Next Article in Journal
Genetic Predisposition to Colorectal Cancer: How Many and Which Genes to Test?
Next Article in Special Issue
A Comprehensive Genome-Wide Association Study of Carotenoid and Capsaicinoid Contents in Capsicum chinense Germplasm
Previous Article in Journal
New Insights into Bitopic Orthosteric/Allosteric Ligands of Cannabinoid Receptor Type 2
Previous Article in Special Issue
Characterization of Transcriptome Dynamics during Early Fruit Development in Olive (Olea europaea L.)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Functional Characterization of Stress Related Glyoxalase Genes in Brassica napus L.

The Key Laboratory of Biology and Genetic Improvement of Oil Crops, The Ministry of Agriculture and Rural Affairs of the PRC, Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences, Wuhan 430062, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(3), 2130; https://doi.org/10.3390/ijms24032130
Submission received: 26 November 2022 / Revised: 6 January 2023 / Accepted: 18 January 2023 / Published: 21 January 2023
(This article belongs to the Special Issue Vegetable Genetics and Genomics)

Abstract

:
Rapeseed (Brassica napus L.) is not only one of the most important oil crops in the world, but it is also an important vegetable crop with a high value nutrients and metabolites. However, rapeseed is often severely damaged by adverse stresses, such as low temperature, pathogen infection and so on. Glyoxalase I (GLYI) and glyoxalase II (GLYII) are two enzymes responsible for the detoxification of a cytotoxic metabolite methylglyoxal (MG) into the nontoxic S-D-lactoylglutathione, which plays crucial roles in stress tolerance in plants. Considering the important roles of glyoxalases, the GLY gene families have been analyzed in higher plans, such as rice, soybean and Chinese cabbage; however, little is known about the presence, distribution, localizations and expression of glyoxalase genes in rapeseed, a young allotetraploid. In this study, a total of 35 BnaGLYI and 30 BnaGLYII genes were identified in the B. napus genome and were clustered into six and eight subfamilies, respectively. The classification, chromosomal distribution, gene structure and conserved motif were identified or predicted. BnaGLYI and BnaGLYII proteins were mainly localized in chloroplast and cytoplasm. By using publicly available RNA-seq data and a quantitative real-time PCR analysis (qRT-PCR), the expression profiling of these genes of different tissues was demonstrated in different developmental stages as well as under stresses. The results indicated that their expression profiles varied among different tissues. Some members are highly expressed in specific tissues, BnaGLYI11 and BnaGLYI27 expressed in flowers and germinating seed. At the same time, the two genes were significantly up-regulated under heat, cold and freezing stresses. Notably, a number of BnaGLY genes showed responses to Plasmodiophora brassicae infection. Overexpression of BnGLYI11 gene in Arabidopsis thaliana seedlings confirmed that this gene conferred freezing tolerance. This study provides insight of the BnaGLYI and BnaGLYII gene families in allotetraploid B. napus and their roles in stress resistance, and important information and gene resources for developing stress resistant vegetable and rapeseed oil.

1. Background

Rapeseed (Brassica napus L.) is one of the most important oil crops in the world. It not only provides high quality edible oil for human beings, but also is a new type of vegetable [1]. Low erucic acid and glucosinolate rapeseed has rich vitamins, fiber and minerals in its stems and leaves and tastes good, which shows great market prospect [2,3]. However, rapeseed is frequently subjected to adverse damage by stresses caused by low temperature, pathogen infection and so on, which not only seriously reduce the yield, but also threatens the health of animals and human beings when it enters the food chain [4]. Thus, exploring and utilizing stress-tolerant genes in rapeseed is of great theoretical and practical significance for vegetable and oilseed production.
Previous reports reveal that the dominant methylglyoxal (MG) concentration in plants can be increased under stress conditions compared with normal conditions [5]. The glyoxalase pathway is the dominant MG scavenging pathways of plants, which includes two enzymes, GLYI and GLYII [6]. GLYI catalyzes the MG conversion into S-D-lactoylglutathione in the presence of reduced glutathione (GSH) [7]. Subsequently, GLYII hydrolyzes S-D-lactoylglutathione into non-toxic D-lactic acid and GSH [8]. The depletion of GSH and the activity of GLYI lead to the toxicity of MG [9]. GLYII is the second rate-limiting enzyme in the system [10]. Lack of GLYII leads to the accumulation of lactoylglutathione [11]. Recently, the third enzyme GLYIII, found to convert MG directly into D-lactose, is far less efficient than the GLYI and GLYII enzymes [11].
In plants, the roles of GLY systems in resistance to biotic and abiotic stresses have been getting more attention recently. The role of GLY systems in resisting salt, extreme temperature and heavy metal stresses were reported [12,13,14,15,16]. GLYI and GLYII can be induced by stresses at transcription and translation levels. For example, in Brassica juecea, GLYII expression was significantly up-regulated under zinc stress [17]. The GLYI protein in rice roots at the seedling stage was significantly induced by low temperature stress [18]. The GLYI protein in tomato roots was significantly increased under heavy metal Al stress [19]. Similarly, GLYI and GLYII activities in onion were also induced by low temperature [20]. The level of transcript, protein and specific activity of GLYI was markedly enhanced under water stress [12]. In addition to abiotic stress responses, GLY genes are also regulated by biotic stresses. The expression of GLYI was induced in Brassica after infection by Sclerotinia sclerotiorum [21]. In B. rapa, BraGLYI1, BraGLYI6, BraGLYI11 and BraGLYI16 were up-regulated after inoculation of Plasmodiophora brassicae in both clubroot-resistant and susceptible lines of B.rapa. BraGLYII13 was more highly induced in the resistant line than the susceptible line at 12 h after inoculation [22]. Overall, the enzyme system is considered as a biomarker of plant stress tolerance [23].
A high concentration of MG can impair plant cells or cell components and can even destroy DNA or cause mutation, resulting in the death of plant cells and tissues [16]. Overexpression or higher activity of glyoxalase enzymes eliminate MG toxicity and confer stress tolerance [23]. For example, overexpression of the GLYI gene in tobacco showed better stress tolerance than the normal plant to MG and high salinity [13]. The transgenic mustard overexpressing the GLYI gene enabled tolerance to salt, heavy metals and drought stresses [5]. Overexpressing of wheat’s GLYI gene also enhanced the tobacco tolerance to ZnCl2 [24]. Double GLY transgenic tomato plants (BjGlyI from B. juncea and PgGlyII from Pennisetum glaucum) showed improved salinity resistance, probably by decreasing the oxidative stress [15]. The transgenic tobacco overexpressing both GLYI and GLYII genes showed significant resistance to ZnCl2 [25]. The overexpression of Manihot esculenta GLYI-13 enhanced the growth ability of transgenic yeast under iron stress [26]. Therefore, overexpression of the glyoxalase pathway or individual genes harbors the potential to confer tolerance to multiple stresses.
Both GLYI and GLYII genes were present as multi-gene families. To date, genome-wide identification of the glyoxalase family has been carried out in Arabidopsis thaliana, Oryza sativa, Glycine max, Medicago truncatula, Brassica rapa, B. oleracea, Vitis vinifera and Manihot esculenta. Crantz [22,26,27,28,29,30,31,32,33]. There are at least 11 GLYI homologous genes in A. thaliana and rice, 24 GLYI members in the soybean genome and 15 in B. rapa. According to GLYII genes, five GLYII genes are in A. thaliana, three in rice, twelve GLYII members in the soybean genome, and sixteen GLYII in B. rapa [22,28]. Moreover, some GLYI and GLYII family genes have been proved to play an important role in response to drought, heavy metals and other stress responses [34,35,36]. Rapeseed (B. napus) is a young allotetraploid, which has more gene copied than its diploid progenitor B. rapa and B. oleracea [37]. In this study, the members of GLYI and GLYII families were identified from the B. napus database by bioinformatics analysis, and their genetic structure, evolutionary relationships, conserved motifs, chromosome localization, expression in different tissues and response to stresses were also studied. The study will provide an important basis for clarifying the evolutionary level and functional differentiation of GLYI and GLYII family genes in polyploidy crops and lay a theoretical foundation for further understanding the response mechanisms of stress in Brassica.

