CHIR99021-Treated Osteocytes with Wnt Activation in 3D-Printed Module Form an Osteogenic Microenvironment for Enhanced Osteogenesis and Vasculogenesis
Abstract
1. Introduction
2. Results
2.1. C91 Activates the Wnt/β-Catenin Signaling Pathway in the Osteoblast Cell Line MLO-Y4
2.2. C91-Induced Osteocytes Promote Osteoblast Differentiation and Mineralization of ST2 Cells via Activation of Wnt Signaling
2.3. COOME Inhibits Adipocyte Formation
2.4. Inhibition of Osteoblast Wnt Signaling Inhibits ST2 Cells Differentiation
2.5. COOME Promotes Cell Proliferation and Does Not Affect Cell Survival in PCI3D Modules
2.6. COOME Promotes the Osteogenic Differentiation and Mineralization of ST2 Cells in PCI3D Modules
2.7. COOME Promotes Angiogenesis
2.8. COOME-Conditioned Medium Promotes Osteoblast Differentiation and Angiogenesis
3. Discussion
4. Materials and Methods
4.1. Reagents and Cells
4.1.1. Chemicals
4.1.2. Assay Kits
4.1.3. Antibodies
4.1.4. Cell Culture Reagents and Cell Sources
4.2. Cell Culture
4.3. Activation and Inhibition of Wnt Signaling in Osteocytic MLO-Y4
4.4. PCL and Cell-Integrated 3D Printing
4.5. Ex Vivo Assay for Osteoblast Differentiation and Matrix Mineralization on Two- or Three-Dimensional Levels
4.5.1. Alkaline Phosphatase Staining
4.5.2. AP Biochemical Activity Assay
4.5.3. Mineralization Assay (Alizarin Red S Staining)
4.6. Cell Proliferative Activity
4.7. Cell Viability Assay
4.8. RNA Extraction and Gene Expression Analysis
4.9. Conditioned Medium
4.10. HUVEC Tube Formation Assay In Vitro and Transwell Migration Assay
4.11. The Experiment of Translocation of β-Catenin into the Nucleus
4.12. Adipogenic Differentiation Induction
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sun, X.; Liu, Y.; Wei, Y.; Wang, Y. Chirality-Induced Bionic Scaffolds in Bone Defects Repair—A Review. Macromol. Biosci. 2022, 22, e2100502. [Google Scholar] [CrossRef]
- Li, R.; Wang, H.; John, J.V.; Song, H.; Teusink, M.J.; Xie, J. 3D Hybrid Nanofiber Aerogels Combining with Nanoparticles Made of a Biocleavable and Targeting Polycation and MiR-26a for Bone Repair. Adv. Funct. Mater. 2020, 30, 2005531. [Google Scholar] [CrossRef]
- Bose, S.; Roy, M.; Bandyopadhyay, A. Recent advances in bone tissue engineering scaffolds. Trends Biotechnol. 2012, 30, 546–554. [Google Scholar] [CrossRef]
- Kim, H.D.; Amirthalingam, S.; Kim, S.L.; Lee, S.S.; Rangasamy, J.; Hwang, N.S. Biomimetic Materials and Fabrication Approaches for Bone Tissue Engineering. Adv. Healthc. Mater. 2017, 6, 1700612. [Google Scholar] [CrossRef]
- Zhang, L.; Yang, G.; Johnson, B.N.; Jia, X. Three-dimensional (3D) printed scaffold and material selection for bone repair. Acta Biomater. 2019, 84, 16–33. [Google Scholar] [CrossRef] [PubMed]
- Matai, I.; Kaur, G.; Seyedsalehi, A.; McClinton, A.; Laurencin, C.T. Progress in 3D bioprinting technology for tissue/organ regenerative engineering. Biomaterials 2020, 226, 119536. [Google Scholar] [CrossRef]
