CREB Is Activated by the SCF/KIT Axis in a Partially ERK-Dependent Manner and Orchestrates Survival and the Induction of Immediate Early Genes in Human Skin Mast Cells
Abstract
:1. Introduction
2. Results
2.1. SCF-Triggered KIT Activation Increases CREB Phosphorylation
2.2. SCF-Induced CREB Phosphorylation Depends on ERK1/2 Activity but Not on Other MAPKs (Mitogen-Activated Protein Kinases), PKA (Protein Kinase A) or PI3K (Phosphatidylinositol-4,5-Bisphosphate 3-Kinase)
2.3. CREB Is Phosphorylated Downstream of the IL-33/ST2 Axis
2.4. CREB Is Constitutively Present in the Nucleus Where it Incurs Phosphorylation following Activation
2.5. ERK Is Constitutively Present in the skMC Nucleus Where it Becomes Phosphorylated following KIT Activation
2.6. CREB Orchestrates skMC Survival Downstream of KIT
2.7. CREB Is Indispesable for The induction of Immediate Early Genes (IEGs)
3. Discussion
4. Materials and Methods
4.1. Cells and Treatments
4.2. Immunoblot Analysis
4.3. Cell Recaovery
4.4. YoPro-1/Propidium Iodide (PI) Staining
4.5. Reverse Transcription-Quantitative PCR (RT-qPCR)
4.6. Accell® Mediated RNA Interference
4.7. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Metcalfe, D.D.; Peavy, R.D.; Gilfillan, A.M. Mechanisms of mast cell signaling in anaphylaxis. J. Allergy Clin. Immunol. 2009, 124, 639–646. [Google Scholar] [CrossRef] [Green Version]
- Galli, S.J.; Tsai, M. IgE and mast cells in allergic disease. Nat. Med. 2012, 18, 693–704. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoffmann, H.J. News in Cellular Allergology: A Review of the Human Mast Cell and Basophil Granulocyte Literature from January 2013 to May 2015. Int. Arch. Allergy Immunol 2015, 168, 253–262. [Google Scholar] [CrossRef] [PubMed]
- Erjefalt, J.S. Mast cells in human airways: The culprit? Eur. Respir. Rev. 2014, 23, 299–307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Steinhoff, M.; Neisius, U.; Ikoma, A.; Fartasch, M.; Heyer, G.; Skov, P.S.; Luger, T.A.; Schmelz, M. Proteinase-activated receptor-2 mediates itch: A novel pathway for pruritus in human skin. J. Neurosci 2003, 23, 6176–6180. [Google Scholar] [CrossRef] [Green Version]
- Tey, H.L.; Yosipovitch, G. Targeted treatment of pruritus: A look into the future. Br. J. Dermatol 2011, 165, 5–17. [Google Scholar] [CrossRef] [Green Version]
- Corbiere, A.; Loste, A.; Gaudenzio, N. MRGPRX2 sensing of cationic compounds-A bridge between nociception and skin diseases? Exp. Dermatol. 2021, 30, 193–200. [Google Scholar] [CrossRef]
- Aich, A.; Afrin, L.B.; Gupta, K. Mast Cell-Mediated Mechanisms of Nociception. Int. J. Mol. Sci. 2015, 16, 29069–29092. [Google Scholar] [CrossRef] [Green Version]
- Babina, M. The pseudo-allergic/neurogenic route of mast cell activation via MRGPRX2: Discovery, functional programs, regulation, relevance to disease, and relation with allergic stimulation. Itch 2020, 5, e32. [Google Scholar] [CrossRef]
- Kuhn, H.; Kolkhir, P.; Babina, M.; Dull, M.; Frischbutter, S.; Fok, J.S.; Jiao, Q.; Metz, M.; Scheffel, J.; Wolf, K.; et al. Mas-related G protein-coupled receptor X2 and its activators in dermatologic allergies. J. Allergy Clin. Immunol. 2021, 147, 456–469. [Google Scholar] [CrossRef]
- Falduto, G.H.; Pfeiffer, A.; Luker, A.; Metcalfe, D.D.; Olivera, A. Emerging mechanisms contributing to mast cell-mediated pathophysiology with therapeutic implications. Pharmacol. Ther. 2021, 220, 107718. [Google Scholar] [CrossRef]
