Unfolding Individual Domains of BmrA, a Bacterial ABC Transporter Involved in Multidrug Resistance
Abstract
1. Introduction
2. Results and Discussion
2.1. Urea-Induced Trp Fluorescence Changes Originate Exclusively from the NBD
2.2. SDS-Induced Trp Fluorescence Changes Originate Mainly, but Not Exclusively, from the NBD
2.3. Monitoring the Unfolding of the NBD in the Context of the Full-Length Protein
3. Materials and Methods
3.1. Cloning
3.2. Protein Expression and Purification
3.3. Preparation of Inverted E. coli Membrane Vesicles
3.4. Hoechst 33342 Transport Assay
3.5. SDS-Induced Protein Unfolding
3.6. Urea-Induced Protein Unfolding
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Krogh, A.; Larsson, B.; Von Heijne, G.; Sonnhammer, E.L.L. Predicting Transmembrane Protein Topology with a Hidden Markov Model: Application to Complete Genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef]
- Booth, P.J.; High, S. Polytopic Membrane Protein Folding and Assembly in Vitro and in Vivo. Mol. Membr. Biol. 2004, 21, 163–170. [Google Scholar] [CrossRef] [PubMed]
- Cymer, F.; Von Heijne, G.; White, S.H. Mechanisms of Integral Membrane Protein Insertion and Folding. J. Mol. Biol. 2015, 427, 999–1022. [Google Scholar] [CrossRef]
- Harris, N.J.; Booth, P.J. Folding and Stability of Membrane Transport Proteins in Vitro. Biochim. Biophys. Acta Biomembr. 2012, 1818, 1055–1066. [Google Scholar] [CrossRef]
- Phillips, B.P.; Miller, E.A. Membrane Protein Folding and Quality Control. Curr. Opin. Struct. Biol. 2021, 69, 50–54. [Google Scholar] [CrossRef]
- Harakalova, M.; Van Harssel, J.J.T.; Terhal, P.A.; Van Lieshout, S.; Duran, K.; Renkens, I.; Amor, D.J.; Wilson, L.C.; Kirk, E.P.; Turner, C.L.S.; et al. Dominant Missense Mutations in ABCC9 Cause Cantúsyndrome. Nat. Genet. 2012, 44, 793–796. [Google Scholar] [CrossRef]
- Sanders, C.R.; Myers, J.K. Disease-Related Misassembly of Membrane Proteins. Annu. Rev. Biophys. Biomol. Struct. 2004, 33, 25–51. [Google Scholar] [CrossRef] [PubMed]
- Nagy, J.K.; Lonzer, W.L.; Sanders, C.R. Kinetic Study of Folding and Misfolding of Diacylglycerol Kinase in Model Membranes. Biochemistry 2001, 40, 8971–8980. [Google Scholar] [CrossRef]
- Marinko, J.T.; Huang, H.; Penn, W.D.; Capra, J.A.; Schlebach, J.P.; Sanders, C.R. Folding and Misfolding of Human Membrane Proteins in Health and Disease: From Single Molecules to Cellular Proteostasis. Chem. Rev. 2019, 119, 5537–5606. [Google Scholar] [CrossRef]
- Haltia, T.; Freire, E. Forces and Factors That Contribute to the Structural Stability of Membrane Proteins. Biochim. Biophys. Acta Rev. Biomembr. 1995, 1241, 295–322. [Google Scholar] [CrossRef] [PubMed]
- Corin, K.; Bowie, J.U. How Physical Forces Drive the Process of Helical Membrane Protein Folding. EMBO Rep. 2022, 23, e53025. [Google Scholar] [CrossRef] [PubMed]
- Pace, C.N.; Grimsley, G.R.; Scholtz, J.M. Denaturation of Proteins by Urea and Guanidine Hydrochloride. In Protein Folding Handbook; Buchner, J., Kiefhaber, T., Eds.; Wiley-VCH Verlag GmbH & Co., KGaA: Weinheim, Germany, 2005; Volume 1, pp. 45–69. ISBN 3-527-30784-2. [Google Scholar]