2. Results

2.1. Identification of GLYI and GLYII Genes in the B. napus Genome

Glyoxalase proteins (GLYI and GLYII) had been identified in Brassicaceae plant A. thaliana and B. rapa. Thus, AtGLYI/AtGLYII and BraGLYI/BraGLYII sequences were used as queries to blast the genome database of B. napus, and the sequences with an E-value under 1.0 × 10−10 were screened out. Then, proteins that included the glyoxalase domain (PF00903) and the metallo-beta-lactamase domain (PF00753) were classified as BnaGLYI and BnaGLYII proteins, respectively. In this study, 35 BnaGLYI and 30 BnaGLYII genes were identified in B. napus. Table 1 summarizes the gene ID, chromosomal distribution, number of introns, CDS and amino acid length, predicted sub-cellular localization, calculated molecular weight and isoelectric points of the putative BnaGLYI and BnaGLYII.
The CDS length of BnaGLYI members ranged from 324 bp (BnaGLYI34) to 3648 bp (BnaGLYI06). Accordingly, BnaGLYI06 encodes for the largest protein with a polypeptide length of 1216 aa and a molecular weight of 134.9 kDa, while BnaGLYI34 encodes for the smallest protein with a polypeptide length of 108 aa and a molecular weight of 12.2 kDa (Table 1). The isoelectric point (pI) of BnaGLYI proteins vary from 4.78 (BnaGLYI08) to 8.86 (BnaGLYI06). Most of the BnaGLYI members showed acidic pI value, and only four proteins (BnaGLYI02, BnaGLYI05, BnaGLYI06 and BnaGLYI23) showed obvious alkalinity pI value (around 8.0) (Table 1). Moreover, there were also four members (BnaGLYI04, BnaGLYI19, BnaGLYI24 and BnaGLYI31) showing a basic pI value (Table 1). Sub-cellular localization of all identified BnaGLYI proteins were analyzed using three tools (CELLO, Wolf-pSORT and ChloroP). The results predicted that all BnaGLYI, except BnaGLYI15, were localized in cytoplasm. However, the TargetP predicted that most BnaGLYI were localized in the chloroplast, followed by the cytoplasm, nucleus, mitochondrion and cytoskeleton (Table 1).
Similarly, the CDS length of BnaGLYII genes also had very wide ranges, from 777 bp (BnaGLYII09) to 5745 bp (BnaGLYII24). Accordingly, BnaGLYII09 was the smallest protein (259 aa, 28.57 kDa), while BnaGLYII24 was the largest protein (1915 aa, 212.36 kDa) (Table 2). The pI value of BnaGLYII proteins varied from 5.21 (BnaGLYII29) to 9.04 (BnaGLYII04). Most of the BnaGLYII proteins showed alkalinity with a pI value around or more than 7.0, and only seven BnaGLYII proteins had an acidic pI value, including BnaGLYII09, BnaGLYII12, BnaGLYII13, BnaGLYII15, BnaGLYII17, BnaGLYII29 and BnaGLYII30 (Table 2). Sub-cellular locations of BnaGLYII proteins were different from BnaGLYI proteins. BnaGLYII protein members were localized in different sub-cellular compartments, such as cytoplasm, chloroplast, extracellular matrix, outermembrane, periplasm, nucleus and mitochondrion (Table 2).