- Voss, M.; Kotrba, J.; Gaffal, E.; Katsoulis-Dimitriou, K.; Dudeck, A. Mast Cells in the Skin: Defenders of Integrity or Offenders in Inflammation? Int. J. Mol. Sci. 2021, 22, 4589. [Google Scholar] [CrossRef] [PubMed]
- Espinosa-Riquer, Z.P.; Segura-Villalobos, D.; Ramirez-Moreno, I.G.; Perez Rodriguez, M.J.; Lamas, M.; Gonzalez-Espinosa, C. Signal Transduction Pathways Activated by Innate Immunity in Mast Cells: Translating Sensing of Changes into Specific Responses. Cells 2020, 9, 2411. [Google Scholar] [CrossRef]
- Katsoulis-Dimitriou, K.; Kotrba, J.; Voss, M.; Dudeck, J.; Dudeck, A. Mast Cell Functions Linking Innate Sensing to Adaptive Immunity. Cells 2020, 9, 2538. [Google Scholar] [CrossRef] [PubMed]
- Eyerich, S.; Metz, M.; Bossios, A.; Eyerich, K. New biological treatments for asthma and skin allergies. Allergy 2020, 75, 546–560. [Google Scholar] [CrossRef] [Green Version]
- Kawakami, T.; Ando, T.; Kimura, M.; Wilson, B.S.; Kawakami, Y. Mast cells in atopic dermatitis. Curr. Opin. Immunol. 2009, 21, 666–678. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilcock, A.; Bahri, R.; Bulfone-Paus, S.; Arkwright, P.D. Mast cell disorders: From infancy to maturity. Allergy 2019, 74, 53–63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guttman-Yassky, E.; Nograles, K.E.; Krueger, J.G. Contrasting pathogenesis of atopic dermatitis and psoriasis--part II: Immune cell subsets and therapeutic concepts. J. Allergy Clin. Immunol. 2011, 127, 1420–1432. [Google Scholar] [CrossRef]
- Wang, Z.; Babina, M. MRGPRX2 signals its importance in cutaneous mast cell biology: Does MRGPRX2 connect mast cells and atopic dermatitis? Exp. Dermatol. 2020, 29, 1104–1111. [Google Scholar] [CrossRef]
- Zhou, X.Y.; Chen, K.; Zhang, J.A. Mast cells as important regulators in the development of psoriasis. Front. Immunol. 2022, 13, 1022986. [Google Scholar] [CrossRef]
- Gaudenzio, N.; Marichal, T.; Galli, S.J.; Reber, L.L. Genetic and Imaging Approaches Reveal Pro-Inflammatory and Immunoregulatory Roles of Mast Cells in Contact Hypersensitivity. Front. Immunol. 2018, 9, 1275. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; Wang, Y.J.; Hao, D.; Wen, X.; Du, D.; He, G.; Jiang, X. The Theranostics Role of Mast Cells in the Pathophysiology of Rosacea. Front. Med. 2019, 6, 324. [Google Scholar] [CrossRef] [Green Version]
- Numata, T.; Harada, K.; Nakae, S. Roles of Mast Cells in Cutaneous Diseases. Front. Immunol. 2022, 13, 923495. [Google Scholar] [CrossRef] [PubMed]
- Metcalfe, D.D. Mast cells and mastocytosis. Blood 2008, 112, 946–956. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okayama, Y.; Kawakami, T. Development, migration, and survival of mast cells. Immunol. Res. 2006, 34, 97–115. [Google Scholar] [CrossRef] [PubMed]
- Akin, C.; Metcalfe, D.D. The biology of Kit in disease and the application of pharmacogenetics. J. Allergy Clin. Immunol. 2004, 114, 13–19. [Google Scholar] [CrossRef]
- Lennartsson, J.; Ronnstrand, L. Stem cell factor receptor/c-Kit: From basic science to clinical implications. Physiol. Rev. 2012, 92, 1619–1649. [Google Scholar] [CrossRef] [Green Version]
- Cruse, G.; Metcalfe, D.D.; Olivera, A. Functional deregulation of KIT: Link to mast cell proliferative diseases and other neoplasms. Immunol. Allergy Clin. North. Am. 2014, 34, 219–237. [Google Scholar] [CrossRef] [Green Version]