- Findlay, H.E.; Rutherford, N.G.; Henderson, P.J.F.; Booth, P.J. Unfolding Free Energy of a Two-Domain Transmembrane Sugar Transport Protein. Proc. Natl. Acad. Sci. USA 2010, 107, 18451–18456. [Google Scholar] [CrossRef] [PubMed]
- Timasheff, S.N.; Xie, G. Preferential Interactions of Urea with Lysozyme and Their Linkage to Protein Denaturation. Biophys. Chem. 2003, 105, 421–448. [Google Scholar] [CrossRef]
- Renthal, R. An Unfolding Story of Helical Transmembrane Proteins. Biochemistry 2006, 45, 14559–14566. [Google Scholar] [CrossRef] [PubMed]
- Stanley, A.M.; Fleming, K.G. The Process of Folding Proteins into Membranes: Challenges and Progress. Arch. Biochem. Biophys. 2008, 469, 46–66. [Google Scholar] [CrossRef]
- Bennion, B.J.; Daggett, V. The Molecular Basis for the Chemical Denaturation of Proteins by Urea. Proc. Natl. Acad. Sci. USA 2003, 100, 5142–5147. [Google Scholar] [CrossRef]
- Sehgal, P.; Otzen, D.E. Thermodynamics of Unfolding of an Integral Membrane Protein in Mixed Micelles. Protein Sci. 2006, 15, 890–899. [Google Scholar] [CrossRef]
- Otzen, D.E. Folding of DsbB in Mixed Micelles: A Kinetic Analysis of the Stability of a Bacterial Membrane Protein. J. Mol. Biol. 2003, 330, 641–649. [Google Scholar] [CrossRef]
- Hellmann, N.; Schneider, D. A Complex Unfolding Pathway of α-Helical Membrane Proteins in SDS-Containing Micelles. Biophys. J. 2021, 120, 3857–3859. [Google Scholar] [CrossRef]
- Lau, F.W.; Bowie, J.U. A Method for Assessing the Stability of a Membrane Protein. Biochemistry 1997, 36, 5884–5892. [Google Scholar] [CrossRef]
- Anbazhagan, V.; Cymer, F.; Schneider, D. Unfolding a Transmembrane Helix Dimer: A FRET Study in Mixed Micelles. Arch. Biochem. Biophys. 2010, 495, 159–164. [Google Scholar] [CrossRef]
- Fisher, L.E.; Engelman, D.M.; Sturgis, J.N. Effect of Detergents on the Association of the Glycophorin A Transmembrane Helix. Biophys. J. 2003, 85, 3097–3105. [Google Scholar] [CrossRef]
- Mattice, W.L.; Riser, J.M.; Clark, D.S. Conformational Properties of the Complexes Formed by Proteins and Sodium Dodecyl Sulfate. Biochemistry 1976, 15, 4264–4272. [Google Scholar] [CrossRef]
- Popot, J.-L.; Engelman, D.M. Membrane Protein Folding and Oligomerization: The Two-Stage Model. Biochemistry 1990, 29, 4031–4037. [Google Scholar] [CrossRef] [PubMed]
- Ambudkar, S.V.; Kim, I.W.; Xia, D.; Sauna, Z.E. The A-Loop, a Novel Conserved Aromatic Acid Subdomain Upstream of the Walker A Motif in ABC Transporters, Is Critical for ATP Binding. FEBS Lett. 2006, 580, 1049–1055. [Google Scholar] [CrossRef] [PubMed]
- Gorzelle, B.M.; Nagy, J.K.; Oxenoid, K.; Lonzer, W.L.; Cafiso, D.S.; Sanders, C.R. Reconstitutive Refolding of Diacylglycerol Kinase, an Integral Membrane Protein. Biochemistry 1999, 38, 16373–16382. [Google Scholar] [CrossRef] [PubMed]
- Miller, D.; Charalambous, K.; Rotem, D.; Schuldiner, S.; Curnow, P.; Booth, P.J. In Vitro Unfolding and Refolding of the Small Multidrug Transporter EmrE. J. Mol. Biol. 2009, 393, 815–832. [Google Scholar] [CrossRef]
- Renart, M.L.; Barrera, F.N.; Molina, M.L.; Encinar, J.A.; Poveda, J.A.; Fernández, A.M.; Gómez, J.; González-Ros, J.M. Effects of Conducting and Blocking Ions on the Structure and Stability of the Potassium Channel KcsA. J. Biol. Chem. 2006, 281, 29905–29915. [Google Scholar] [CrossRef]
