Porcine Epidemic Diarrhea Virus and Its nsp14 Suppress ER Stress Induced GRP78
Abstract
1. Introduction
2. Results
2.1. ER Stress Inhibits PEDV Propagation
2.2. PEDV Suppresses GRP78 Expression
2.3. PEDV nsp14 Inhibits GRP78
2.4. PEDV nsp14 N7-MTase Domain Is Crucial for Inhibiting GRP78
2.5. PEDV and Its nsp14 inhibit GRP78 by Regulating Cellular Translation
2.6. PEDV nsp14 Subcellular Localization
2.7. PEDV nsp14 Inhibits the Activity of GRP78 Promoter
3. Discussion
4. Materials and Methods
4.1. Viruses, Cells, Reagents, and Consumables
4.2. Cell Counting kit-8 Assay
4.3. TCID50 Assay
4.4. Transfection
4.5. Indirect Immunofluorescence Assay
4.6. Western Blot
4.7. Reverse-Transcription Quantitative PCR
4.8. Puromycin Incorporation Assay
4.9. Flow Cytometry
4.10. Luciferase Reporter Assay
4.11. Significant Difference Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, D.; Fang, L.; Xiao, S. Porcine epidemic diarrhea in China. Virus Res. 2016, 226, 7–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Ma, Z.; Li, Y.; Gao, S.; Xiao, S. Porcine epidemic diarrhea virus: Molecular mechanisms of attenuation and vaccines. Microb. Pathog. 2020, 149, 104553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sueyoshi, M.; Tsuda, T.; Yamazaki, K.; Yoshida, K.; Nakazawa, M.; Sato, K.; Minami, T.; Iwashita, K.; Watanabe, M.; Suzuki, Y.; et al. An immunohistochemical investigation of porcine epidemic diarrhoea. J. Comp. Pathol. 1995, 113, 59–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.; Li, H.; Liu, Y.; Pan, Y.; Deng, F.; Song, Y.; Tang, X.; He, Q. New variants of porcine epidemic diarrhea virus, China, 2011. Emerg. Infect. Dis. 2012, 18, 1350–1353. [Google Scholar] [CrossRef] [Scilit]
- Wood, E.N. An apparently new syndrome of porcine epidemic diarrhoea. Vet. Rec. 1977, 100, 243–244. [Google Scholar] [CrossRef] [Scilit]
- Sun, R.Q.; Cai, R.J.; Chen, Y.Q.; Liang, P.S.; Chen, D.K.; Song, C.X. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg. Infect. Dis. 2012, 18, 161–163. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.W.; Dickerman, A.W.; Piñeyro, P.; Li, L.; Fang, L.; Kiehne, R.; Opriessnig, T.; Meng, X.J. Origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. mBio 2013, 4, e00737-13. [Google Scholar] [CrossRef] [Scilit]
- Lee, C. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol. J. 2015, 12, 193. [Google Scholar] [CrossRef] [Scilit]
- Antas, M.; Woźniakowski, G. Current Status of Porcine Epidemic Diarrhoea (PED) in European Pigs. J. Vet. Res. 2019, 63, 465–470. [Google Scholar] [CrossRef] [Scilit]
- Schulz, L.L.; Tonsor, G.T. Assessment of the economic impacts of porcine epidemic diarrhea virus in the United States. J. Anim. Sci. 2015, 93, 5111–5118. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Kong, N.; Jiao, Y.; Dong, S.; Sun, D.; Chen, X.; Zheng, H.; Tong, W.; Yu, H.; Yu, L.; et al. EGR1 Suppresses Porcine Epidemic Diarrhea Virus Replication by Regulating IRAV To Degrade Viral Nucleocapsid Protein. J. Virol. 2021, 95, e00645-21. [Google Scholar] [CrossRef] [Scilit]
- Su, M.; Li, C.; Qi, S.; Yang, D.; Sun, D. A molecular epidemiological investigation of PEDV in China: Characterization of co-infection and genetic diversity of S1-based genes. Transbound. Emerg. Dis. 2019, 67, 1129–1140. [Google Scholar] [CrossRef] [Scilit]
