. Chim. Acta 1975, 60, 391–396. [Google Scholar] [CrossRef] [PubMed]
- Pizarro, C.; Arenzana-Rámila, I.; Pérez-del-Notario, N.; Pérez-Matute, P.; González-Sáiz, J.-M. Plasma Lipidomic Profiling Method Based on Ultrasound Extraction and Liquid Chromatography Mass Spectrometry. Anal. Chem. 2013, 85, 12085–12092. [Google Scholar] [CrossRef] [PubMed]
- Castro-Perez, J.M.; Kamphorst, J.; Degroot, J.; Lafeber, F.; Goshawk, J.; Yu, K.; Shockcor, J.P.; Vreeken, R.J.; Hankemeier, T. Comprehensive LC-MSE Lipidomic Analysis Using a Shotgun Approach and Its Application to Biomarker Detection and Identification in Osteoarthritis Patients. J. Proteome Res. 2010, 9, 2377–2389. [Google Scholar] [CrossRef]
- Jové, M.; Naudí, A.; Gambini, J.; Borras, C.; Cabré, R.; Portero-Otín, M.; Viña, J.; Pamplona, R. A Stress-Resistant Lipidomic Signature Confers Extreme Longevity to Humans. J. Gerontol. A-Biol. 2017, 72, 30–37. [Google Scholar] [CrossRef]
- Jové, M.; Cabré, R.; Mota-Martorell, N.; Martin-Garí, M.; Obis, È.; Ramos, P.; Canales, I.; Galo-Licona, J.D.; Sol, J.; Nogueras, L.; et al. Age-Related Changes in Lipidome of Rat Frontal Cortex and Cerebellum Are Partially Reversed by Methionine Restriction Applied in Old Age. Int. J. Mol. Sci. 2021, 22, 12517. [Google Scholar] [CrossRef]
- Chong, J.; Wishart, D.S.; Xia, J. Using MetaboAnalyst 4.0 for Comprehensive and Integrative Metabolomics Data Analysis. Curr. Protoc. Bioinform. 2019, 68, e86. [Google Scholar] [CrossRef] [PubMed]
Lipid Family (LIPID MAPS Classification) | Compound | Fold Change | p Value | Regulation in the Presence of SrfJ |
---|---|---|---|---|
Fatty acyls | Heptadecanoyl carnitine | 5.67 × 104 | 1.04 × 10−2 | Up |
Glycerolipids | MG (13:0) | 1.54 × 104 | 4.93 × 10−2 | Up |
TG (56:0) | 4.33 × 10³ | 4.94 × 10−2 | Up | |
TG (56:2) | 1.21 × 104 | 1.03 × 10−2 | Up | |
TG (58:6) | 1.11 × 104 | 4.98 × 10−2 | Up | |
TG (60:6) | 7.03 × 10³ | 4.95 × 10−2 | Up | |
TG (62:4) | 5.87 × 10³ | 4.95 × 10−2 | Up | |
TG (62:6) | 1.38 × 104 | 1.02 × 10−2 | Up | |
Glycerophospholipids | LPE (2:0) | 3.52 × 105 | 1.01 × 10−2 | Up |
PA (44:6) | 2.24 | 8.25 × 10−3 | Up | |
PC (52:4) | 1.71 × 104 | 4.96 × 10−2 | Up | |
PE (31:0) | 1.68 | 9.91 × 10−3 | Up | |
PE (48:1) | 1.24 × 104 | 4.95 × 10−2 | Up | |
PE (P-40:2) | 1.14 × 104 | 4.96 × 10−2 | Up | |
Sphingolipids | Cer (d30:1) | 6.22 × 10³ | 4.99 × 10−2 | Up |
LacCer (d44:1(2OH)) | 2.09 | 4.81 × 10−2 | Up | |
Sterol lipids | CE (22:1) | 1.14 × 104 | 1.78 × 10−16 | Up |
Glycerophospholipids | CL (78:2) | 1.55 × 10−4 | 4.97 × 10−2 | Down |
LPC (20:1) | 6.89 × 10−5 | 4.94 × 10−2 | Down | |
PC (P-34:3) | 2.89 × 10−5 | 4.93 × 10−2 | Down | |
PE (O-38:5) | 2.45 × 10−5 | 5.30 × 10−3 | Down | |
PS (44:4) | 1.62 × 10−4 | 5.29 × 10−3 | Down | |
Sphingolipids | SM (d40:1) | 6.29 × 10−5 | 4.97 × 10−2 | Down |
Strain/Plasmid | Relevant Characteristics | Source/Reference |
---|---|---|
Escherichia coli | ||
BL21(DE3) | F- ompT gal dcm lon hsdSB (r− m−; E. coli B strain), with DE3, a λ prophage carrying the T7 RNA pol gene | Stratagene |