- Franke, K.; Kirchner, M.; Mertins, P.; Zuberbier, T.; Babina, M. The SCF/KIT axis in human mast cells: Capicua acts as potent KIT repressor and ERK predominates PI3K. Allergy 2022, 77, 3337–3349. [Google Scholar] [CrossRef] [PubMed]
- Tshori, S.; Sonnenblick, A.; Yannay-Cohen, N.; Kay, G.; Nechushtan, H.; Razin, E. Microphthalmia transcription factor isoforms in mast cells and the heart. Mol. Cell Biol. 2007, 27, 3911–3919. [Google Scholar] [CrossRef] [Green Version]
- Ando, T.; Xiao, W.; Gao, P.; Namiranian, S.; Matsumoto, K.; Tomimori, Y.; Hong, H.; Yamashita, H.; Kimura, M.; Kashiwakura, J.; et al. Critical role for mast cell Stat5 activity in skin inflammation. Cell Rep. 2014, 6, 366–376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sasaki, H.; Kurotaki, D.; Tamura, T. Regulation of basophil and mast cell development by transcription factors. Allergol. Int. 2016, 65, 127–134. [Google Scholar] [CrossRef] [Green Version]
- Peter, B.; Bibi, S.; Eisenwort, G.; Wingelhofer, B.; Berger, D.; Stefanzl, G.; Blatt, K.; Herrmann, H.; Hadzijusufovic, E.; Hoermann, G.; et al. Drug-induced inhibition of phosphorylation of STAT5 overrides drug resistance in neoplastic mast cells. Leukemia 2018, 32, 1016–1022. [Google Scholar] [CrossRef] [PubMed]
- Desai, A.; Sowerwine, K.; Liu, Y.; Lawrence, M.G.; Chovanec, J.; Hsu, A.P.; O’Connell, M.P.; Kim, J.; Boris, L.; Jones, N.; et al. GATA-2-deficient mast cells limit IgE-mediated immediate hypersensitivity reactions in human subjects. J. Allergy Clin. Immunol. 2019, 144, 613–617.e614. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Gao, J.; Kamran, M.; Harmacek, L.; Danhorn, T.; Leach, S.M.; O’Connor, B.P.; Hagman, J.R.; Huang, H. GATA2 regulates mast cell identity and responsiveness to antigenic stimulation by promoting chromatin remodeling at super-enhancers. Nat. Commun. 2021, 12, 494. [Google Scholar] [CrossRef]
- Mora-Garcia, P.; Cheng, J.; Crans-Vargas, H.N.; Countouriotis, A.; Shankar, D.; Sakamoto, K.M. Transcriptional regulators and myelopoiesis: The role of serum response factor and CREB as targets of cytokine signaling. Stem Cells 2003, 21, 123–130. [Google Scholar] [CrossRef]
- Lonze, B.E.; Ginty, D.D. Function and regulation of CREB family transcription factors in the nervous system. Neuron 2002, 35, 605–623. [Google Scholar] [CrossRef] [Green Version]
- Johannessen, M.; Delghandi, M.P.; Moens, U. What turns CREB on? Cell Signal. 2004, 16, 1211–1227. [Google Scholar] [CrossRef]
- Feng, C.; Mery, A.G.; Beller, E.M.; Favot, C.; Boyce, J.A. Adenine nucleotides inhibit cytokine generation by human mast cells through a Gs-coupled receptor. J. Immunol. 2004, 173, 7539–7547. [Google Scholar] [CrossRef] [Green Version]
- Mortaz, E.; Redegeld, F.A.; Sarir, H.; Karimi, K.; Raats, D.; Nijkamp, F.P.; Folkerts, G. Cigarette smoke stimulates the production of chemokines in mast cells. J. Leukoc Biol. 2008, 83, 575–580. [Google Scholar] [CrossRef]