2.2. Chromosome Localization and Gene Duplication Analysis of BnaGLYI and BnaGLYII

In order to get a more intuitive view of the distribution of GLY genes in B. napus chromosomes, the information of their starting and ending position in chromosomes were collected (Table 1), and a chromosome distribution map was drawn on the MG2C (Map Gene2 Chromosome v2) website (Figure 1). For the BnaGLYI gene family, there were 31 genes that were unevenly distributed on 14 chromosomes, and no genes were found on chromosomes A01, A04, C01, C04 and C07. Four genes (BnaGLYI32-35) were located in the unmapped scaffolds in the Cnn_ random genome (Figure 1a). Chromosomes A06, C05 and C08 contained the maximum number of BnaGLYI genes, four genes each, while five chromosomes (A02, A03, A05, C06 and C09) had only one BnaGLYI gene (Figure 1a). In total, 16 BnaGLYI genes were distributed on the An-subgenome and 19 were from the Cn-subgenome. Similarly, 27 BnaGLYII genes were unevenly located in 15 different chromosomes (Figure 1b). There were four chromosomes that contained no BnaGLYII genes (A07, A10, C07 and C09) (Figure 1b). Chromosome C03 harbored five BnaGLYII genes, which contained the most BnaGLYI genes. However, most of chromosomes, like A01, A02, A04, A08, C02, C05, C06 and C08, contained only one BnaGLYII gene (Figure 1b). The remaining three genes could not be mapped into chromosomes of the rapeseed genome, which were distributed on Ann and Cnn (Figure 1b). Moreover, BnaGLYII proteins were mainly localized in the chloroplast and cytosol.
Gene replication is the main way of gene family expansion. This study also analyzed the gene replication of the GLY gene family in B. napus. Among BnaGLYI proteins, there were 15 pairs of duplicated genes. Three genes categorized into one group that formed three gene pairs (BnaGLYI01/17/18). Other gene pairs all included two genes (BnaGLYI02/19, BnaGLYI03/35, BnaGLYI04/22, BnaGLYI05/23, BnaGLYI07/25, BnaGLYI09/26, BnaGLYI10/28, BnaGLYI11/27, BnaGLYI12/32, BnaGLYI13/30, BnaGLYI14/29 and BnaGLYI15/21). Moreover, there were nine gene pairs with over 95% sequence similarity in BnaGLYII proteins. They were BnaGLYII01/16, BnaGLYII02/18, BnaGLYII03/19, BnaGLYII04/20, BnaGLYII05/21, BnaGLYII06/24, BnaGLYII08/29, BnaGLYII11/22 and BnaGLYII12/23, respectively (Figure 1b). Such a high level of sequence similarity implied the possibility of segmental duplication of those genes. In addition, there were no tandem duplications found in both the BnaGLYI and BnaGLYII proteins.

2.3. Gene Structure and Phylogenetic Analysis of the BnaGLYI and BnaGLYII

To further investigate the gene structure, the CDS and genomic sequences of the BnaGLY genes were aligned. One to twenty-six introns varied from BnaGLYI genes, and there were no introns in the BnaGLYI08 and BnaGLYI31 (Figure 2b, Table 1). BnaGLYI13, BnaGLYI15, BnaGLYI21 and BnaGLYI30 only contained one intron. BnaGLYI06 gene had the largest number of introns (26). Similarly, the BnaGLYII genes also contained varied numbers of introns (4–31), e.g., thirty-one introns were identified in BnaGLYII17, and four introns were predicted in BraGLYII24 (Figure 2b, Table 2). In addition, the GLY proteins that clustered in the same group possessed a similar structure (Figure 2).
To understand the evolutionary relationships and functions among the predicted BnaGLY proteins, a phylogenetic tree was drawn with all BnaGLY protein sequences by MEGA7.0. The thirty-five BnaGLY proteins were resolved into six distinguishing groups (Group A–F; Figure 3a). The largest clade Group F, containing thirty-two GLYI members, included nineteen GLYI in Brassicaceae, whereas the smallest group (Group B), containing ten members, included six GLYI in Brassicaceae (Figure 3a). Group A included sixteen members of Brassicaceae, and one protein from rice. Group C included twenty-six proteins, which contained fourteen members of Brassicaceae (six BnaGLYI, three BraGLYI, three BolGLYI and two AtGLYI). Group D and E contained 13 and 14 members, respectively. Generally, BnaGLYI members first clustered with proteins from B. rapa and B. oleracea, followed by AtGLYIs, forming a small Brassicaceae clade, and subsequently further clustered with GLYI members from rice (Figure 3a).
Similarly, the BnaGLYII proteins formed eight distinct groups (Figure 3b). Two BnaGLYII proteins were clustered in groups A, B, C, D and F, respectively; four BnaGLYII proteins were classified in group E and G, and twelve BraGLYII proteins were in Group H (Figure 3b).
To explore the selective pressure on BnaGLY genes, we calculated the non-synonymous/synonymous mutation ratio (Ka/Ks); Ka/Ks > 1 indicates positive selection, Ka/Ks = 1 indicates neutral selection, and Ka/Ks < 1 indicates purifying selection [38]. The Ka/Ks ratio for 10 BnaGLYI genes was >1, ranging from 1.0664 (BnaGLY11) to 6.3118 (BnaGLY102), which indicated that these genes were experienced higher positive selection pressure during the evolutionary history of B. napus. The other genes showed Ka/Ks < 1, which experienced higher purifying selection pressure (Table S1). Moreover, most of the BnaGLYII genes had a Ka/Ks < 1, and only five BnaGLYII genes experienced positive selection pressure (Table S2). A comparison of Ka/Ks ratios among the BnaGLYI and BnaGLYII genes indicated that the average Ka/Ks ratio of BnaGLYI was higher than that of BnaGLYII genes. These results suggested that the BnaGLYI gene family may have suffered robust purifying selective pressure during evolution.