DH5α | supE44 ∆lacU169 (Ø80 lacZ∆M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 | [43] |
XL1-Blue | recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 Dlac-pro/F’ proAB lacIq lacZDM15 Tn10 (Tetr) | [44] |
Salmonella enterica serovar Typhimurium | ||
14028 | Wild type | ATCC |
SV5599 | srfJ::3XFLAG Kmr | [18] |
SV9689 | ΔsrfJ | This work |
Plasmids | ||
pGEX-4T-1 | GST fusion vector, Apr | GE Healthcare |
pIZ1855 | pcDNA3-SrfJ-3xFLAG | This work |
pIZ2046 | pQE30-SrfJ | This work |
pIZ3397 | pQE30-SrfJ(E196A) | This work |
pIZ3411 | pQE30-SrfJ(E294A) | This work |
pIZ3412 | pQE30-SrfJ(E196A/E294A) | This work |
pIZ3633 | pcDNA3-SrfJ(E294A)-3xFLAG | This work |
Oligonucleotide/ Use | Sequence 5’–3’ |
---|---|
Deletion of srfJ | |
srfJP1 | cagatcgactcctgccgccatagcaacgtactggcgcctgGTGTAGGCTGGAGCTGCTTC |
srfJP4 | accgcgccacgcgttacagcagattgacggattcggcggcATTCCGGGGATCCGTCGACC |
Construction of pIZ1855 | |
srfJpcdnadir | gtcaGGATCCgccaccATGAAAGGCAGACTCATCTC |
3×FlagEcorev | ctgagaattcTTACTATTTATCGTCGTCATC |
Construction of pIZ2046 | |
srfJBamfw | CTAGGGATCCAAAGGCAGACTCATCTCTTC |
srfJSalrv | ATCTGTCGACAATCCCAGCTTCATCATTCAG |
Construction of pIZ2397 | |
PsrfJKpnIfw | ATGCGGTACCTCACTGCGATGTTACCGGCG |
srfJsalIrev | GTACGTCGACGATCGACTCCTGCCGCCATAG |
Construction of pIZ3397 | |
srfJE196Afw | GCGCTCTCCGTGCAGAATGCGCCGGTGGCGGTAAAAACC |
srfJE196Arv | GGTTTTTACCGCCACCGGCGCATTCTGCACGGAGAGCGC |
Construction of pIZ3411 and pIZ3412 | |
srfJE294Afw | GATAAAAAACTCCTGTTTTCCGCGGGCTGTGTGCCAATGGAGAGC |
srfJE294Arv | GCTCTCCATTGGCACACAGCCCGCGGAAAACAGGAGTTTTTTATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aguilera-Herce, J.; Panadero-Medianero, C.; Sánchez-Romero, M.A.; Balbontín, R.; Bernal-Bayard, J.; Ramos-Morales, F. Salmonella Type III Secretion Effector SrfJ: A Glucosylceramidase Affecting the Lipidome and the Transcriptome of Mammalian Host Cells. Int. J. Mol. Sci. 2023, 24, 8403. https://doi.org/10.3390/ijms24098403
Aguilera-Herce J, Panadero-Medianero C, Sánchez-Romero MA, Balbontín R, Bernal-Bayard J, Ramos-Morales F. Salmonella Type III Secretion Effector SrfJ: A Glucosylceramidase Affecting the Lipidome and the Transcriptome of Mammalian Host Cells. International Journal of Molecular Sciences. 2023; 24(9):8403. https://doi.org/10.3390/ijms24098403
Chicago/Turabian StyleAguilera-Herce, Julia, Concepción Panadero-Medianero, María Antonia Sánchez-Romero, Roberto Balbontín, Joaquín Bernal-Bayard, and Francisco Ramos-Morales. 2023. "Salmonella Type III Secretion Effector SrfJ: A Glucosylceramidase Affecting the Lipidome and the Transcriptome of Mammalian Host Cells" International Journal of Molecular Sciences 24, no. 9: 8403. https://doi.org/10.3390/ijms24098403
APA StyleAguilera-Herce, J., Panadero-Medianero, C., Sánchez-Romero, M. A., Balbontín, R., Bernal-Bayard, J., & Ramos-Morales, F. (2023). Salmonella Type III Secretion Effector SrfJ: A Glucosylceramidase Affecting the Lipidome and the Transcriptome of Mammalian Host Cells. International Journal of Molecular Sciences, 24(9), 8403. https://doi.org/10.3390/ijms24098403