- Zhu, T.; Du, S.; Cao, D.; Pei, Z.; Guo, Y.; Shao, H.; Wang, H.; Wang, K.; Hu, G. Isolation and identification of a variant subtype G 2b porcine epidemic diarrhea virus and S gene sequence characteristic. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2019, 71, 82–90. [Google Scholar] [CrossRef] [Scilit]
- Huan, C.; Pan, H.; Fu, S.; Xu, W.; Liu, X. Characterization and evolution of the coronavirus porcine epidemic diarrhoea virus HLJBY isolated in China. Transbound. Emerg. Dis. 2020, 67, 65–79. [Google Scholar] [CrossRef] [Scilit]
- Sano, R.; Reed, J.C. ER stress-induced cell death mechanisms. Biochim. Et Biophys. Acta 2013, 1833, 3460–3470. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Kaufman, R.J. Protein misfolding in the endoplasmic reticulum as a conduit to human disease. Nature 2016, 529, 326–335. [Google Scholar] [CrossRef] [Scilit]
- Ellgaard, L.; McCaul, N.; Chatsisvili, A.; Braakman, I. Co- and Post-Translational Protein Folding in the ER. Traffic 2016, 17, 615–638. [Google Scholar] [CrossRef] [Scilit]
- Rashid, H.O.; Yadav, R.K.; Kim, H.R.; Chae, H.J. ER stress: Autophagy induction, inhibition and selection. Autophagy 2015, 11, 1956–1977. [Google Scholar] [CrossRef] [Scilit]
- Karagöz, G.E.; Acosta-Alvear, D.; Walter, P. The Unfolded Protein Response: Detecting and Responding to Fluctuations in the Protein-Folding Capacity of the Endoplasmic Reticulum. Cold Spring Harb. Perspect. Biol. 2019, 11, a033886. [Google Scholar] [CrossRef] [Scilit]
- Han, C.Y.; Lim, S.W.; Koo, J.H.; Kim, W.; Kim, S.G. PHLDA3 overexpression in hepatocytes by endoplasmic reticulum stress via IRE1-Xbp1s pathway expedites liver injury. Gut 2016, 65, 1377–1388. [Google Scholar] [CrossRef] [Scilit]
- Muñoz, J.P.; Ivanova, S.; Sánchez-Wandelmer, J.; Martínez-Cristóbal, P.; Noguera, E.; Sancho, A.; Díaz-Ramos, A.; Hernández-Alvarez, M.I.; Sebastián, D.; Mauvezin, C.; et al. Mfn2 modulates the UPR and mitochondrial function via repression of PERK. EMBO J. 2013, 32, 2348–2361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, H.J.; Park, J.Y.; Kim, J.W.; Yang, S.G.; Jung, J.M.; Kim, M.J.; Kang, M.J.; Cho, Y.H.; Wee, G.; Yang, H.Y.; et al. Melatonin improves the meiotic maturation of porcine oocytes by reducing endoplasmic reticulum stress during in vitro maturation. J. Pineal Res. 2018, 64, e12458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, S.; Ye, H.; Cui, Y.; Jiang, L. AtSec62 is critical for plant development and is involved in ER-phagy in Arabidopsis thaliana. J. Integr. Plant Biol. 2020, 62, 181–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishigaki, S.; Fonseca, S.G.; Oslowski, C.M.; Jurczyk, A.; Shearstone, J.R.; Zhu, L.J.; Permutt, M.A.; Greiner, D.L.; Bortell, R.; Urano, F. AATF mediates an antiapoptotic effect of the unfolded protein response through transcriptional regulation of AKT1. Cell Death Differ. 2010, 17, 774–786. [Google Scholar] [CrossRef] [Scilit]
- Phoomak, C.; Cui, W.; Hayman, T.J.; Yu, S.H.; Zhao, P. The translocon-associated protein (TRAP) complex regulates quality control of N-linked glycosylation during ER stress. Sci. Adv. 2021, 7, eabc6364. [Google Scholar] [CrossRef] [Scilit]