- Nam, Y.H.; Min, D.; Kim, H.P.; Song, K.J.; Kim, K.A.; Lee, Y.A.; Kim, S.H.; Shin, M.H. Leukotriene B4 receptor BLT-mediated phosphorylation of NF-kappaB and CREB is involved in IL-8 production in human mast cells induced by Trichomonas vaginalis-derived secretory products. Microbes Infect. 2011, 13, 1211–1220. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Ma, H.; Tao, X.; Luo, Y.; Wang, H.; He, J.; Fang, Q.; Guo, S.; Song, C. SCF promotes the production of IL-13 via the MEK-ERK-CREB signaling pathway in mast cells. Exp. Ther. Med. 2019, 18, 2491–2496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dragunow, M. CREB and neurodegeneration. Front. Biosci. 2004, 9, 100–103. [Google Scholar] [CrossRef]
- Lamprecht, R. CREB: A message to remember. Cell Mol. Life Sci. 1999, 55, 554–563. [Google Scholar] [CrossRef]
- Collins, J.W. The neuroscience of learning. J. Neurosci. Nurs. 2007, 39, 305–310. [Google Scholar] [CrossRef]
- Mantamadiotis, T.; Papalexis, N.; Dworkin, S. CREB signalling in neural stem/progenitor cells: Recent developments and the implications for brain tumour biology. Bioessays 2012, 34, 293–300. [Google Scholar] [CrossRef]
- Noguchi, S.; Arakawa, T.; Fukuda, S.; Furuno, M.; Hasegawa, A.; Hori, F.; Ishikawa-Kato, S.; Kaida, K.; Kaiho, A.; Kanamori-Katayama, M.; et al. FANTOM5 CAGE profiles of human and mouse samples. Sci. Data 2017, 4, 170112. [Google Scholar] [CrossRef] [Green Version]
- DGT, RIKEN PMI CLST; FANTOM Consortium; Forrest, A.R.; Kawaji, H.; Rehli, M.; Baillie, J.K.; de Hoon, M.J.; Haberle, V.; Lassmann, T. A promoter-level mammalian expression atlas. Nature 2014, 507, 462–470. [Google Scholar] [CrossRef] [Green Version]
- Phair, I.R.; Sumoreeah, M.C.; Scott, N.; Spinelli, L.; Arthur, J.S.C. IL-33 induces granzyme C expression in murine mast cells via an MSK1/2-CREB-dependent pathway. Biosci. Rep. 2022, 42, 1165. [Google Scholar] [CrossRef]
- Motakis, E.; Guhl, S.; Ishizu, Y.; Itoh, M.; Kawaji, H.; de Hoon, M.; Lassmann, T.; Carninci, P.; Hayashizaki, Y.; Zuberbier, T.; et al. Redefinition of the human mast cell transcriptome by deep-CAGE sequencing. Blood 2014, 123, e58–e67. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Franke, K.; Wang, Z.; Zuberbier, T.; Babina, M. Cytokines Stimulated by IL-33 in Human Skin Mast Cells: Involvement of NF-kappaB and p38 at Distinct Levels and Potent Co-Operation with FcepsilonRI and MRGPRX2. Int. J. Mol. Sci. 2021, 22, 3580. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Guhl, S.; Franke, K.; Artuc, M.; Zuberbier, T.; Babina, M. IL-33 and MRGPRX2-Triggered Activation of Human Skin Mast Cells-Elimination of Receptor Expression on Chronic Exposure, but Reinforced Degranulation on Acute Priming. Cells 2019, 8, 341. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Babina, M.; Wang, Z.; Franke, K.; Guhl, S.; Artuc, M.; Zuberbier, T. Yin-Yang of IL-33 in Human Skin Mast Cells: Reduced Degranulation, but Augmented Histamine Synthesis through p38 Activation. J. Investig. Dermatol. 2019, 139, 1516–1525.e1513. [Google Scholar] [CrossRef]
- Maik-Rachline, G.; Hacohen-Lev-Ran, A.; Seger, R. Nuclear ERK: Mechanism of Translocation, Substrates, and Role in Cancer. Int. J. Mol. Sci. 2019, 20, 1194. [Google Scholar] [CrossRef] [Green Version]
- Kinjo, K.; Sandoval, S.; Sakamoto, K.M.; Shankar, D.B. The role of CREB as a proto-oncogene in hematopoiesis. Cell Cycle 2005, 4, 1134–1135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Babina, M.; Franke, K.; Bal, G. How “Neuronal” Are Human Skin Mast Cells? Int. J. Mol. Sci. 2022, 23, 871. [Google Scholar] [CrossRef]
