Salvianolic-Acid-B-Loaded HA Self-Healing Hydrogel Promotes Diabetic Wound Healing through Promotion of Anti-Inflammation and Angiogenesis
Abstract
1. Introduction
2. Results
2.1. Preparation and Characterization of the Hydrogels
2.2. Cytocompatibility Evaluation of the Hydrogels
2.3. Inflammatory Regulation of SAB In Vitro
2.4. In Vivo Experiment, Histology and Immunofluorescence Staining
3. Discussion
4. Materials and Methods
4.1. Materials, Cells and Animals
4.2. Synthesis and Characterization of HA-ADH and OHA
4.3. Morphology and Rheological Properties of the Hydrogels
4.4. Degradation Performance and Drug Release Profile In Vitro
4.5. Cytocompatibility Evaluation of the Hydrogels
4.6. Inflammatory Regulation of SAB In Vitro
4.7. In Vivo Diabetic Wound Healing Assessment
4.8. Histology and Immunofluorescence Staining
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Banday, M.Z.; Sameer, A.S.; Nissar, S. Pathophysiology of diabetes: An overview. Avicenna J. Med. 2020, 10, 174–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McDermott, K.; Fang, M.; Boulton, A.J.M.; Selvin, E.; Hicks, C.W. Etiology, Epidemiology, and Disparities in the Burden of Diabetic Foot Ulcers. Diabetes Care 2023, 46, 209–221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rehak, L.; Giurato, L.; Meloni, M.; Panunzi, A.; Manti, G.M.; Uccioli, L. The Immune-Centric Revolution in the Diabetic Foot: Monocytes and Lymphocytes Role in Wound Healing and Tissue Regeneration—A Narrative Review. J. Clin. Med. 2022, 11, 889. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kharaziha, M.; Baidya, A.; Annabi, N. Rational Design of Immunomodulatory Hydrogels for Chronic Wound Healing. Adv. Mater. 2021, 33, 2100176. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, T.T.; Jones, J.I.; Wolter, W.R.; Perez, R.L.; Schroeder, V.A.; Champion, M.M.; Hesek, D.; Lee, M.; Suckow, M.A.; Mobashery, S.; et al. Hyperbaric oxygen therapy accelerates wound healing in diabetic mice by decreasing active matrix metalloproteinase-9. Wound Repair Regen. 2020, 28, 194–201. [Google Scholar] [CrossRef] [Scilit]
- Dunnill, C.; Patton, T.; Brennan, J.; Barrett, J.; Dryden, M.; Cooke, J.; Leaper, D.; Georgopoulos, N.T. Reactive oxygen species (ROS) and wound healing: The functional role of ROS and emerging ROS-modulating technologies for augmentation of the healing process. Int. Wound J. 2017, 14, 89–96. [Google Scholar] [CrossRef] [Scilit]
- Matoori, S.; Veves, A.; Mooney, D.J. Advanced bandages for diabetic wound healing. Sci. Transl. Med. 2021, 13, eabe4839. [Google Scholar] [CrossRef] [Scilit]
- Esakkimuthukumar, M.; Swaroop, A.K.; Patnaik, S.K.; Kumar, R.R.; Praveen, T.K.; Naik, M.R.; Jubie, S. A novel family of small molecule HIF-1 alpha stabilizers for the treatment of diabetic wounds; an integrated in silico, in vitro, and in vivo strategy. RSC Adv. 2022, 12, 31293–31302. [Google Scholar] [CrossRef] [Scilit]
- Patel, S.; Srivastava, S.; Singh, M.R.; Singh, D. Mechanistic insight into diabetic wounds: Pathogenesis, molecular targets and treatment strategies to pace wound healing. Biomed. Pharmacother. 2019, 112, 108615. [Google Scholar] [CrossRef] [Scilit]
- Lyttle, B.D.; Vaughn, A.E.; Bardill, J.R.; Apte, A.; Gallagher, L.T.; Zgheib, C.; Liechty, K.W. Effects of microRNAs on angiogenesis in diabetic wounds. Front. Med. 2023, 10, 457. [Google Scholar] [CrossRef] [Scilit]