2.4. Conserved Motif and the Enzyme Activity of BnaGLY

Based on the conserved metal binding sites H/QEH/QE of GLYI proteins and multiple alignment results, the expected enzyme activity of the putative BnaGLYI proteins was predicted. Overall, out of a total thirty-five putative BnaGLYI proteins, sixteen have all the four conserved residues and are expected to have functional GLYI enzyme activity (Figure 4 and Table S3). The other 19 BnaGLYI proteins may have variant function. Additionally, GLYII from microorganisms and plants contained the well-conserved metal binding motif (THXHXDH) and active site motif (C/GHT) [31,39], which play an important role in GLYII enzyme activity. Therefore, based on the protein sequence alignment results, the presence of enzymatic activity of the putative BnaGLYII proteins were evaluated (Figure 4, Table S4). Fourteen of thirty putative BnaGLYII proteins possess all the conserved metal binding residues and may have the functional GLYII enzyme activity (Table S4).
To better understand the protein sequence features of BnaGLY, the conserved motifs of each protein were also identified using the MEME Suite 5.1.1 (http://meme-suite.org/tools/meme, (accessed on 28 May 2020)) (Figure S1). We found that most proteins in the same group had similar motifs, and the LOGOs of these protein motifs were obtained by MEME (Figure S2). In BnaGLYI proteins, motif 1 was observed in all the 34 BnaGLYI proteins, except the BnaGLYI20. Motifs 1, 2, 3 and 4 contained the conserved sites of H/QEH/QE. Similarly, motif 1 was detected in most BnaGLYII proteins, except the BnaGLY16 and BnaGLY26. Motifs 1 and 3 contain the metal binding site (THXHXDH) and active site (C/GHT), respectively. Moreover, we also found that most proteins in the same group had similar motifs (Figure S2). However, the conserved domain of the BnaGLY protein was divergent (Figure S3a,b). The structural domain is not as conservative as expected.

2.5. Tissue Expression Profiles of BnaGLYI and BnaGLYII

To investigate the tissue-specific expression profiles of the BnaGLY genes, we selected 20 types of tissues in database (https://biodb.swu.edu.cn/brassica/, (accessed on 15 June 2020)) to analyze, including 10 tissues at the initial flowering stage and 10 tissues at the different development stages of the podding. The expression levels of the BnaGLY genes showed diverse expression patterns (Figure S3). Six BnaGLYI members (BnaGLYI09, BnaGLYI11, BnaGLYI16, BnaGLYI26, BnaGLYI27 and BnaGLYI35) were highly expressed in most of the tissues. Their average fragments per kilo base of exons per million fragments mapped (FPKM) values were over twenty-five, and the value in a single tissue was at least over three. In contrast, the expression levels of BnaGLYI22, BnaGLYI29, BnaGLYI32 and BnaGLYI34 were not detected in most tissues. They only showed faint expression in one to three tissues, e.g., the expression of BnaGLYI32 was only detected in silique pericarps (SP) at 24 and 27 days after flowering (DAF). The expression of BnaGLYI14 was not detected in all the 10 tissues (Figure S4a). In BnaGLYII genes, BnaGLYII28 was only weakly expressed in SP at 27 DAF, while the FPKM values of BnaGLYII18 and BnaGLYII29 were less than one. The other BnaGLYII genes were constitutive expression. However, some genes were expressed at higher levels in specific tissues, e.g., BnaGLYII19 was highly expressed in anther (Figure S4b). These results indicated that most BnaGLY genes were expressed at different levels in different tissues.
The expression levels of some BnaGLY genes were verified in eight different tissues and organs (including root, stem, leaf, flower, flower bud, 25DAF seed, silique and silique wall by qRT-PCR (Figure 5). A total of 19 BnaGLYI genes and 33 BnaGLYII genes were selected after verifying the specificity for each primer pair. According to the data, the expression level of some BnaGLYI and BnaGLYII genes was consistent with the results of database; for example, the expression level of most BnaGLYI was not detected, such as BnaGLYI29 and BnaGLYII28 (Figure S5 and Table S8), whereas most BnaGLYII showed constitutive expression. Some genes expressed highly in specific tissues; for example, BnaGLYI02, BnaGLYI09 and BnaGLYI19 showed relatively high expression levels in the leaf and silique wall, BnaGLYII12 and BnaGLYII15 were highly expressed in seeds and BnaGLYII05 was highly expressed in flowers. However, the expression level of several genes was inconsistent with the GEO data; for example, BnaGLYI11 and BnaGLYI27 showed particularly high expression levels in the flowers (Figure 5a), and BnaGLYII20 and BnaGLYII26 were strongly expressed in the root (Figure 5b). Moreover, qRT-PCR results indicated that BnaGLYII07 and BnaGLYII24 were much more highly expressed in the leaf, not in the stem as shown in Figure 5b.
The identified paralogous pairs of BnaGLYI and BnaGLYII genes revealed similar expression patterns, such as BnaGLYI02/19. However, some of the paralogous gene pairs showed a high level of expression divergence in different tissues. For example, BnaGLYII06 showed high level expression in flowers, while its paralogous BnaGLYII24 showed high level expression in leaf. The diverse expression patterns suggested that these members might play diverse functions.
Moreover, the expression levels of BnaGLY in developing seeds at two, four, six and eight weeks after pollination (WAP) were analyzed using the gene expression omnibus (GEO) database (GSE77637) (Figure S6). The expression of BnaGLYI11 and BnaGLYI27 genes was high in the four stages, and the FPKM values were all over 2000. BnaGLYI01, BnaGLYI04, and BnaGLYI32 showed high expression level at eight WAP. BnaGLYI10, BnaGLYI14, BnaGLYI28, BnaGLYI29 and BnaGLYI34 showed low expression levels in all the seed development stages (Figure S6a). In the case of BnaGLYII, the expression of BnaGLYII09, BnaGLYII14 and BnaGLYII28 was up-regulated at eight WAP. The expressions of BnaGLYII03, BnaGLYII06, BnaGLYII24, BnaGLYII13, BnaGLYII25, BnaGLYII19, BnaGLYII20 and BnaGLYII26 were gradually decreased in the four development stages (Figure S6b).