- Hazzan, T.; Eberle, J.; Worm, M.; Babina, M. Apoptotic resistance of human skin mast cells is mediated by Mcl-1. Cell Death Discov. 2017, 3, 17048. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hazzan, T.; Eberle, J.; Worm, M.; Babina, M. Thymic Stromal Lymphopoietin Interferes with the Apoptosis of Human Skin Mast Cells by a Dual Strategy Involving STAT5/Mcl-1 and JNK/Bcl-x(L). Cells 2019, 8, 829. [Google Scholar] [CrossRef] [Green Version]
- Babina, M.; Guhl, S.; Motakis, E.; Artuc, M.; Hazzan, T.; Worm, M.; Forrest, A.R.; Zuberbier, T. Retinoic acid potentiates inflammatory cytokines in human mast cells: Identification of mast cells as prominent constituents of the skin retinoid network. Mol. Cell Endocrinol. 2015, 406, 49–59. [Google Scholar] [CrossRef]
- Hu, P.; Carlesso, N.; Xu, M.; Liu, Y.; Nebreda, A.R.; Takemoto, C.; Kapur, R. Genetic evidence for critical roles of P38alpha protein in regulating mast cell differentiation and chemotaxis through distinct mechanisms. J. Biol. Chem. 2012, 287, 20258–20269. [Google Scholar] [CrossRef] [Green Version]
- Jaaro, H.; Rubinfeld, H.; Hanoch, T.; Seger, R. Nuclear translocation of mitogen-activated protein kinase kinase (MEK1) in response to mitogenic stimulation. Proc. Natl. Acad. Sci. USA 1997, 94, 3742–3747. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Odom, D.T.; Koo, S.H.; Conkright, M.D.; Canettieri, G.; Best, J.; Chen, H.; Jenner, R.; Herbolsheimer, E.; Jacobsen, E.; et al. Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc. Natl. Acad. Sci. USA 2005, 102, 4459–4464. [Google Scholar] [CrossRef] [Green Version]
- Wang, P.; Tian, H.; Zhang, J.; Qian, J.; Li, L.; Shi, L.; Zhao, Y. Spaceflight/microgravity inhibits the proliferation of hematopoietic stem cells by decreasing Kit-Ras/cAMP-CREB pathway networks as evidenced by RNA-Seq assays. FASEB J. 2019, 33, 5903–5913. [Google Scholar] [CrossRef]
- Niwano, T.; Terazawa, S.; Sato, Y.; Kato, T.; Nakajima, H.; Imokawa, G. Glucosamine abrogates the stem cell factor + endothelin-1-induced stimulation of melanogenesis via a deficiency in MITF expression due to the proteolytic degradation of CREB in human melanocytes. Arch. Dermatol. Res. 2018, 310, 625–637. [Google Scholar] [CrossRef]
- Niwano, T.; Terazawa, S.; Nakajima, H.; Imokawa, G. The stem cell factor-stimulated melanogenesis in human melanocytes can be abrogated by interrupting the phosphorylation of MSK1: Evidence for involvement of the p38/MSK1/CREB/MITF axis. Arch. Dermatol. Res. 2018, 310, 187–196. [Google Scholar] [CrossRef]
- Boer, A.K.; Drayer, A.L.; Vellenga, E. Stem cell factor enhances erythropoietin-mediated transactivation of signal transducer and activator of transcription 5 (STAT5) via the PKA/CREB pathway. Exp. Hematol. 2003, 31, 512–520. [Google Scholar] [CrossRef]
- Carlezon, W.A., Jr.; Duman, R.S.; Nestler, E.J. The many faces of CREB. Trends Neurosci. 2005, 28, 436–445. [Google Scholar] [CrossRef] [PubMed]
- Unal, E.B.; Uhlitz, F.; Bluthgen, N. A compendium of ERK targets. FEBS Lett. 2017, 591, 2607–2615. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu Frisk, J.M.; Kjellen, L.; Melo, F.R.; Ohrvik, H.; Pejler, G. Mitogen-Activated Protein Kinase Signaling Regulates Proteoglycan Composition of Mast Cell Secretory Granules. Front. Immunol. 2018, 9, 1670. [Google Scholar] [CrossRef]