- Li, Q.; Xu, S.; Feng, Q.; Dai, Q.; Yao, L.; Zhang, Y.; Gao, H.; Dong, H.; Chen, D.; Cao, X. 3D printed silk-gelatin hydrogel scaffold with different porous structure and cell seeding strategy for cartilage regeneration. Bioact. Mater. 2021, 6, 3396–3410. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.; Chen, H.; Zhang, H.; Guo, C.; Yang, K.; Chen, K.; Cheng, R.; Qian, N.; Sandler, N.; Zhang, Y.S.; et al. Vascularized 3D printed scaffolds for promoting bone regeneration. Biomaterials 2019, 190–191, 97–110. [Google Scholar] [CrossRef] [PubMed]
- Shim, J.H.; Kim, S.E.; Park, J.Y.; Kundu, J.; Kim, S.W.; Kang, S.S.; Cho, D.W. Three-dimensional printing of rhBMP-2-loaded scaffolds with long-term delivery for enhanced bone regeneration in a rabbit diaphyseal defect. Tissue Eng. Part A 2014, 20, 1980–1992. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Shi, Y.; Zhang, X.; Ma, J. Evaluation of BMP-2 and VEGF loaded 3D printed hydroxyapatite composite scaffolds with enhanced osteogenic capacity in vitro and in vivo. Mater. Sci. Eng. C Mater. Biol. Appl. 2020, 112, 110893. [Google Scholar] [CrossRef]
- Hettiaratchi, M.H.; Krishnan, L.; Rouse, T.; Chou, C.; McDevitt, T.C.; Guldberg, R.E. Heparin-mediated delivery of bone morphogenetic protein-2 improves spatial localization of bone regeneration. Sci. Adv. 2020, 6, eaay1240. [Google Scholar] [CrossRef]
- James, A.W.; LaChaud, G.; Shen, J.; Asatrian, G.; Nguyen, V.; Zhang, X.; Ting, K.; Soo, C. A Review of the Clinical Side Effects of Bone Morphogenetic Protein-2. Tissue Eng. Part B Rev. 2016, 22, 284–297. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.W.; Lee, S.J.; Ko, I.K.; Kengla, C.; Yoo, J.J.; Atala, A. A 3D bioprinting system to produce human-scale tissue constructs with structural integrity. Nat. Biotechnol. 2016, 34, 312–319. [Google Scholar] [CrossRef] [PubMed]
- Zhu, G.; Zhang, T.; Chen, M.; Yao, K.; Huang, X.; Zhang, B.; Li, Y.; Liu, J.; Wang, Y.; Zhao, Z. Bone physiological microenvironment and healing mechanism: Basis for future bone-tissue engineering scaffolds. Bioact. Mater. 2021, 6, 4110–4140. [Google Scholar] [CrossRef]
- Tu, X.; Delgado-Calle, J.; Condon, K.W.; Maycas, M.; Zhang, H.; Carlesso, N.; Taketo, M.M.; Burr, D.B.; Plotkin, L.I.; Bellido, T. Osteocytes mediate the anabolic actions of canonical Wnt/β-catenin signaling in bone. Proc. Natl. Acad. Sci. USA 2015, 112, E478–E486. [Google Scholar] [CrossRef]
- Gori, F.; Superti-Furga, A.; Baron, R. Bone Formation and the Wnt Signaling Pathway. N. Engl. J. Med. 2016, 375, 1902–1903. [Google Scholar] [CrossRef] [PubMed]
- Wodarz, A.; Nusse, R. Mechanisms of Wnt signaling in development. Annu. Rev. Cell Dev. Biol. 1998, 14, 59–88. [Google Scholar] [CrossRef]
- Matsushita, Y.; Nagata, M.; Kozloff, K.M.; Welch, J.D.; Mizuhashi, K.; Tokavanich, N.; Hallett, S.A.; Link, D.C.; Nagasawa, T.; Ono, W.; et al. A Wnt-mediated transformation of the bone marrow stromal cell identity orchestrates skeletal regeneration. Nat. Commun. 2020, 11, 332. [Google Scholar] [CrossRef] [PubMed]
- MacDonald, B.T.; He, X. Frizzled and LRP5/6 receptors for Wnt/β-catenin signaling. Cold Spring Harb. Perspect. Biol. 2012, 4, a007880. [Google Scholar] [CrossRef] [PubMed]
- Schunk, S.J.; Floege, J.; Fliser, D.; Speer, T. WNT-β-catenin signalling—A versatile player in kidney injury and repair. Nat. Rev. Nephrol. 2021, 17, 172–184. [Google Scholar] [CrossRef]