2.6. Expression of BnaGLY in B. napus Seed Germination

To dissect the influence of GLY pathways in the seed germination of B. napus, the expression level of GLY genes was analyzed using the data in GEO (GSE13723). The expression level of BnaGLYI in winter oilseed rape (WOSR) accessions with different germination rates (high, medium and low; C129, C033 and C032, respectively) at different germination times showed similar expression patterns, e.g., the expression of BnaGLYI11 and BnaGLYI27 were significantly up-regulated at 72 h after imbibition (hai) in all the three accessions, and the expressions of BnaGLYI04, BnaGLYI07, BnaGLYI17, BnaGLYI21 and BnaGLYI25 obviously decreased at 36 hai and 72 hai. Meanwhile, BnaGLYI06, BnaGLYI10, BnaGLYI14, BnaGLYI24, BnaGLYI28, BnaGLYI29 and BnaGLYI34 showed weak expression in all the accessions at the four germination stages (Figure S7a). In contrast, the average expression level of BnaGLYII genes was much higher than that of BnaGLYI. BnaGLYII5, BnaGLYII11, BnaGLYII21 and BnaGLYII22 showed significant up-regulation at 36 hai and 72 hai in all the three accessions, while BnaGLYII1 was only up-regulated at 72 hai in the three accessions. BnaGLYII9 showed high expression at early stages of germination; however, it was sharply decreased at 36 hai, and then was significantly up-regulated at 72 hai. BnaGLYII3 and BnaGLYII19 were up-regulated at the three germination time points in the three accessions. BnaGLYII17 and BnaGLYII25 showed very low expression levels in accession C033 from 0 to 72 hai (Figure S7b). BnaGLY showed diverse expression patterns, though some genes were clustered within the same group.

2.7. The Response of the BnaGLYI and BnaGLYII on Pathogen Infection

The RNA-seq data sets available in GEO (GSE81545) were used for analysis of the BnaGLY gene expression in response to the fungal pathogen [40]. In the BnaGLYI gene, the expression levels of BnaGLYI07, BnaGLYI24 and BnaGLYI25 were significantly up-regulated after S. sclerotiorum pathogen infection in the resistant cultivar (ZY821) and sensitive cultivar (Westar). BnaGLYI02, BnaGLYI19, BnaGLYI31 and BnaGLYI35 were significantly down-regulated after pathogen infection in both cultivars, while the expression of BnaGLYI08 and BnaGLYI10 was down–regulated in sensitive cultivar; however, their expression was up–regulated in resistant cultivar. Most interestingly, the BnaGLYI17 and BnaGLYI18 genes were up-regulated in the susceptible cultivar; however, they were down-regulated in the resistant cultivar (Figure 6a).
In contrast to the BnaGLYI genes, most BnaGLYII genes showed significantly decreased expression levels after pathogen infection, e.g., BnaGLYII06, BnaGLYII08, BnaGLYII14, BnaGLYII23, BnaGLYII25, BnaGLYII28 and BnaGLYII30 were significantly down-regulated in both cultivars. Only BnaGLYII02, BnaGLYII03, BnaGLYII18 and BnaGLYII19 were significantly induced in both cultivars after being infected by pathogen (Figure 6b). Moreover, BnaGLYII16 was up-regulated in the susceptible cultivars and down-regulated in the resistant cultivars.