- Arner, E.; Daub, C.O.; Vitting-Seerup, K.; Andersson, R.; Lilje, B.; Drablos, F.; Lennartsson, A.; Ronnerblad, M.; Hrydziuszko, O.; Vitezic, M.; et al. Transcribed enhancers lead waves of coordinated transcription in transitioning mammalian cells. Science 2015, 347, 1010–1014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bahrami, S.; Drablos, F. Gene regulation in the immediate-early response process. Adv. Biol. Regul. 2016, 62, 37–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fowler, T.; Sen, R.; Roy, A.L. Regulation of primary response genes. Mol. Cell 2011, 44, 348–360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saha, R.N.; Dudek, S.M. Splitting hares and tortoises: A classification of neuronal immediate early gene transcription based on poised RNA polymerase II. Neuroscience 2013, 247, 175–181. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turner, H.; Cantrell, D.A. Distinct Ras effector pathways are involved in Fc epsilon R1 regulation of the transcriptional activity of Elk-1 and NFAT in mast cells. J. Exp. Med. 1997, 185, 43–53. [Google Scholar] [CrossRef] [Green Version]
- Koga, Y.; Tsurumaki, H.; Aoki-Saito, H.; Sato, M.; Yatomi, M.; Takehara, K.; Hisada, T. Roles of Cyclic AMP Response Element Binding Activation in the ERK1/2 and p38 MAPK Signalling Pathway in Central Nervous System, Cardiovascular System, Osteoclast Differentiation and Mucin and Cytokine Production. Int. J. Mol. Sci. 2019, 20, 1346. [Google Scholar] [CrossRef] [Green Version]
- Knoll, B.; Nordheim, A. Functional versatility of transcription factors in the nervous system: The SRF paradigm. Trends Neurosci. 2009, 32, 432–442. [Google Scholar] [CrossRef]
- Tyssowski, K.M.; DeStefino, N.R.; Cho, J.H.; Dunn, C.J.; Poston, R.G.; Carty, C.E.; Jones, R.D.; Chang, S.M.; Romeo, P.; Wurzelmann, M.K.; et al. Different Neuronal Activity Patterns Induce Different Gene Expression Programs. Neuron 2018, 98, 530–546.e511. [Google Scholar] [CrossRef] [Green Version]
- Liebermann, D.A.; Gregory, B.; Hoffman, B. AP-1 (Fos/Jun) transcription factors in hematopoietic differentiation and apoptosis. Int. J. Oncol. 1998, 12, 685–700. [Google Scholar] [CrossRef]
- Babina, M.; Schulke, Y.; Kirchhof, L.; Guhl, S.; Franke, R.; Bohm, S.; Zuberbier, T.; Henz, B.M.; Gombart, A.F. The transcription factor profile of human mast cells in comparison with monocytes and granulocytes. Cell Mol. Life Sci. 2005, 62, 214–226. [Google Scholar] [CrossRef]
- Baranes, D.; Razin, E. Protein kinase C regulates proliferation of mast cells and the expression of the mRNAs of fos and jun proto-oncogenes during activation by IgE-Ag or calcium ionophore A23187. Blood 1991, 78, 2354–2364. [Google Scholar] [CrossRef]
- Razin, E.; Szallasi, Z.; Kazanietz, M.G.; Blumberg, P.M.; Rivera, J. Protein kinases C-beta and C-epsilon link the mast cell high-affinity receptor for IgE to the expression of c-fos and c-jun. Proc. Natl. Acad. Sci. USA 1994, 91, 7722–7726. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.N.; Ji, K.; Zhang, L.N.; Xie, C.C.; Li, W.Y.; Zhao, Z.F.; Chen, J.J. Inhibition of c-Fos expression attenuates IgE-mediated mast cell activation and allergic inflammation by counteracting an inhibitory AP1/Egr1/IL-4 axis. J. Transl. Med. 2021, 19, 261. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.N.; Tuckerman, J.; Nechushtan, H.; Schutz, G.; Razin, E.; Angel, P. c-Fos as a regulator of degranulation and cytokine production in FcepsilonRI-activated mast cells. J. Immunol. 2004, 173, 2571–2577. [Google Scholar] [CrossRef] [Green Version]