- Shenkarev, Z.O.; Lyukmanova, E.N.; Butenko, I.O.; Petrovskaya, L.E.; Paramonov, A.S.; Shulepko, M.A.; Nekrasova, O.V.; Kirpichnikov, M.P.; Arseniev, A.S. Lipid-Protein Nanodiscs Promote in Vitro Folding of Transmembrane Domains of Multi-Helical and Multimeric Membrane Proteins. Biochim. Biophys. Acta Biomembr. 2013, 1828, 776–784. [Google Scholar] [CrossRef]
- Di Bartolo, N.D.; Booth, P.J. Unravelling the Folding and Stability of an ABC (ATP-Binding Cassette) Transporter. Biochem. Soc. Trans. 2011, 39, 751–760. [Google Scholar] [CrossRef]
- Lorch, M.; Booth, P.J. Insertion Kinetics of a Denatured α Helical Membrane Protein into Phospholipid Bilayer Vesicles. J. Mol. Biol. 2004, 344, 1109–1121. [Google Scholar] [CrossRef] [PubMed]
- Booth, P.J.; Paulsen, H. Assembly of Light-Harvesting Chlorophyll a/b Complex in Vitro. Time-Resolved Fluorescence Measurements. Biochemistry 1996, 35, 5103–5108. [Google Scholar] [CrossRef] [PubMed]
- London, E.; Khorana, H.G. Denaturation and Renaturation of Bacteriorhodopsin in Detergents and Lipid-Detergent Mixtures. J. Biol. Chem. 1982, 257, 7003–7011. [Google Scholar] [CrossRef] [PubMed]
- Veerappan, A.; Cymer, F.; Klein, N.; Schneider, D. The Tetrameric α-Helical Membrane Protein GlpF Unfolds via a Dimeric Folding Intermediate. Biochemistry 2011, 50, 10223–10230. [Google Scholar] [CrossRef] [PubMed]
- Trefz, M.; Keller, R.; Vogt, M.; Schneider, D. The GlpF Residue Trp219 Is Part of an Amino-Acid Cluster Crucial for Aquaglyceroporin Oligomerization and Function. Biochim. Biophys. Acta Biomembr. 2018, 1860, 887–894. [Google Scholar] [CrossRef] [PubMed]
- Weber, M.; Prodöhl, A.; Dreher, C.; Becker, C.; Underhaug, J.; Svane, A.S.P.; Malmendal, A.; Nielsen, N.C.; Otzen, D.; Schneider, D. SDS-Facilitated in Vitro Formation of a Transmembrane B-Type Cytochrome Is Mediated by Changes in Local PH. J. Mol. Biol. 2011, 407, 594–606. [Google Scholar] [CrossRef]
- Van Veen, H.W.; Konings, W.N. Multidrug Transporters from Bacteria to Man: Similarities in Structure and Function. Semin. Cancer Biol. 1997, 8, 183–191. [Google Scholar] [CrossRef]
- Davidson, A.L.; Chen, J. ATP-Binding Cassette Transporters in Bacteria. Annu. Rev. Biochem. 2004, 73, 241–268. [Google Scholar] [CrossRef]
- Gottesman, M.M.; Pastan, I.; Ambudkar, S.V. P-Glycoprotein and Multidrug Resistance. Curr. Opin. Genet. Dev. 1996, 6, 610–617. [Google Scholar] [CrossRef]
- Borst, P.; Elferink, R.O. Mammalian ABC Transporters in Health and Disease. Annu. Rev. Biochem. 2002, 71, 537–592. [Google Scholar] [CrossRef]
- Jones, P.M.; George, A.M. The ABC Transporter Structure and Mechanism: Perspectives on Recent Research. Cell. Mol. Life Sci. 2004, 61, 682–699. [Google Scholar] [CrossRef] [PubMed]
- Gottesman, M.M.; Pastan, I. Biochemistry of Multidrug Resistance Mediated by the Multidrug Transporter. Annu. Rev. Biochem. 1993, 62, 385–427. [Google Scholar] [CrossRef] [PubMed]
- Robey, R.W.; Pluchino, K.M.; Hall, M.D.; Fojo, A.T.; Bates, S.E.; Gottesman, M.M. Revisiting the Role of ABC Transporters in Multidrug-Resistant Cancer. Nat. Rev. Cancer 2018, 18, 452–464. [Google Scholar] [CrossRef]