- Wang, X.; Ma, Y.; Chen, J.; Liu, Y.; Liu, G.; Wang, P.; Wang, B.; Taketo, M.M.; Bellido, T.; Tu, X. A novel decellularized matrix of Wnt signaling-activated osteocytes accelerates the repair of critical-sized parietal bone defects with osteoclastogenesis, angiogenesis, and neurogenesis. Bioact. Mater. 2023, 21, 110–128. [Google Scholar] [CrossRef]
- Li, Y.; Liu, Y.; Liu, B.; Wang, J.; Wei, S.; Qi, Z.; Wang, S.; Fu, W.; Chen, Y.G. A growth factor-free culture system underscores the coordination between Wnt and BMP signaling in Lgr5+ intestinal stem cell maintenance. Cell Discov. 2018, 4, 49. [Google Scholar] [CrossRef] [PubMed]
- Buikema, J.W.; Lee, S.; Goodyer, W.R.; Maas, R.G.; Chirikian, O.; Li, G.; Miao, Y.; Paige, S.L.; Lee, D.; Wu, H.; et al. Wnt Activation and Reduced Cell-Cell Contact Synergistically Induce Massive Expansion of Functional Human iPSC-Derived Cardiomyocytes. Cell Stem Cell 2020, 27, 50–63.e5. [Google Scholar] [CrossRef]
- Zhao, M.; Tang, Y.; Zhou, Y.; Zhang, J. Deciphering Role of Wnt Signalling in Cardiac Mesoderm and Cardiomyocyte Differentiation from Human iPSCs: Four-dimensional control of Wnt pathway for hiPSC-CMs differentiation. Sci. Rep. 2019, 9, 19389. [Google Scholar] [CrossRef]
- Wang, P.; Wang, X.; Wang, B.; Li, X.; Xie, Z.; Chen, J.; Honjo, T.; Tu, X. 3D printing of osteocytic Dll4 integrated with PCL for cell fate determination towards osteoblasts in vitro. Bio-Des. Manuf. 2022, 5, 497–511. [Google Scholar] [CrossRef]
- Pevsner-Fischer, M.; Morad, V.; Cohen-Sfady, M.; Rousso-Noori, L.; Zanin-Zhorov, A.; Cohen, S.; Cohen, I.R.; Zipori, D. Toll-like receptors and their ligands control mesenchymal stem cell functions. Blood 2007, 109, 1422–1432. [Google Scholar] [CrossRef] [PubMed]
- Picke, A.K.; Campbell, G.M.; Blüher, M.; Krügel, U.; Schmidt, F.N.; Tsourdi, E.; Winzer, M.; Rauner, M.; Vukicevic, V.; Busse, B.; et al. Thy-1 (CD90) promotes bone formation and protects against obesity. Sci. Transl. Med. 2018, 10, eaao6806. [Google Scholar] [CrossRef]
- Chen, Q.; Shou, P.; Zheng, C.; Jiang, M.; Cao, G.; Yang, Q.; Cao, J.; Xie, N.; Velletri, T.; Zhang, X.; et al. Fate decision of mesenchymal stem cells: Adipocytes or osteoblasts? Cell Death Differ. 2016, 23, 1128–1139. [Google Scholar] [CrossRef] [PubMed]
- Veldhuis-Vlug, A.G.; Rosen, C.J. Mechanisms of marrow adiposity and its implications for skeletal health. Metabolism 2017, 67, 106–114. [Google Scholar] [CrossRef]
- Ramasamy, S.K.; Kusumbe, A.P.; Itkin, T.; Gur-Cohen, S.; Lapidot, T.; Adams, R.H. Regulation of Hematopoiesis and Osteogenesis by Blood Vessel-Derived Signals. Annu. Rev. Cell Dev. Biol. 2016, 32, 649–675. [Google Scholar] [CrossRef]
- Liu, Y.; Ruan, X.; Li, J.; Wang, B.; Chen, J.; Wang, X.; Wang, P.; Tu, X. The Osteocyte Stimulated by Wnt Agonist SKL2001 Is a Safe Osteogenic Niche Improving Bioactivities in a Polycaprolactone and Cell Integrated 3D Module. Cells 2022, 11, 831. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Chen, J.; Wang, X.; Liu, Y.; Ma, Y.; Tu, X. Functionalized 3D-Printed ST2/Gelatin Methacryloyl/Polcaprolactone Scaffolds for Enhancing Bone Regeneration with Vascularization. Int. J. Mol. Sci. 2022, 23, 8347. [Google Scholar] [CrossRef] [PubMed]