- Lorentz, A.; Wilke, M.; Sellge, G.; Worthmann, H.; Klempnauer, J.; Manns, M.P.; Bischoff, S.C. IL-4-induced priming of human intestinal mast cells for enhanced survival and Th2 cytokine generation is reversible and associated with increased activity of ERK1/2 and c-Fos. J. Immunol. 2005, 174, 6751–6756. [Google Scholar] [CrossRef] [Green Version]
- Herring, J.A.; Elison, W.S.; Tessem, J.S. Function of Nr4a Orphan Nuclear Receptors in Proliferation, Apoptosis and Fuel Utilization Across Tissues. Cells 2019, 8, 1373. [Google Scholar] [CrossRef] [Green Version]
- Prince, L.R.; Prosseda, S.D.; Higgins, K.; Carlring, J.; Prestwich, E.C.; Ogryzko, N.V.; Rahman, A.; Basran, A.; Falciani, F.; Taylor, P.; et al. NR4A orphan nuclear receptor family members, NR4A2 and NR4A3, regulate neutrophil number and survival. Blood 2017, 130, 1014–1025. [Google Scholar] [CrossRef]
- Jakaria, M.; Haque, M.E.; Cho, D.Y.; Azam, S.; Kim, I.S.; Choi, D.K. Molecular Insights into NR4A2(Nurr1): An Emerging Target for Neuroprotective Therapy Against Neuroinflammation and Neuronal Cell Death. Mol. Neurobiol. 2019, 56, 5799–5814. [Google Scholar] [CrossRef]
- Babina, M.; Wang, Z.; Artuc, M.; Guhl, S.; Zuberbier, T. MRGPRX2 is negatively targeted by SCF and IL-4 to diminish pseudo-allergic stimulation of skin mast cells in culture. Exp. Dermatol. 2018, 27, 1298–1303. [Google Scholar] [CrossRef]
- Rastogi, S.; Willmes, D.M.; Nassiri, M.; Babina, M.; Worm, M. PGE2 deficiency predisposes to anaphylaxis by causing mast cell hyperresponsiveness. J. Allergy Clin. Immunol. 2020, 146, 1387–1396.e1313. [Google Scholar] [CrossRef]
- Babina, M.; Artuc, M.; Guhl, S.; Zuberbier, T. Retinoic Acid Negatively Impacts Proliferation and MCTC Specific Attributes of Human Skin Derived Mast Cells, but Reinforces Allergic Stimulability. Int. J. Mol. Sci. 2017, 18, 525. [Google Scholar] [CrossRef] [Green Version]
- Guhl, S.; Neou, A.; Artuc, M.; Zuberbier, T.; Babina, M. Skin mast cells develop non-synchronized changes in typical lineage characteristics upon culture. Exp. Dermatol. 2014, 23, 933–935. [Google Scholar] [CrossRef]
- Guhl, S.; Artuc, M.; Neou, A.; Babina, M.; Zuberbier, T. Long-term cultured human skin mast cells are suitable for pharmacological studies of anti-allergic drugs due to high responsiveness to FcepsilonRI cross-linking. Biosci. Biotechnol. Biochem. 2011, 75, 382–384. [Google Scholar] [CrossRef]
- Hasel, K.W.; Glass, J.R.; Godbout, M.; Sutcliffe, J.G. An endoplasmic reticulum-specific cyclophilin. Mol. Cell Biol. 1991, 11, 3484–3491. [Google Scholar] [CrossRef] [Green Version]
- Chen, M.; Shen, X. Nuclear actin and actin-related proteins in chromatin dynamics. Curr. Opin. Cell Biol. 2007, 19, 326–330. [Google Scholar] [CrossRef]
- Serebryannyy, L.; de Lanerolle, P. Nuclear actin: The new normal. Mutat. Res. 2020, 821, 111714. [Google Scholar] [CrossRef]
- Serebryannyy, L.A.; Cruz, C.M.; de Lanerolle, P. A Role for Nuclear Actin in HDAC 1 and 2 Regulation. Sci. Rep. 2016, 6, 28460. [Google Scholar] [CrossRef] [Green Version]
- Babina, M.; Guhl, S.; Artuc, M.; Zuberbier, T. IL-4 and human skin mast cells revisited: Reinforcement of a pro-allergic phenotype upon prolonged exposure. Arch. Dermatol. Res. 2016, 308, 665–670. [Google Scholar] [CrossRef]