2.8. Expression of BnaGLY in Response to Abiotic Stresses

We also investigated the response of BnaGLY genes to drought and heat stresses at expression level (Figure 7, Table S9). The expression levels of 12 BnaGLYI genes (BnaGLYI01, BnaGLYI03, BnaGLYI05, BnaGLYI08, BnaGLYI11, BnaGLYI19, BnaGLYI20, BnaGLYI27, BnaGLYI31, BnaGLYI33 and BnaGLYI35) were up-regulated under heat stress, while the expression of 12 BnaGLYI genes (BnaGLYI02, BnaGLYI06, BnaGLYI09, BnaGLYI13, BnaGLYI15, BnaGLYI17, BnaGLYI18, BnaGLYI21, BnaGLYI24, BnaGLYI26, BnaGLYI30 and BnaGLYI34) were down-regulated under heat stress. Meanwhile, twenty BnaGLYI were highly expressed under heat stress, and five BnaGLYI were lowly expressed under drought stress. Ten BnaGLYI genes (BnaGLYI01, BnaGLYI03, BnaGLYI08, BnaGLYI16, BnaGLYI19, BnaGLYI20, BnaGLYI27, BnaGLYI31, BnaGLYI33 and BnaGLYI35), whose expression levels were up-regulated under heat stress, were also highly expressed under drought stress, while four BnaGLYI genes (BnaGLYI06, BnaGLYI09, BnaGLYI24 and BnaGLYI34) that were down-regulated under heat stress were equally low expressed under drought stress. At the same time, the expression levels of BnaGLYI11 increased under heat stress but decreased under drought stress, while six BnaGLYI genes (BnaGLYI13, BnaGLYI15, BnaGLYI17, BnaGLYI18, BnaGLYI21 and BnaGLYI30) decreased under heat stress but increased under drought stress (Figure 7a).
In the case of BnaGLYII, twenty and fourteen BnaGLYII genes were induced under heat and drought stresses, respectively, while six and ten BnaGLYII genes were lowly expressed under heat and drought stresses, respectively. Among these genes, ten genes (BnaGLYII01, BnaGLYII06, BnaGLYII09, BnaGLYII10, BnaGLYII14, BnaGLYII16, BnaGLYII20, BnaGLYII23 and BnaGLYII28) were up-regulated and two genes (BnaGLYII04 and BnaGLYII29) were down-regulated under both stresses (Figure 7b). At the same time, the expression levels of six BnaGLYII genes (BnaGLYII02, BnaGLYII05, BnaGLYII11, BnaGLYII13, BnaGLYII18 and BnaGLYII24) increased under heat stress but decreased under drought stress, while four BnaGLYII genes (BnaGLYII08, BnaGLYII19, BnaGLYII26 and BnaGLYII30) decreased under heat stress but increased under drought stress (Figure 7b).
To detect the response of BnaGLY genes to low temperature stress, the FPKM value of each gene (Table S10), treated with different cold tolerance under cold accumulations at chilling (CA) and freezing (FA) temperature and cold shocks at the same temperature (CB and FB) condition in two B. napus varieties, were determined using the data from GEO (GSE129220: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE129220, (accessed on 16 December 2022)). A total of nine, twelve, ten and thirteen BnaGLYI genes were up-regulated under CA, FA, CB and FB treatments compared with their controls in B. napus variety HX17, respectively. Among these up-regulated genes, there were one (BnaGLYI11), two (BnaGLYI27 and BnaGLYI11) and one (BnaGLYI11) genes significantly up-regulated under CA, FA and CB treatment (Figure 8a and Table S9). There were nine, eight, four and seven BnaGLYI genes up-regulated under CA, FA, CB and FB treatments, and two (BnaGLYI27 and BnaGLYI11), one (BnaGLYI11) and three BnaGLYI (BnaGLYI07, BnaGLYI11 and BnaGLYI27) genes significantly up-regulated under CA, FA, and FB treatments in B. napus variety HX58.
In the case of BnaGLYII, 13, 21, 17 and 17 BnaGLYII genes were induced in HX17, while 16, 25, 17 and 18 BnaGLYII genes were induced under CA, FA, CB and FB treatments HX58, respectively (Figure 8b and Table S10). Among these genes, three (BnaGLYII11, BnaGLYII22 and BnaGLYII02), four (BnaGLYII02, BnaGLYII11, BnaGLYII14 and BnaGLYII22) and four (BnaGLYII01, BnaGLYII09, BnaGLYII14 and BnaGLYII30) were up-regulated significantly under CA, CB and FB in HX17. Three (BnaGLYII04, BnaGLYII11 and BnaGLYII22), eight (BnaGLYII01, BnaGLYII04, BnaGLYII16, BnaGLYII18, BnaGLYII22, BnaGLYII24, BnaGLYII25 and BnaGLYII29), eight (BnaGLYII02, BnaGLYII10, BnaGLYII11, BnaGLYII14, BnaGLYII17, BnaGLYII18, BnaGLYII22 and BnaGLYII28) and nine (BnaGLYII02, BnaGLYII10, BnaGLYII11, BnaGLYII14 BnaGLYII15, BnaGLYII17, BnaGLYII18, BnaGLYII22 and BnaGLYII28) BnaGLYII were up-regulated significantly under CA, FA, CB and FB in HX58.

2.9. Overexpression of BnGLYI Confer Enhanced Arabidopsis Seedlings Freezing Tolerance

The above results revealed that BnaGLYI11 was significantly induced under both chilling and freezing stresses regardless of cold acclimation, which indicated that the two genes play important roles in cold tolerance in B. napus. To elucidate the function of BnaGLY11 gene, we examined the freezing tolerance of BnaGLYI11–overexpressing transgenic Arabidopsis thaliana seedlings (BnaGLYI11-OE). BnaGLYI11 was indeed overexpressed in these transgenic plants (Figure 9a). After the freezing treatment, the BnGLYI11-OE plants showed higher survival rates than the wild-type plants under freezing conditions. The results indicated that the plants over expressing the BnGLYI11 gene possessed increased capacities to tolerate freezing temperatures (Figure 9b,c).