- Higgins, C.F. ABC Transporters: From Microorganisms to Man. Annu. Rev. Cell Biol. 1992, 8, 67–113. [Google Scholar] [CrossRef] [PubMed]
- Locher, K.P. Mechanistic Diversity in ATP-Binding Cassette (ABC) Transporters. Nat. Struct. Mol. Biol. 2016, 23, 487–493. [Google Scholar] [CrossRef]
- Javed, W.; Vallet, S.; Clement, M.-P.; Le Roy, A.; Moulin, M.; Härtlein, M.; Breyton, C.; Burlet-Schiltz, O.; Marcoux, J.; Orelle, C.; et al. Structural Insights into the Catalytic Cycle of a Bacterial Multidrug ABC Efflux Pump. J. Mol. Biol. 2022, 434, 167541. [Google Scholar] [CrossRef]
- Orelle, C.; Gubellini, F.; Durand, A.; Marco, S.; Lévy, D.; Gros, P.; Di Pietro, A.; Jault, J.M. Conformational Change Induced by ATP Binding in the Multidrug ATP-Binding Cassette Transporter BmrA†. Biochemistry 2008, 47, 2404–2412. [Google Scholar] [CrossRef]
- Higgins, C.F.; Hiles, I.D.; Salmond, G.P.C.; Gill, D.R.; Downie, J.A.; Evans, I.J.; Holland, I.B.; Gray, L.; Buckel, S.D.; Bell, A.W.; et al. A Family of Related ATP-Binding Subunits Coupled to Many Distinct Biological Processes in Bacteria. Nature 1986, 323, 448–450. [Google Scholar] [CrossRef]
- Loo, T.W.; Bartlett, M.C.; Clarke, D.M. Human P-Glycoprotein Contains a Greasy Ball-and-Socket Joint at the Second Transmission Interface. J. Biol. Chem. 2013, 288, 20326–20333. [Google Scholar] [CrossRef]
- Dawson, R.J.P.; Locher, K.P. Structure of a Bacterial Multidrug ABC Transporter. Nature 2006, 443, 180–185. [Google Scholar] [CrossRef]
- Ward, A.B.; Reyes, C.L.; Yu, J.; Roth, C.B.; Chang, G. Flexibility in the ABC Transporter MsbA: Alternating Access with a Twist. Proc. Natl. Acad. Sci. USA 2007, 104, 19005–19010. [Google Scholar] [CrossRef] [PubMed]
- Locher, K.P.; Lee, A.T.; Rees, D.C. The E. Coli BtuCD Structure: A Framework for ABC Transporter Architecture and Mechanism. Science 2002, 296, 1091–1098. [Google Scholar] [CrossRef] [PubMed]
- Chami, M.; Steinfels, E.; Orelle, C.; Jault, J.-M.; Di Pietro, A.; Rigaud, J.-L.; Marco, S. Three-Dimensional Structure by Cryo-Electron Microscopy of YvcC, an Homodimeric ATP-Binding Cassette Transporter from Bacillus subtilis. J. Mol. Biol. 2002, 315, 1075–1085. [Google Scholar] [CrossRef]
- Chaptal, V.; Zampieri, V.; Wiseman, B.; Orelle, C.; Martin, J.; Nguyen, K.; Gobet, A.; Di Cesare, M.; Magnard, S.; Javed, W.; et al. Substrate-Bound and Substrate-Free Outward-Facing Structures of a Multidrug ABC Exporter. Sci. Adv. 2022, 8, eabg9215. [Google Scholar] [CrossRef]
- Thomas, C.; Aller, S.G.; Beis, K.; Carpenter, E.P.; Chang, G.; Chen, L.; Dassa, E.; Dean, M.; Duong Van Hoa, F.; Ekiert, D.; et al. Structural and Functional Diversity Calls for a New Classification of ABC Transporters. FEBS Lett. 2020, 594, 3767–3775. [Google Scholar] [CrossRef] [PubMed]
- Thomas, C.; Tampé, R. Structural and Mechanistic Principles of ABC Transporters. Annu. Rev. Biochem. 2020, 89, 605–636. [Google Scholar] [CrossRef] [PubMed]
- Eftink, M.R. The Use of Fluorescence Methods to Monitor Unfolding Transitions in Proteins. Biophys. J. 1994, 66, 482–501. [Google Scholar] [CrossRef]