- Asadi, N.; Pazoki-Toroudi, H.; Del Bakhshayesh, A.R.; Akbarzadeh, A.; Davaran, S.; Annabi, N. Multifunctional hydrogels for wound healing: Special focus on biomacromolecular based hydrogels. Int. J. Biol. Macromol. 2021, 170, 728–750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koehler, J.; Brandl, F.P.; Goepferich, A.M. Hydrogel wound dressings for bioactive treatment of acute and chronic wounds. Eur. Polym. J. 2018, 100, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Zeng, Q.; Qian, Y.; Huang, Y.; Ding, F.; Qi, X.; Shen, J. Polydopamine nanoparticle-dotted food gum hydrogel with excellent antibacterial activity and rapid shape adaptability for accelerated bacteria-infected wound healing. Bioact. Mater. 2021, 6, 2647–2657. [Google Scholar] [CrossRef] [Scilit]
- Graça, M.F.P.; Miguel, S.P.; Cabral, C.S.D.; Correia, I.J. Hyaluronic acid—Based wound dressings: A review. Carbohydr. Polym. 2020, 241, 116364. [Google Scholar] [CrossRef] [Scilit]
- Burdick, J.A.; Prestwich, G.D. Hyaluronic acid hydrogels for biomedical applications. Adv. Mater. 2011, 23, H41–H56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwon, M.Y.; Wang, C.; Galarraga, J.H.; Puré, E.; Han, L.; Burdick, J.A. Influence of hyaluronic acid modification on CD44 binding towards the design of hydrogel biomaterials. Biomaterials 2019, 222, 119451. [Google Scholar] [CrossRef] [Scilit]
- Gwon, K.; Kim, E.; Tae, G. Heparin-hyaluronic acid hydrogel in support of cellular activities of 3D encapsulated adipose derived stem cells. Acta Biomater. 2017, 49, 284–295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vu, T.T.; Gulfam, M.; Jo, S.-H.; Rizwan, A.; Joo, S.-B.; Lee, B.; Park, S.-H.; Lim, K.T. The effect of molecular weight and chemical structure of cross-linkers on the properties of redox-responsive hyaluronic acid hydrogels. Int. J. Biol. Macromol. 2023, 124285. [Google Scholar] [CrossRef] [Scilit]
- Yang, B.; Song, J.; Jiang, Y.; Li, M.; Wei, J.; Qin, J.; Peng, W.; Lasaosa, F.L.; He, Y.; Mao, H.; et al. Injectable Adhesive Self-Healing Multicross-Linked Double-Network Hydrogel Facilitates Full-Thickness Skin Wound Healing. ACS Appl. Mater. Interfaces 2020, 12, 57782–57797. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Xu, P.; Yao, Z.; Fang, Q.; Feng, L.; Guo, R.; Cheng, B. Preparation of Antimicrobial Hyaluronic Acid/Quaternized Chitosan Hydrogels for the Promotion of Seawater-Immersion Wound Healing. Front. Bioeng. Biotechnol. 2019, 7, 360. [Google Scholar] [CrossRef] [Scilit]
- Guan, S.; Li, Y.; Cheng, C.; Gao, X.; Gu, X.; Han, X.; Ye, H. Manufacture of pH- and HAase-responsive hydrogels with on-demand and continuous antibacterial activity for full-thickness wound healing. Int. J. Biol. Macromol. 2020, 164, 2418–2431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moura, L.I.; Dias, A.M.; Carvalho, E.; de Sousa, H.C. Recent advances on the development of wound dressings for diabetic foot ulcer treatment—A review. Acta Biomater. 2013, 9, 7093–7114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taylor, D.L.; Panhuis, M.I.H. Self-Healing Hydrogels. Adv. Mater. 2016, 28, 9060–9093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.W.; Kim, S.; Jeong, Y.R.; Kim, J.; Kim, D.S.; Keum, K.; Lee, H.; Ha, J.S. Self-healing strain-responsive electrochromic display based on a multiple crosslinked network hydrogel. Chem. Eng. J. 2022, 430, 132685. [Google Scholar] [CrossRef] [Scilit]
- del Olmo, J.A.; Alonso, J.M.; Saez-Martinez, V.; Benito-Cid, S.; Moreno-Benitez, I.; Bengoa-Larrauri, M.; Perez-Gonzalez, R.; Vilas-Vilela, J.L.; Perez-Alvarez, L. Self-healing, antibacterial and anti-inflammatory chitosan-PEG hydrogels for ulcerated skin wound healing and drug delivery. Biomater. Adv. 2022, 139, 212992. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.; Dong, Q.; Peng, X.; Chen, Y.; Yang, H.; Xu, W.; Zhao, Y.; Xiao, P.; Zhou, Y. Self-Healing Hyaluronic Acid Nanocomposite Hydrogels with Platelet-Rich Plasma Impregnated for Skin Regeneration. ACS Nano 2022, 16, 11346–11359. [Google Scholar] [CrossRef] [Scilit]