- Masciarelli, S.; Capuano, E.; Ottone, T.; Divona, M.; De Panfilis, S.; Banella, C.; Noguera, N.I.; Picardi, A.; Fontemaggi, G.; Blandino, G.; et al. Retinoic acid and arsenic trioxide sensitize acute promyelocytic leukemia cells to ER stress. Leukemia 2018, 32, 285–294. [Google Scholar] [CrossRef] [Scilit]
- Di Prisco, G.V.; Huang, W.; Buffington, S.A. Translational control of mGluR-dependent long-term depression and object-place learning by eIF2α. Nat. Neurosci. 2014, 17, 1073–1082. [Google Scholar] [CrossRef] [Scilit]
- Raab, M.S.; Breitkreutz, I.; Tonon, G.; Zhang, J.; Hayden, P.J.; Nguyen, T.; Fruehauf, J.H.; Lin, B.K.; Chauhan, D.; Hideshima, T.; et al. Targeting PKC: A novel role for beta-catenin in ER stress and apoptotic signaling. Blood 2009, 113, 1513–1521. [Google Scholar] [CrossRef] [Scilit]
- Kupsco, A.; Schlenk, D. Mechanisms of selenomethionine developmental toxicity and the impacts of combined hypersaline conditions on Japanese medaka (Oryzias latipes). Environ. Sci. Technol. 2014, 48, 7062–7068. [Google Scholar] [CrossRef] [Scilit]
- Rutkowski, D.T.; Arnold, S.M.; Miller, C.N.; Wu, J.; Li, J.; Gunnison, K.M.; Mori, K.; Sadighi Akha, A.A.; Raden, D.; Kaufman, R.J. Adaptation to ER stress is mediated by differential stabilities of pro-survival and pro-apoptotic mRNAs and proteins. PLoS Biol. 2006, 4, e374. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Ni, M.; Lee, B.; Barron, E.; Hinton, D.R.; Lee, A.S. The unfolded protein response regulator GRP78/BiP is required for endoplasmic reticulum integrity and stress-induced autophagy in mammalian cells. Cell Death Differ. 2008, 15, 1460–1471. [Google Scholar] [CrossRef] [Scilit]
- Shen, J.; Xu, R.; Mai, J.; Kim, H.C.; Guo, X.; Qin, G.; Yang, Y.; Wolfram, J.; Mu, C.; Xia, X.; et al. High capacity nanoporous silicon carrier for systemic delivery of gene silencing therapeutics. ACS Nano 2013, 7, 9867–9880. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, I.M.; Abdelmalek, D.H.; Elfiky, A.A. GRP78: A cell’s response to stress. Life Sci. 2019, 226, 156–163. [Google Scholar] [CrossRef] [Scilit]
- Lindquist, S.; Craig, E.A. The heat-shock proteins. Annu. Rev. Genet. 1988, 22, 631–677. [Google Scholar] [CrossRef]
- Lindstedt, P.R.; Aprile, F.A.; Matos, M.J.; Perni, M.; Bertoldo, J.B.; Bernardim, B.; Peter, Q.; Jiménez-Osés, G.; Knowles, T.P.J.; Dobson, C.M.; et al. Enhancement of the Anti-Aggregation Activity of a Molecular Chaperone Using a Rationally Designed Post-Translational Modification. ACS Cent. Sci. 2019, 5, 1417–1424. [Google Scholar] [CrossRef] [Scilit]
- Ji, C.; Kaplowitz, N.; Lau, M.Y.; Kao, E.; Petrovic, L.M.; Lee, A.S. Liver-specific loss of glucose-regulated protein 78 perturbs the unfolded protein response and exacerbates a spectrum of liver diseases in mice. Hepatology 2011, 54, 229–239. [Google Scholar] [CrossRef] [Scilit]
- Haas, I.G. BiP—A heat shock protein involved in immunoglobulin chain assembly. Curr. Top. Microbiol. Immunol. 1991, 167, 71–82. [Google Scholar] [CrossRef] [Scilit]