- Lieben, L. Regenerative medicine: The future of 3D printing of human tissues is taking shape. Nat. Rev. Rheumatol. 2016, 12, 191. [Google Scholar] [CrossRef]
- Pashuck, E.T.; Stevens, M. From clinical imaging to implantation of 3D printed tissues. Nat. Biotechnol. 2016, 34, 295–296. [Google Scholar] [CrossRef]
- Yazdanpanah, Z.; Johnston, J.D.; Cooper, D.M.L.; Chen, X. 3D Bioprinted Scaffolds for Bone Tissue Engineering: State-of-the-Art and Emerging Technologies. Front. Bioeng. Biotechnol. 2022, 10, 824156. [Google Scholar] [CrossRef] [PubMed]
- Patel, P.P.; Buckley, C.; Taylor, B.L.; Sahyoun, C.C.; Patel, S.D.; Mont, A.J.; Mai, L.; Patel, S.; Freeman, J.W. Mechanical and biological evaluation of a hydroxyapatite-reinforced scaffold for bone regeneration. J. Biomed. Mater. Res. Part A 2019, 107, 732–741. [Google Scholar] [CrossRef]
- Riquelme, M.A.; Cardenas, E.R.; Jiang, J.X. Osteocytes and Bone Metastasis. Front. Endocrinol. 2020, 11, 567844. [Google Scholar] [CrossRef]
- Delgado-Calle, J.; Tu, X.; Pacheco-Costa, R.; McAndrews, K.; Edwards, R.; Pellegrini, G.G.; Kuhlenschmidt, K.; Olivos, N.; Robling, A.; Peacock, M.; et al. Control of Bone Anabolism in Response to Mechanical Loading and PTH by Distinct Mechanisms Downstream of the PTH Receptor. J. Bone Miner. Res. 2017, 32, 522–535. [Google Scholar] [CrossRef]
- Marsell, R.; Sisask, G.; Nilsson, Y.; Sundgren-Andersson, A.K.; Andersson, U.; Larsson, S.; Nilsson, O.; Ljunggren, O.; Jonsson, K.B. GSK-3 inhibition by an orally active small molecule increases bone mass in rats. Bone 2012, 50, 619–627. [Google Scholar] [CrossRef]
- Yan, D.Y.; Tang, J.; Chen, L.; Wang, B.; Weng, S.; Xie, Z.; Wu, Z.Y.; Shen, Z.; Bai, B.; Yang, L. Imperatorin promotes osteogenesis and suppresses osteoclast by activating AKT/GSK3 beta/beta-catenin pathways. J. Cell. Mol. Med. 2020, 24, 2330–2341. [Google Scholar] [CrossRef]
- Antika, L.D.; Lee, E.J.; Kim, Y.H.; Kang, M.K.; Park, S.H.; Kim, D.Y.; Oh, H.; Choi, Y.J.; Kang, Y.H. Dietary phlorizin enhances osteoblastogenic bone formation through enhancing beta-catenin activity via GSK-3beta inhibition in a model of senile osteoporosis. J. Nutr. Biochem. 2017, 49, 42–52. [Google Scholar] [CrossRef]
- Bertacchini, J.; Magaro, M.S.; Poti, F.; Palumbo, C. Osteocytes Specific GSK3 Inhibition Affects In Vitro Osteogenic Differentiation. Biomedicines 2018, 6, 61. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.M.; Chiu, H.C.; Chin, Y.T.; Lin, H.Y.; Chiang, C.Y.; Tu, H.P.; Fu, M.M.; Fu, E. Effects of enamel matrix derivative on the proliferation and osteogenic differentiation of human gingival mesenchymal stem cells. Stem Cell Res. Ther. 2014, 5, 52. [Google Scholar] [CrossRef]
- He, J.; Jiang, J.; Safavi, K.E.; Spångberg, L.S.; Zhu, Q. Emdogain promotes osteoblast proliferation and differentiation and stimulates osteoprotegerin expression. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 2004, 97, 239–245. [Google Scholar] [CrossRef]