- Yang, R.; Liu, X.; Ren, Y.; Xue, W.; Liu, S.; Wang, P.; Zhao, M.; Xu, H.; Chi, B. Injectable adaptive self-healing hyaluronic acid/poly (γ-glutamic acid) hydrogel for cutaneous wound healing. Acta Biomater. 2021, 127, 102–115. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; Huang, Y.; Pan, W.; Tong, X.; Zeng, Q.; Su, T.; Qi, X.; Shen, J. Polydopamine-incorporated dextran hydrogel drug carrier with tailorable structure for wound healing. Carbohydr. Polym. 2021, 253, 117213. [Google Scholar] [CrossRef] [Scilit]
- Choudhary, M.; Chhabra, P.; Tyagi, A.; Singh, H. Scar free healing of full thickness diabetic wounds: A unique combination of silver nanoparticles as antimicrobial agent, calcium alginate nanoparticles as hemostatic agent, fresh blood as nutrient/growth factor supplier and chitosan as base matrix. Int. J. Biol. Macromol. 2021, 178, 41–52. [Google Scholar] [CrossRef] [Scilit]
- Goh, M.; Hwang, Y.; Tae, G. Epidermal growth factor loaded heparin-based hydrogel sheet for skin wound healing. Carbohydr. Polym. 2016, 147, 251–260. [Google Scholar] [CrossRef] [Scilit]
- Rahim, M.A.; Kristufek, S.L.; Pan, S.; Richardson, J.J.; Caruso, F. Phenolic Building Blocks for the Assembly of Functional Materials. Angew. Chem. Int. Ed. 2019, 58, 1904–1927. [Google Scholar] [CrossRef] [Scilit]
- Qian, Y.; Zheng, Y.; Jin, J.; Wu, X.; Xu, K.; Dai, M.; Niu, Q.; Zheng, H.; He, X.; Shen, J. Immunoregulation in Diabetic Wound Repair with a Photoenhanced Glycyrrhizic Acid Hydrogel Scaffold. Adv. Mater. 2022, 34, e2200521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soares, R.D.F.; Campos, M.G.N.; Ribeiro, G.P.; Salles, B.C.C.; Cardoso, N.S.; Ribeiro, J.R.; Souza, R.M.; Leme, K.C.; Soares, C.B.; de Oliveira, C.M.; et al. Development of a chitosan hydrogel containing flavonoids extracted from Passiflora edulis leaves and the evaluation of its antioxidant and wound healing properties for the treatment of skin lesions in diabetic mice. J. Biomed. Mater. Res. Part A 2020, 108, 654–662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, H.; Song, L.; Sun, B.; Chu, D.; Yang, L.; Li, M.; Li, H.; Dai, Y.; Yu, Z.; Guo, J. Modulation of macrophages by a paeoniflorin-loaded hyaluronic acid-based hydrogel promotes diabetic wound healing. Mater. Today Bio 2021, 12, 100139. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.G.; Kwon, S.; Moon, S.K.; Cho, S.Y.; Park, S.U.; Jung, W.S.; Park, J.M.; Ko, C.N.; Cho, K.H. Neuroprotective Effects of Geopung-Chunghyuldan Based on Its Salvianolic Acid B Content Using an in Vivo Stroke Model. Curr. Issues Mol. Biol. 2023, 45, 1613–1626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Ma, S.; Xia, H.; Lou, H.; Zhu, F.; Sun, L. Anti-inflammatory activities and potential mechanisms of phenolic acids isolated from Salvia miltiorrhiza f. alba roots in THP-1 macrophages. J. Ethnopharmacol. 2018, 222, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Z.; Liu, W.; Mu, Y.P.; Zhang, H.; Wang, X.N.; Zhao, C.Q.; Chen, J.M.; Liu, P. Pharmacological Effects of Salvianolic Acid B against Oxidative Damage. Front. Pharmacol. 2020, 11, 572373. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Zhang, X.; Cui, L.; Chen, R.; Zhang, Y.; Zhang, C.; Zhu, X.; He, T.; Shen, Z.; Dong, L.; et al. Salvianolic acids enhance cerebral angiogenesis and neurological recovery by activating JAK2/STAT3 signaling pathway after ischemic stroke in mice. J. Neurochem. 2017, 143, 87–99. [Google Scholar] [CrossRef] [Scilit]
- Patil, C.; Patil, M.; Patil, M. Studies on Synthesis of Aldimines: Part-I. Synthesis, Characterization and Biological Activity of Aldimines from Benzaldehyde with variedly substituted anilines. Recent Res. Sci. Technol. 2018, 10, 23–27. [Google Scholar] [CrossRef] [Scilit]