- Lodhi, I.J.; Wei, X.; Yin, L.; Feng, C.; Adak, S.; Abou-Ezzi, G.; Hsu, F.F.; Link, D.C.; Semenkovich, C.F. Peroxisomal lipid synthesis regulates inflammation by sustaining neutrophil membrane phospholipid composition and viability. Cell Metab. 2015, 21, 51–64. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.H.; Eu, Y.J.; Yoo, C.M.; Kim, Y.W.; Pih, K.T.; Jin, J.B.; Kim, S.J.; Stenmark, H.; Hwang, I. Trafficking of phosphatidylinositol 3-phosphate from the trans-Golgi network to the lumen of the central vacuole in plant cells. Plant Cell 2001, 13, 287–301. [Google Scholar] [CrossRef] [Scilit]
- Quillard, T.; Araújo, H.A.; Franck, G.; Shvartz, E.; Sukhova, G.; Libby, P. TLR2 and neutrophils potentiate endothelial stress, apoptosis and detachment: Implications for superficial erosion. Eur. Heart J. 2015, 36, 1394–1404. [Google Scholar] [CrossRef] [Scilit]
- Shaban, M.S.; Müller, C. Multi-level inhibition of coronavirus replication by chemical ER stress. Nat. Commun. 2021, 12, 5536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Beltagi, S.; Preda, C.A.; Goulding, L.V.; James, J.; Pu, J.; Skinner, P.; Jiang, Z.; Wang, B.L.; Yang, J.; Banyard, A.C.; et al. Thapsigargin Is a Broad-Spectrum Inhibitor of Major Human Respiratory Viruses: Coronavirus, Respiratory Syncytial Virus and Influenza A Virus. Viruses 2021, 13, 234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zode, G.S.; Kuehn, M.H.; Nishimura, D.Y.; Searby, C.C.; Mohan, K.; Grozdanic, S.D.; Bugge, K.; Anderson, M.G.; Clark, A.F.; Stone, E.M.; et al. Reduction of ER stress via a chemical chaperone prevents disease phenotypes in a mouse model of primary open angle glaucoma. J. Clin. Investig. 2011, 121, 3542–3553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oslowski, C.M.; Urano, F. Measuring ER stress and the unfolded protein response using mammalian tissue culture system. Methods Enzymol. 2011, 490, 71–92. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez-Cotto, R.I.; Ortiz-Martínez, M.G.; Rivera-Ramírez, E.; Mateus, V.L.; Amaral, B.S.; Jiménez-Vélez, B.D.; Gioda, A. Particle pollution in Rio de Janeiro, Brazil: Increase and decrease of pro-inflammatory cytokines IL-6 and IL-8 in human lung cells. Environ. Pollut. 2014, 194, 112–120. [Google Scholar] [CrossRef] [Scilit]
- Ha, S.W.; Jang, H.L.; Nam, K.T.; Beck, G.R., Jr. Nano-hydroxyapatite modulates osteoblast lineage commitment by stimulation of DNA methylation and regulation of gene expression. Biomaterials 2015, 65, 32–42. [Google Scholar] [CrossRef] [Scilit]
- Kong, N.; Shan, T.; Wang, H.; Jiao, Y.; Zuo, Y. BST2 suppresses porcine epidemic diarrhea virus replication by targeting and degrading virus nucleocapsid protein with selective autophagy. Autophagy 2020, 16, 1737–1752. [Google Scholar] [CrossRef] [Scilit]
- Dong, S.; Kong, N.; Qin, W.; Zhai, H.; Zhai, X.; Yang, X.; Ye, C.; Ye, M.; Liu, C.; Yu, L.; et al. ATG4B hinders porcine epidemic diarrhea virus replication through interacting with TRAF3 and activating type-I IFN signaling. Vet. Microbiol. 2022, 273, 109544. [Google Scholar] [CrossRef] [Scilit]
- Bouvet, M.; Imbert, I.; Subissi, L.; Gluais, L.; Canard, B.; Decroly, E. RNA 3’-end mismatch excision by the severe acute respiratory syndrome coronavirus nonstructural protein nsp10/nsp14 exoribonuclease complex. Proc. Natl. Acad. Sci. USA 2012, 109, 9372–9377. [Google Scholar] [CrossRef] [Scilit]