3. Discussions

Abiotic and biotic stresses severely affect the overall growth of plants and reduce their total productivity. MG is a cytotoxic metabolite, which is produced more under abiotic and biotic stresses [23]. Excessive accumulation of MG results in the disruption of the antioxidant defense system, biomembrane structures and cellular functions, including the peroxidation of lipids, the oxidation of protein and fatty acids and other metabolic dysfunctions [23,41]. The glyoxalase pathway, as the main MG detoxification system, could protect DNA and protein by converting MG into D-lactate and improve plant adaptation to multiple stresses. Many studies have revealed that the glyoxalase-overexpressing transgenic plants restrict MG accumulation and confer stress tolerance [23]. Therefore, genome-wide analysis of the glyoxalase enzymes has been carried out previously in rice, Arabidopsis, soybean, B. rapa, grape and M. truncatula based on their conserved metal ion and substrate binding sites [22,27,28,29,31,42]. However, these families have not been studied in B. napus, the important oil and vegetable crop. In this study, we identified 35 BnaGLYI and 30 BnaGLYII in B. napus genome. B. napus (AACC) originates from natural crossing of B. rapa (AA) and B. oleracea (CC) [43]. Sixteen BraGLYI and fourteen BraGLYII were located in the AA subgenome, while fifteen and thirteen BolGLYI and BolGLYII were located in the CC subgenome. The number of BnaGLYI gene number was much higher than the ancestral species plants B. rapa [22] and B. oleracea [33] (total 31 GLYI). The GLY families display varied sequences, which might lead to diversity in their biochemical functions. Furthermore, phylogenetic relations, gene structures, protein motifs, Ks/Ka and the expression pattern of BnaGLY gene families were systematically investigated in the study.
According to the recent GLYI screening criteria, not only metal binding sites but also GSH binding sites, active sites and dimer interfaces should be considered [44]. Meanwhile, fourteen conserved amino acids of GLYIIs were important for substrate binding, metal binding and catalytic activity [45]. Using these criteria, only three A. thaliana genes (AtGLYI2, AtGLYI3 and AtGLYI6) and two rice genes (OsGLYI8 and OsGLYI11.2) were functional and contained all the binding sites. In this study, different BnaGLYs subfamily proteins shared the different type of conserved domains, which suggested their functional diversity. Analysis of all BnaGLYI proteins revealed that 16 BnaGLYI possessed conserved metal binding sites (H/QEH/QE) and may have expected enzyme activity of the putative BnaGLYI proteins along with the catalytic domain (PF00903). In addition, fourteen of thirty putative BnaGLYII proteins contained a metal binding motif (THHHXDH) and an active site motif (C/GHT), which were similar to Escherichia coli, Saccharomyces cerevisiae, Salmonella typhimurium, L. infantum, Homo sapiens and higher plants (A. thaliana, B. juncea, O. sativa) [39].
Previous reports indicated that genes with less introns showed rapid gene activation and timely responses to various stresses [46]. In our study, BnaGLYI and BnaGLYII genes showed significantly varied gene length and exon-intron structure. However, the genes with less or no introns did not show higher expression levels as reported [46,47], e.g., BnaGLYI08 and BnaGLYI31 containing no introns showed very low level of expression, which did not show significant expression responses to the stress conditions. Meanwhile, we found that some genes expressed higher in specific tissues; for example, BnaGLYI02, BnaGLYI09 and BnaGLYI19 were highly expressed in the leaf, whereas BnaGLYII12 and BnaGLYII15 were highly expressed in seeds and BnaGLYII05 was highly expressed in flowers. These results indicate that most BnaGLY genes were expressed at different levels in different tissues. In addition, the expression of several BnaGLYI and BnaGLYII genes detected using qRT-PCR was different from the published database. This was understandable, as there were different sampling periods and growth conditions.
There is a firm link between GLY enzymes and stress tolerance in plants. The expression level of GLYI and GLYII can be induced under various stress treatments in different plants [34]. The transcripts of GLYI in tomatoes were up-regulated under salinity stress and phytohormonal and osmotic stimulation [34]. In pumpkin seedlings, the transcription level of GLYI was induced by salinity, heavy metal, white light and MG treatments [48]. Therefore, the expression patterns of the BnaGLYI and BnaGLYII genes were first analyzed using publicly available expression data in the study. The BnaGLY did not show any significant effect on winter oilseed rape germination rates, because the genes showed a similar expression pattern in accessions with different germination rates during germination. In a recent study, the glyoxalase enzyme of rice not only increased tolerance abiotic stresses (salinity, drought and extreme temperatures) but also reduced damage from biotic stresses (Rhizoctonia solani) [49]. In grapes, most glyoxalase genes had two periods of high expression after downy mildew inoculation [27]. In our study, the induced genes after infection may have a response on the S. sclerotiorum pathogen, e.g., BnaGLYI07, BnaGLYI24, BnaGLYI25, BnaGLYII02, BnaGLYII03, BnaGLYII18 and BnaGLYII19 genes, whose expressions were highly up-regulated in both cultivars. Furthermore, the genes that were only up–regulated in resistant cultivar may have related to the disease resistances of plants, such as BnaGLYI08 and BnaGLYI10. In addition, the genes up-regulated in the susceptible cultivar and down-regulated in the resistant cultivar require further study, such as the BnaGLYI17 and BnaGLYI18. However, whether glyoxalase proteins participate in S. Sclerotiorum pathogen response require further investigations.
In this study, we also uncovered that BnaGLYI and BnaGLYII genes are highly responsive to drought, heat and cold stresses, which implied these genes contribute to multiple stress responses in B. napus. For example, BnaGLYI27 was highly up-regulated under both heat drought stresses, and BnaGLYII22 was significantly induced under both chilling and freezing stresses regardless of cold acclimation. Most importantly, BnaGLYI11 was significantly up-regulated under all temperature stresses (heat, chilling and freezing stresses, regardless of cold acclimation). Considering rapeseed oil suffers cold stress during vegetative stage, the rapeseed varieties with low cold tolerance have higher risk of freeze injury in cold winter and spring. Hence, it is vital to understand the cold-induced molecular responses in rapeseed. Therefore, BnaGLYI11 was overexpressed in A. thaliana and the transgenic A. thaliana with the BnaGLYI11 gene confers freezing tolerance. Previously, we found BnaGLYI (BnaA06g04580D, BnaGLYI05) transgenic yeast cells enhanced their tolerance to extreme temperature stress [30]. Similarly, overexpression of AtGLYI2, AtGLYI3 and AtGLYI6 in E. coli provides multi-stress heat tolerance [44]. BnaGLYI11 shared approximately 96% identity with ATGLYI3, and BnaGLYΙ05 showed 98% identity with ATGLYI2 (Table S11). The alignment results indicated that BnaGLY proteins shared a high sequence similarity, which may show significant function similarity. However, the freezing-tolerant BnaGLYΙ11 showed low similarity to BnaGLYΙ05 (35%), which indicates that the cold tolerance function may be due to the conserved function domains. Further investigations should explore the mechanism of the response of the glyoxalase pathway to stress tolerance in plants to generate more stress-tolerant varieties using molecular approaches.