- Guhl, S.; Stefaniak, R.; Strathmann, M.; Babina, M.; Piazena, H.; Henz, B.M.; Zuberbier, T. Bivalent effect of UV light on human skin mast cells-low-level mediator release at baseline but potent suppression upon mast cell triggering. J. Investig. Dermatol. 2005, 124, 453–456. [Google Scholar] [CrossRef] [Green Version]
- Hazzan, T.; Guhl, S.; Artuc, M.; Franke, K.; Worm, M.; Zuberbier, T.; Babina, M. An efficient method for gene knock-down by RNA interference in human skin mast cells. Exp. Dermatol 2017, 26, 1136–1139. [Google Scholar] [CrossRef] [Green Version]
- Wang, Z.; Li, Z.; Bal, G.; Franke, K.; Zuberbier, T.; Babina, M. beta-arrestin-1 and beta-arrestin-2 Restrain MRGPRX2-Triggered Degranulation and ERK1/2 Activation in Human Skin Mast Cells. Front. Allergy 2022, 3, 930233. [Google Scholar] [CrossRef]
- Babina, M.; Wang, Z.; Roy, S.; Guhl, S.; Franke, K.; Artuc, M.; Ali, H.; Zuberbier, T. MRGPRX2 Is the Codeine Receptor of Human Skin Mast Cells: Desensitization through beta-Arrestin and Lack of Correlation with the FcepsilonRI Pathway. J. Investig. Dermatol. 2021, 141, 1286–1296.e1284. [Google Scholar] [CrossRef] [PubMed]
- Babina, M.; Wang, Z.; Franke, K.; Zuberbier, T. Thymic Stromal Lymphopoietin Promotes MRGPRX2-Triggered Degranulation of Skin Mast Cells in a STAT5-Dependent Manner with Further Support from JNK. Cells 2021, 10, 102. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward 5′-3′ | Reverse 5′-3′ |
---|---|---|
FOS | AGTGACCGTGGGAATGAAGT | GCTTCAACGCAGACTACGAG |
NR4A2 | TTCTGTAACCCTCCTAGCCC | AGCATGGCCAAACATTTCCC |
JUNB | GCCCGGATGTGCACTAAAAT | GACCAGAAAAGTAGCTGCCG |
CREB1 | GAGAAGCGGAGTGTTGGTGA | TCCGTCACTGCTTTCGTTCA |
HPRT | GCCTCCCATCTCCTTCATCA | CCTGGCGTCGTGATTAGTGA |
PPIB * | AAGATGTCCCTGTGCCCTAC | ATGGCAAGCATGTGGTGTTT |
GAPDH | ATCTCGCTCCTGGAAGATGG | AGGTCGGAGTCAACGGATTT |
MCL1 | TGCTGGAGTAGGAGCTGGTT | CCTCTTGCCACTTGCTTTTC |
TNF | TCTCGAACCCCGAGTGACAA | TCAGCCACTGGAGCTGCC |
IL8 | ATGACTTCCAAGCTGGCCGTGGCT | CTCAGCCCTCTTCAAAAACTTCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Franke, K.; Bal, G.; Li, Z.; Zuberbier, T.; Babina, M. CREB Is Activated by the SCF/KIT Axis in a Partially ERK-Dependent Manner and Orchestrates Survival and the Induction of Immediate Early Genes in Human Skin Mast Cells. Int. J. Mol. Sci. 2023, 24, 4135. https://doi.org/10.3390/ijms24044135
Franke K, Bal G, Li Z, Zuberbier T, Babina M. CREB Is Activated by the SCF/KIT Axis in a Partially ERK-Dependent Manner and Orchestrates Survival and the Induction of Immediate Early Genes in Human Skin Mast Cells. International Journal of Molecular Sciences. 2023; 24(4):4135. https://doi.org/10.3390/ijms24044135
Chicago/Turabian StyleFranke, Kristin, Gürkan Bal, Zhuoran Li, Torsten Zuberbier, and Magda Babina. 2023. "CREB Is Activated by the SCF/KIT Axis in a Partially ERK-Dependent Manner and Orchestrates Survival and the Induction of Immediate Early Genes in Human Skin Mast Cells" International Journal of Molecular Sciences 24, no. 4: 4135. https://doi.org/10.3390/ijms24044135
APA StyleFranke, K., Bal, G., Li, Z., Zuberbier, T., & Babina, M. (2023). CREB Is Activated by the SCF/KIT Axis in a Partially ERK-Dependent Manner and Orchestrates Survival and the Induction of Immediate Early Genes in Human Skin Mast Cells. International Journal of Molecular Sciences, 24(4), 4135. https://doi.org/10.3390/ijms24044135