- Snijder, E.J.; Decroly, E.; Ziebuhr, J. The Nonstructural Proteins Directing Coronavirus RNA Synthesis and Processing. Adv. Virus Res. 2016, 96, 59–126. [Google Scholar] [CrossRef] [Scilit]
- Niu, X.; Kong, F.; Hou, Y.J.; Wang, Q. Crucial mutation in the exoribonuclease domain of nsp14 of PEDV leads to high genetic instability during viral replication. Cell Biosci. 2021, 11, 106. [Google Scholar] [CrossRef] [Scilit]
- Robson, F.; Khan, K.S.; Le, T.K.; Paris, C.; Demirbag, S.; Barfuss, P.; Rocchi, P.; Ng, W.L. Coronavirus RNA Proofreading: Molecular Basis and Therapeutic Targeting. Mol. Cell 2020, 79, 710–727. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Cai, H.; Lu, M.; Ma, Y.; Li, A.; Gao, Y.; Zhou, J. Porcine Epidemic Diarrhea Virus Deficient in RNA Cap Guanine-N-7 Methylation Is Attenuated and Induces Higher Type I and III Interferon Responses. J. Virol. 2020, 94, e00447-20. [Google Scholar] [CrossRef] [Scilit]
- Hsu, J.C.; Laurent-Rolle, M.; Pawlak, J.B. Translational shutdown and evasion of the innate immune response by SARS-CoV-2 NSP14 protein. Proc. Natl. Acad. Sci. USA 2021, 118, e2101161118. [Google Scholar] [CrossRef] [Scilit]
- Thoms, M.; Buschauer, R. Structural basis for translational shutdown and immune evasion by the Nsp1 protein of SARS-CoV-2. Science 2020, 369, 1249–1255. [Google Scholar] [CrossRef] [Scilit]
- Smith, M.; Wilkinson, S. ER homeostasis and autophagy. Essays Biochem. 2017, 61, 625–635. [Google Scholar] [CrossRef] [Scilit]
- Xue, M.; Fu, F.; Ma, Y.; Zhang, X.; Li, L.; Feng, L.; Liu, P. The PERK Arm of the Unfolded Protein Response Negatively Regulates Transmissible Gastroenteritis Virus Replication by Suppressing Protein Translation and Promoting Type I Interferon Production. J. Virol. 2018, 92, e00431-18. [Google Scholar] [CrossRef] [Scilit]
- Eckard, S.C.; Rice, G.I.; Fabre, A.; Badens, C.; Gray, E.E.; Hartley, J.L.; Crow, Y.J.; Stetson, D.B. The SKIV2L RNA exosome limits activation of the RIG-I-like receptors. Nat. Immunol. 2014, 15, 839–845. [Google Scholar] [CrossRef] [Scilit]
- Taylor, G.M.; Raghuwanshi, S.K.; Rowe, D.T.; Wadowsky, R.M.; Rosendorff, A. Endoplasmic reticulum stress causes EBV lytic replication. Blood 2011, 118, 5528–5539. [Google Scholar] [CrossRef] [Scilit]
- Pfaffenbach, K.T.; Lee, A.S. The critical role of GRP78 in physiologic and pathologic stress. Curr. Opin. Cell Biol. 2011, 23, 150–156. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Wey, S.; Zhang, Y.; Ye, R.; Lee, A.S. Role of the unfolded protein response regulator GRP78/BiP in development, cancer, and neurological disorders. Antioxid. Redox Signal. 2009, 11, 2307–2316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nain, M.; Mukherjee, S.; Karmakar, S.P.; Paton, A.W.; Paton, J.C.; Abdin, M.Z.; Basu, A.; Kalia, M.; Vrati, S. GRP78 Is an Important Host Factor for Japanese Encephalitis Virus Entry and Replication in Mammalian Cells. J. Virol. 2017, 91, e02274-16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jindadamrongwech, S.; Thepparit, C.; Smith, D.R. Identification of GRP 78 (BiP) as a liver cell expressed receptor element for dengue virus serotype 2. Arch. Virol. 