- Vivian, J.T.; Callis, P.R. Mechanisms of Tryptophan Fluorescence Shifts in Proteins. Biophys. J. 2001, 80, 2093–2109. [Google Scholar] [CrossRef]
- Steinfels, E.; Orelle, C.; Dalmas, O.; Penin, F.; Miroux, B.; Di Pietro, A.; Jault, J.M. Highly Efficient Over-Production in E. Coli of YvcC, a Multidrug-like ATP-Binding Cassette Transporter from Bacillus subtilis. Biochim. Biophys. Acta Biomembr. 2002, 1565, 1–5. [Google Scholar] [CrossRef]
- Oepen, K.; Özbek, H.; Schüffler, A.; Liermann, J.C.; Thines, E.; Schneider, D. Myristic Acid Inhibits the Activity of the Bacterial ABC Transporter BmrA. Int. J. Mol. Sci. 2021, 22, 13565. [Google Scholar] [CrossRef]
- Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The Proteomics Server for in-Depth Protein Knowledge and Analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [Google Scholar] [CrossRef] [PubMed]
- Pace, C.N. Determination and Analysis of Urea and Guanidine Hydrochloride Denaturation Curves. Methods Enzymol. 1986, 131, 266–280. [Google Scholar] [CrossRef] [PubMed]
Primer | 5′-Sequence-3′ |
---|---|
QC W104A fw | CTGCGGGAGTTATTAGCGAAGAAATTAATTAAG |
QC W104A rev | CTTAATTAATTTCTTCGCTAATAACTCCCGCAG |
QC W104F fw | CTGCGGGAGTTATTATTTAAGAAATTAATTAAG |
QC W104F rev | CTTAATTAATTTCTTAAATAATAACTCCCGCAG |
QC W104Y fw | CTGCGGGAGTTATTATATAAGAAATTAATTAAG |
QC W104Y rev | CTTAATTAATTTCTTATATAATAACTCCCGCAG |
QC W164A fw | CTTGTTTATTATGAACGCGAAGCTGACACTGCTTG |
QC W164A rev | CAAGCAGTGTCAGCTTCGCGTTCATAATAAACAAG |
QC W164F fw | CTTGTTTATTATGAACTTTAAGCTGACACTGCTTG |
QC W164F rev | CAAGCAGTGTCAGCTTAAAGTTCATAATAAACAAG |
QC W164Y fw | CTTGTTTATTATGAACTATAAGCTGACACTGCTTG |
QC W164Y rev | CAAGCAGTGTCAGCTTATAGTTCATAATAAACAAG |
QC W413A fw | CGCTTGAATCGGCGAGGGAGCATATC |
QC W413A rev | GATATGCTCCCTCGCCGATTCAAGCG |
QC W413F fw | CTCGCTTGAATCGTTTAGGGAGCATATCGGG |
QC W413F rev | CCCGATATGCTCCCTAAACGATTCAAGCGAG |
QC W413Y fw | CTCGCTTGAATCGTATAGGGAGCATATCGGG |
QC W413Y rev | CCCGATATGCTCCCTATACGATTCAAGCGAG |
BmrA TMD XbaI fw | GGCCATTCTAGAATGCCAACCAAGAAACAAAAATC |
BmrA TMD XhoI rev | GCGCGCCTCGAGTCCTGTCACTGTATCTTCCTC |
BmrA NBD XbaI fw | GCGCGCTCTAGAATGAAACAAATTGAAAATGCAC |
BmrA NBD XhoI rev | GGCCATCTCGAGCCCGGCTTTGTTTTCTAAGTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oepen, K.; Mater, V.; Schneider, D. Unfolding Individual Domains of BmrA, a Bacterial ABC Transporter Involved in Multidrug Resistance. Int. J. Mol. Sci. 2023, 24, 5239. https://doi.org/10.3390/ijms24065239
Oepen K, Mater V, Schneider D. Unfolding Individual Domains of BmrA, a Bacterial ABC Transporter Involved in Multidrug Resistance. International Journal of Molecular Sciences. 2023; 24(6):5239. https://doi.org/10.3390/ijms24065239
Chicago/Turabian StyleOepen, Kristin, Veronika Mater, and Dirk Schneider. 2023. "Unfolding Individual Domains of BmrA, a Bacterial ABC Transporter Involved in Multidrug Resistance" International Journal of Molecular Sciences 24, no. 6: 5239. https://doi.org/10.3390/ijms24065239
APA StyleOepen, K., Mater, V., & Schneider, D. (2023). Unfolding Individual Domains of BmrA, a Bacterial ABC Transporter Involved in Multidrug Resistance. International Journal of Molecular Sciences, 24(6), 5239. https://doi.org/10.3390/ijms24065239