- Prasadam, I.; Zhou, Y.; Du, Z.; Chen, J.; Crawford, R.; Xiao, Y. Osteocyte-induced angiogenesis via VEGF—MAPK-dependent pathways in endothelial cells. Mol. Cell. Biochem. 2014, 386, 15–25. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Li, J.; Song, X.; Sun, T.; Mi, L.; Liu, J.; Xia, X.; Bai, N.; Li, X. Alginate/Gelatin Hydrogel Scaffold Containing nCeO2 as a Potential Osteogenic Nanomaterial for Bone Tissue Engineering. Int. J. Nanomed. 2022, 17, 6561–6578. [Google Scholar] [CrossRef]
- Tan, Q.C.; Jiang, X.S.; Chen, L.; Huang, J.F.; Zhou, Q.X.; Wang, J.; Zhao, Y.; Zhang, B.; Sun, Y.N.; Wei, M.; et al. Bioactive graphene oxide-functionalized self-expandable hydrophilic and osteogenic nanocomposite for orthopaedic applications. Mater. Today Bio 2023, 18, 100500. [Google Scholar] [CrossRef] [PubMed]
- Zamani, Y.; Mohammadi, J.; Amoabediny, G.; Visscher, D.O.; Helder, M.N.; Zandieh-Doulabi, B.; Klein-Nulend, J. Enhanced osteogenic activity by MC3T3-E1 pre-osteoblasts on chemically surface-modified poly(ε-caprolactone) 3D-printed scaffolds compared to RGD immobilized scaffolds. Biomed. Mater. 2018, 14, 015008. [Google Scholar] [CrossRef]
- Pillai, H.K.; Fang, M.; Beglov, D.; Kozakov, D.; Vajda, S.; Stapleton, H.M.; Webster, T.F.; Schlezinger, J.J. Ligand binding and activation of PPARgamma by Firemaster® 550: Effects on adipogenesis and osteogenesis in vitro. Environ. Health Perspect. 2014, 122, 1225–1232. [Google Scholar] [CrossRef]
- Rozen, W.M.; Ashton, M.W.; Pan, W.R.; Kiil, B.J.; McClure, V.K.; Grinsell, D.; Stella, D.L.; Corlett, R.J. Anatomical variations in the harvest of anterolateral thigh flap perforators: A cadaveric and clinical study. Microsurgery 2009, 29, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Wen, X.; Cawthorn, W.P.; MacDougald, O.A.; Stupp, S.I.; Snead, M.L.; Zhou, Y. The influence of Leucine-rich amelogenin peptide on MSC fate by inducing Wnt10b expression. Biomaterials 2011, 32, 6478–6486. [Google Scholar] [CrossRef] [PubMed]
- Graneli, C.; Karlsson, C.; Brisby, H.; Lindahl, A.; Thomsen, P. The effects of PPAR-gamma inhibition on gene expression and the progression of induced osteogenic differentiation of human mesenchymal stem cells. Connect. Tissue Res. 2014, 55, 262–274. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.C.; Chen, S.; Zheng, L.; Qin, L. Angiogenesis Assays for the Evaluation of Angiogenic Properties of Orthopaedic Biomaterials—A General Review. Adv. Healthc. Mater. 2017, 6, 1600434. [Google Scholar] [CrossRef] [PubMed]
- Reis, M.; Liebner, S. Wnt signaling in the vasculature. Exp. Cell Res. 2013, 319, 1317–1323. [Google Scholar] [CrossRef]
- Olsen, J.J.; Pohl, S.Ö.G.; Deshmukh, A.; Visweswaran, M.; Ward, N.C.; Arfuso, F.; Agostino, M.; Dharmarajan, A. The Role of Wnt Signalling in Angiogenesis. Clin Biochem. Rev. 2017, 38, 131–142. [Google Scholar]
- Zerlin, M.; Julius, M.A.; Kitajewski, J. Wnt/Frizzled signaling in angiogenesis. Angiogenesis 2008, 11, 63–69. [Google Scholar] [CrossRef] [PubMed]
- Bao, S.; Tang, W.W.; Wu, B.; Kim, S.; Li, J.; Li, L.; Kobayashi, T.; Lee, C.; Chen, Y.; Wei, M.; et al. Derivation of hypermethylated pluripotent embryonic stem cells with high potency. Cell Res. 2018, 28, 22–34. [Google Scholar] [CrossRef] [PubMed]
- Glass, D.A.; Bialek, P.; Ahn, J.D.; Starbuck, M.; Patel, M.S.; Clevers, H.; Taketo, M.M.; Long, F.; McMahon, A.P.; Lang, R.A.; et al. Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation. Dev. Cell 2005, 8, 751–764. [Google Scholar] [CrossRef]