- Kalantari, K.; Mostafavi, E.; Afifi, A.M.; Izadiyan, Z.; Jahangirian, H.; Rafiee-Moghaddam, R.; Webster, T.J. Wound dressings functionalized with silver nanoparticles: Promises and pitfalls. Nanoscale 2020, 12, 2268–2291. [Google Scholar] [CrossRef] [Scilit]
- Davis, F.M.; Kimball, A.; Boniakowski, A.; Gallagher, K. Dysfunctional Wound Healing in Diabetic Foot Ulcers: New Crossroads. Curr. Diabetes Rep. 2018, 18, 2. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scopelliti, F.; Cattani, C.; Dimartino, V.; Mirisola, C.; Cavani, A. Platelet Derivatives and the Immunomodulation of Wound Healing. Int. J. Mol. Sci. 2022, 23, 8370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Augustine, R.; Hasan, A.; Patan, N.K.; Dalvi, Y.B.; Varghese, R.; Antony, A.; Unni, R.N.; Sandhyarani, N.; Al Moustafa, A.E. Cerium Oxide Nanoparticle Incorporated Electrospun Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) Membranes for Diabetic Wound Healing Applications. Acs Biomater. Sci. Eng. 2020, 6, 58–70. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.M.; Ho, C.K.; Gao, Y.; Chong, C.H.; Zheng, D.N.; Zhang, Y.F.; Yu, L. Salvianolic acid-B improves fat graft survival by promoting proliferation and adipogenesis. Stem Cell Res. Ther. 2021, 12, 507. [Google Scholar] [CrossRef] [Scilit]
- Cai, C.; Zhang, X.; Li, Y.; Liu, X.; Wang, S.; Lu, M.; Yan, X.; Deng, L.; Liu, S.; Wang, F.; et al. Self-Healing Hydrogel Embodied with Macrophage-Regulation and Responsive-Gene-Silencing Properties for Synergistic Prevention of Peritendinous Adhesion. Adv. Mater. 2022, 34, 2106564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roh, H.H.; Kim, H.S.; Kim, C.; Lee, K.Y. 3D Printing of Polysaccharide-Based Self-Healing Hydrogel Reinforced with Alginate for Secondary Cross-Linking. Biomedicines 2021, 9, 1224. [Google Scholar] [CrossRef] [Scilit]








| Primer Name | Primer Sequence (5′-3′) |
|---|---|
| Humo IL-1β | F: AATCTCACAGCAGCATCTCGACAAG |
| R: TCCACGGGCAAGACATAGGTAGC | |
| Humo ccr7 | F: ATGGTGATCGGCTTTCTGGT |
| R: CCAGGACCACCCCATTGTAG | |
| Humo CD206 | F: CCACAGTTATGCCTACCATGCC |
| R: TCCCTCCAAAGCCTATACAAGC | |
| Humo GAPDH | F: TGACATCAAGAAGGTGGTGAAGCAG |
| R: GTGTCGCTGTTGAAGTCAGAGGAG |
| Primer Name | Primer Sequence |
|---|---|
| Rat IL-1β | F: CTCAGAGCCATAAGAAAACCGT |
| R: GACAATGCTGCCTCGTGACC | |
| Rat IL-10 | F: TATGTTGCCTGCTCTTACTGGCT |
| R: GCAGTTATTGTCACCCCGGAT | |
| Rat GAPDH | F: GACATGCCGCCTGGAGAAAC |
| R: AGCCCAGGATGCCCTTTAGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, G.; Zhu, J.; Jin, L.; Chen, J.; Xu, R.; Zhao, Y.; Yan, T.; Wan, H. Salvianolic-Acid-B-Loaded HA Self-Healing Hydrogel Promotes Diabetic Wound Healing through Promotion of Anti-Inflammation and Angiogenesis. Int. J. Mol. Sci. 2023, 24, 6844. https://doi.org/10.3390/ijms24076844
Zhou G, Zhu J, Jin L, Chen J, Xu R, Zhao Y, Yan T, Wan H. Salvianolic-Acid-B-Loaded HA Self-Healing Hydrogel Promotes Diabetic Wound Healing through Promotion of Anti-Inflammation and Angiogenesis. International Journal of Molecular Sciences. 2023; 24(7):6844. https://doi.org/10.3390/ijms24076844
Chicago/Turabian StyleZhou, Guoying, Jiayan Zhu, Liang Jin, Jing Chen, Ruojiao Xu, Yali Zhao, Tingzi Yan, and Haitong Wan. 2023. "Salvianolic-Acid-B-Loaded HA Self-Healing Hydrogel Promotes Diabetic Wound Healing through Promotion of Anti-Inflammation and Angiogenesis" International Journal of Molecular Sciences 24, no. 7: 6844. https://doi.org/10.3390/ijms24076844
APA StyleZhou, G., Zhu, J., Jin, L., Chen, J., Xu, R., Zhao, Y., Yan, T., & Wan, H. (2023). Salvianolic-Acid-B-Loaded HA Self-Healing Hydrogel Promotes Diabetic Wound Healing through Promotion of Anti-Inflammation and Angiogenesis. International Journal of Molecular Sciences, 24(7), 6844. https://doi.org/10.3390/ijms24076844