2004, 149, 915–927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ojha, C.R.; Rodriguez, M.; Lapierre, J.; Muthu Karuppan, M.K.; Branscome, H.; Kashanchi, F.; El-Hage, N. Complementary Mechanisms Potentially Involved in the Pathology of Zika Virus. Front. Immunol. 2018, 9, 2340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chu, H.; Chan, C.M.; Zhang, X.; Wang, Y.; Yuan, S.; Zhou, J.; Au-Yeung, R.K.; Sze, K.H.; Yang, D.; Shuai, H.; et al. Middle East respiratory syndrome coronavirus and bat coronavirus HKU9 both can utilize GRP78 for attachment onto host cells. J. Biol. Chem. 2018, 293, 11709–11726. [Google Scholar] [CrossRef] [Scilit]
- Shahriari-Felordi, M.; Alikhani, H.K.; Hashemian, S.R.; Hassan, M.; Vosough, M. Mini review ATF4 and GRP78 as novel molecular targets in ER-Stress modulation for critical COVID-19 patients. Mol. Biol. Rep. 2022, 49, 1545–1549. [Google Scholar] [CrossRef] [Scilit]
- Huang, H.; Kang, R.; Wang, J.; Luo, G.; Yang, W.; Zhao, Z. Hepatitis C virus inhibits AKT-tuberous sclerosis complex (TSC), the mechanistic target of rapamycin (MTOR) pathway, through endoplasmic reticulum stress to induce autophagy. Autophagy 2013, 9, 175–195. [Google Scholar] [CrossRef] [Scilit]
- Turpin, J.; El-Safadi, D.; Lebeau, G.; Frumence, E.; Desprès, P.; Viranaïcken, W.; Krejbich-Trotot, P. CHOP Pro-Apoptotic Transcriptional Program in Response to ER Stress Is Hacked by Zika Virus. Int. J. Mol. Sci. 2021, 22, 3750. [Google Scholar] [CrossRef] [Scilit]
- Urano, F.; Wang, X.; Bertolotti, A.; Zhang, Y.; Chung, P.; Harding, H.P.; Ron, D. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 2000, 287, 664–666. [Google Scholar] [CrossRef] [Scilit]
- Tang, B.S.; Chan, K.H.; Cheng, V.C.; Woo, P.C.; Lau, S.K.; Lam, C.C.; Chan, T.L.; Wu, A.K.; Hung, I.F.; Leung, S.Y.; et al. Comparative host gene transcription by microarray analysis early after infection of the Huh7 cell line by severe acute respiratory syndrome coronavirus and human coronavirus 229E. J. Virol. 2005, 79, 6180–6193. [Google Scholar] [CrossRef] [Scilit]
- Versteeg, G.A.; van de Nes, P.S.; Bredenbeek, P.J.; Spaan, W.J. The coronavirus spike protein induces endoplasmic reticulum stress and upregulation of intracellular chemokine mRNA concentrations. J. Virol. 2007, 81, 10981–10990. [Google Scholar] [CrossRef] [Scilit]
- Liao, Y.; Fung, T.S.; Huang, M.; Fang, S.G.; Zhong, Y.; Liu, D.X. Upregulation of CHOP/GADD153 during coronavirus infectious bronchitis virus infection modulates apoptosis by restricting activation of the extracellular signal-regulated kinase pathway. J. Virol. 2013, 87, 8124–8134. [Google Scholar] [CrossRef] [Scilit]
- Yuen, C.K.; Lam, J.Y.; Wong, W.M.; Mak, L.F.; Wang, X.; Chu, H.; Cai, J.P.; Jin, D.Y.; To, K.K.; Chan, J.F.; et al. SARS-CoV-2 nsp13, nsp14, nsp15 and orf6 function as potent interferon antagonists. Emerg. Microbes Infect. 2020, 9, 1418–1428. [Google Scholar] [CrossRef] [Scilit]
- Ma, P.; Gu, K.; Li, H.; Zhao, Y.; Li, C.; Wen, R.; Zhou, C.; Lei, C.; Yang, X.; Wang, H. Infectious Bronchitis Virus Nsp14 Degrades JAK1 to Inhibit the JAK-STAT Signaling Pathway in HD11 Cells. Viruses 2022, 14, 1045. [Google Scholar] [CrossRef] [Scilit]
- Case, J.B.; Li, Y.; Elliott, R.; Lu, X.; Graepel, K.W.; Sexton, N.R.; Smith, E.C.; Weiss, S.R.; Denison, M.R. Murine Hepatitis Virus nsp14 Exoribonuclease Activity Is Required for Resistance to Innate Immunity. J. Virol. 2018, 92, e01531-17. [Google Scholar] [CrossRef] [Scilit]