- Wang, B.; Khan, S.; Wang, P.; Wang, X.; Liu, Y.; Chen, J.; Tu, X. A Highly Selective GSK-3β Inhibitor CHIR99021 Promotes Osteogenesis by Activating Canonical and Autophagy-Mediated Wnt Signaling. Front. Endocrinol. 2022, 13, 926622. [Google Scholar] [CrossRef]
- Chia, W.; Liu, J.; Huang, Y.G.; Zhang, C. A circular RNA derived from DAB1 promotes cell proliferation and osteogenic differentiation of BMSCs via RBPJ/DAB1 axis. Cell Death Dis. 2020, 11, 372. [Google Scholar] [CrossRef]
- Jia, L.; Zhou, X.; Huang, X.; Xu, X.; Jia, Y.; Wu, Y.; Yao, J.; Wu, Y.; Wang, K. Maternal and umbilical cord serum-derived exosomes enhance endothelial cell proliferation and migration. FASEB J. 2018, 32, 4534–4543. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Li, Q.; Zhang, J.; Li, P.; An, P.; Wang, C.; Hu, P.; Zou, X.; Dou, X.; Zhu, L. Wnt7a promotes the osteogenic differentiation of human mesenchymal stem cells. Int. J. Mol. Med. 2021, 47, 94. [Google Scholar] [CrossRef] [PubMed]








| Primer | Forward | Reverse |
|---|---|---|
| Gapdh | GCACAGTCAAGGCCGAGAAT | GCCTTCTCCATGGTGGTGAA |
| beta-actin | AGAGGGAAATCGTGCGTGAC | CCATACCCAAGAAGGAAGGCT |
| Lef1 | TACCCCAGCCAGTGTCAACA | TCCATGATAGGCTTTGATGACTTTC |
| Axin2 | TGCAGGAGGCGGTACAGTTC | GCTGGAAGTGGTAAAGCAGCTT |
| Bmp4 | GAGGAGTTTCCATCACGAAGA | GCTCTGCCGAGGAGATCA |
| Smad6 | AAGATGCTGAAGCCGTTGGT | CGAACTCCAGTATCTCCGCTTT |
| Alpl | CACGGCGTCCATGAGCAGAAC | CAGGCACAGTGGTCAAGGTTGG |
| Runx2 | CCGGTCTCCTTCCAGGAT | GGGAACTGCTGTGGCTTC |
| Osx | CCCTTCTCAAGCACCAATGG | AAGGGTGGGTAGTCA TTTGCA TA |
| Bglap | CAGCGGCCCTGAGTCTGA | GCCGGAGTCTGTTCACTACCTTA |
| Col1a1 | GACAGGCGAACAAGGTGACAGAG | CAGGAGAACCAGGAGAACCAGGAG |
| Ibsp | CAGAGGAGGCAAGCGTCACT | GCTGTCTGGGTGCCAACACT |
| Vegf | AGAAGGAGGAGGGCAGAATCATCAC | GGGCACACAGGATGGCTTGAAG |
| Pparg | GGAAAGACAACGGACAAATCAC | TACGGATCGAAACTGGCAC |
| Cebpb | TGAACAAGAACAGCAACGAG | TCACTGGTCACCTCCAGCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, Y.; Liu, Y.; Wang, B.; Tu, X. CHIR99021-Treated Osteocytes with Wnt Activation in 3D-Printed Module Form an Osteogenic Microenvironment for Enhanced Osteogenesis and Vasculogenesis. Int. J. Mol. Sci. 2023, 24, 6008. https://doi.org/10.3390/ijms24066008
Luo Y, Liu Y, Wang B, Tu X. CHIR99021-Treated Osteocytes with Wnt Activation in 3D-Printed Module Form an Osteogenic Microenvironment for Enhanced Osteogenesis and Vasculogenesis. International Journal of Molecular Sciences. 2023; 24(6):6008. https://doi.org/10.3390/ijms24066008
Chicago/Turabian StyleLuo, Yisheng, Yangxi Liu, Bo Wang, and Xiaolin Tu. 2023. "CHIR99021-Treated Osteocytes with Wnt Activation in 3D-Printed Module Form an Osteogenic Microenvironment for Enhanced Osteogenesis and Vasculogenesis" International Journal of Molecular Sciences 24, no. 6: 6008. https://doi.org/10.3390/ijms24066008
APA StyleLuo, Y., Liu, Y., Wang, B., & Tu, X. (2023). CHIR99021-Treated Osteocytes with Wnt Activation in 3D-Printed Module Form an Osteogenic Microenvironment for Enhanced Osteogenesis and Vasculogenesis. International Journal of Molecular Sciences, 24(6), 6008. https://doi.org/10.3390/ijms24066008