- Pan, R.; Kindler, E.; Cao, L.; Zhou, Y.; Zhang, Z.; Liu, Q.; Ebert, N.; Züst, R.; Sun, Y.; Gorbalenya, A.E.; et al. N7-Methylation of the Coronavirus RNA Cap Is Required for Maximal Virulence by Preventing Innate Immune Recognition. mBio 2022, 13, e0366221. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Kiledjian, M. Decapping the message: A beginning or an end. Biochem. Soc. Trans. 2006, 34, 35–38. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, X. A putative nucleoporin 96 Is required for both basal defense and constitutive resistance responses mediated by suppressor of npr1-1,constitutive 1. Plant Cell 2005, 17, 1306–1316. [Google Scholar] [CrossRef] [Scilit]
- Jiang, J.; Zhang, C.; Wang, X. A recently evolved isoform of the transcription factor BES1 promotes brassinosteroid signaling and development in Arabidopsis thaliana. Plant Cell 2015, 27, 361–374. [Google Scholar] [CrossRef] [Scilit]
- Singh, S.; Singh, T.G. Role of Nuclear Factor Kappa B (NF-κB) Signalling in Neurodegenerative Diseases: An Mechanistic Approach. Curr. Neuropharmacol. 2020, 18, 918–935. [Google Scholar] [CrossRef] [Scilit]
- Guo, Y.; Kang, W.; Lei, X.; Li, Y.; Xiang, A.; Liu, Y.; Zhao, J.; Zhang, J.; Yan, Z. Hepatitis B viral core protein disrupts human host gene expression by binding to promoter regions. BMC Genom. 2012, 13, 563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Owen, D.R.; Allerton, C.M.N.; Anderson, A.S.; Aschenbrenner, L.; Avery, M.; Berritt, S.; Boras, B.; Cardin, R.D.; Carlo, A.; Coffman, K.J.; et al. An oral SARS-CoV-2 M(pro) inhibitor clinical candidate for the treatment of COVID-19. Science 2021, 374, 1586–1593. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Primer | Sequence (5′–3′) |
|---|---|
| PEDV F | CGTACAGGTAAGTCAATTAC |
| PEDV R | GATGAAGCATTGACTGAA |
| PEDV probe-M | FAM-TTCGTCACAGTCGCCAAGG-TAMRA |
| Human-GRP78-F | CATCAACGAGCCTACGGCA |
| Human-GRP78-R | AGACACATCGAAGGTTCCGC |
| Human-GAPDH-F | CACCATCTTCCAGGAGCGA |
| Human-GAPDH-R | ATGACGAACATGGGGGCATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zeng, W.; Ren, J.; Yang, G.; Jiang, C.; Dong, L.; Sun, Q.; Hu, Y.; Li, W.; He, Q. Porcine Epidemic Diarrhea Virus and Its nsp14 Suppress ER Stress Induced GRP78. Int. J. Mol. Sci. 2023, 24, 4936. https://doi.org/10.3390/ijms24054936
Zeng W, Ren J, Yang G, Jiang C, Dong L, Sun Q, Hu Y, Li W, He Q. Porcine Epidemic Diarrhea Virus and Its nsp14 Suppress ER Stress Induced GRP78. International Journal of Molecular Sciences. 2023; 24(5):4936. https://doi.org/10.3390/ijms24054936
Chicago/Turabian StyleZeng, Wei, Jingping Ren, Gan Yang, Changsheng Jiang, Ling Dong, Qi Sun, Yaofang Hu, Wentao Li, and Qigai He. 2023. "Porcine Epidemic Diarrhea Virus and Its nsp14 Suppress ER Stress Induced GRP78" International Journal of Molecular Sciences 24, no. 5: 4936. https://doi.org/10.3390/ijms24054936
APA StyleZeng, W., Ren, J., Yang, G., Jiang, C., Dong, L., Sun, Q., Hu, Y., Li, W., & He, Q. (2023). Porcine Epidemic Diarrhea Virus and Its nsp14 Suppress ER Stress Induced GRP78. International Journal of Molecular Sciences, 24(5), 4936. https://doi.org/10.3390/ijms24054936