4. Conclusions

This study provides a systematic knowledge of BnaGLY gene family in B. napus. A total of 35 BnaGLYI and 30 BnaGLYII genes were identified. The genes in the same subfamily showed similar structure and motif composition. Phylogenetic comparison and synteny analysis of BnGLY genes provide valuable clues for their evolutionary characteristics. Moreover, the gene expression pattern and their responses to seed gemination rate, S. Sclerotiorum pathogen heat and drought and temperature stresses were also determined. The transgenic A. thaliana with the temperature stresses responding to BnaGLYI-11 confers cold tolerance. These results provide an important foundation for further understanding the biological functions of BnaGLY genes and their utilization in rapeseed breeding.

5. Methods

5.1. Plant Materials

The B. napus cultivar Zhongshuang11 used for edible oil and vegetable plants was obtained from the National Mid-term Gene Bank of Oil Crops Research Institute, Chinese Academy of Agriculture Sciences. It was planted in a growth chamber at 20 ± 2 °C with 12 h light and 12 h dark. The roots were sampled from 3-leaf stage seedlings. Fresh flower buds were obtained, and stems, leaves, siliques and seeds were sampled 25 days after flowering (DAF). Three biological replicates of each tested tissue were collected from three different individuals. All the samples were immediately frozen in liquid nitrogen and stored at −80 °C until RNA isolation. Wild-type Arabidopsis (Columbia ecotype) and overexpression transgenic lines were planted in a growth room with a constant temperature and light cycle (16 h light/8 h dark, 22 ± 1 °C, humidity 60%).

5.2. Identification of the GLYI and GLYII Genes Family in B. napus

Firstly, AtGLYI and AtGLYII protein sequences were acquired from the Arabidopsis Information Resource-TAIR (http://www.arabidopsis.org, (accessed on 12 May 2020)). The genes and proteins of B. napus were downloaded from the website of the B. napus Genome Browser (http://www.genoscope.cns.fr/brassicana pus/, (accessed on 18 May 2020)) databases. Secondly, Arabidopsis GLY protein sequences were used as query to perform the Blast P against B. napus genome. Then the protein sequences with the e-value under 1.0 × 10−10 were confirmed again by the Pfam protein family database, according to the particular domains (PF00903) in GLYI proteins and the metallo-beta-lactamase domain (PF00753) in the GLYII proteins. All identified putative GLY proteins were designated as BnaGLYI01 to BnaGLYI35 and BnaGLYII01 to BnaGLYII30 according to their location in the chromosome. Localization of proteins were predicted using the CELLO v.2.5 website (http://cello.life.nctu.edu.tw/, accessed on 20 May 2020) [50] and the WOLF PSORT website (https://www.genscript.com/wolf-psort.html, accessed on 20 May 2020) [51]. Chloroplast localization was confirmed by ChloroP (http://www.cbs.dtu.dk/services/ChloroP/, accessed on 20 May 2020) [52]. The isoelectric points (pI) and molecular weights (Mw) were calculated using the ExPASy proteomics server database (http://www.expasy.org/tools/, (accessed on 26 May 2020))

5.3. Chromosomal Location, Duplication and Ka (Non-Synonymous Mutation Rate)/Ks (Synonymous Mutation Rate) Analysis

The location information of GLY genes on chromosomes were acquired from the website of the B. napus Genome Browser. Mapping of these GLY genes was performed using the online website MG2C (http://mg2c.iask.in/mg2c_v2.0/, (accessed on 10 August 2020)). Gene duplication was defined according to the criteria described in previous studies [53,54]: the aligned region of two sequences covers over 70% of the longer sequence and the similarity of the aligned region is over 95%. In addition, the Ka and Ks values of the repeating gene pairs were calculated using DnaSp software, and then evolutionary rate and the type of selection pressure on the gene were determined based on the Ka/Ks ratio [38].

5.4. Phylogenetic Analysis, Gene Structure and Conserved Motif

The Cluster X program was used to perform multiple sequence alignments with default parameters [55]. Phylogenetic trees were subsequently constructed by the MEGA 6.0 software using Neighbor-Joining (NJ) [56]. Bootstrap analysis was conducted with 1000 replications. The iTOL website (https://itol.embl.de/, (16 August 2020)) was used to better visualize the phylogenetic tree [57].
The exon/intron of GLY genes were inferred through comparison of genomic sequences and CDS sequences in the gene structure display server (http://gsds.cbi.pku.edu.cn/index.php) [58].
The MEME online tool (http://meme-suite.org/, (accessed on 28 May 2020)) [59] was employed to identify conserved motifs in BnaGLY genes with the following parameters: distribution of motifs, the optimum width of motif, 6–50; the maximum number of motif, 5; the number of repetitions, any. Only motifs with an e-value < 1.0 × 10−10 were retained for further analysis.
The conserved domains were retrieved, using NCBI Conserved Domain Database (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, (accessed on 23 December 2022)) and Visualized NCBI CDD pattern of TB-tools (https://github.com/CJ-Chen/TBtools, (accessed on 27 December 2022)) [60].

5.5. Expression Analysis of BnaGLY Genes at Different Developmental Stages and Under Stress Treatments

The temporal and spatial expression patterns of BnaGLY were analyzed using the RNA-seq data online (https://biodb.swu.edu.cn/brassica/, (accessed on 15 June 2020)), including roots, stems, leaves, flowers, seeds and silique tissues and germination, bolting, initial flowering and podding stages. Stem-1 was sampled at the bolting stage. Stem-2, anther, filament, pedicel, inflorescence tip, mature leaf, young leaf, petal and carpel root were sampled at the initial flowering stage. The embryo, inner integument, outer integument, seed, silique pericarp, embryo and seed coat were sampled at podding stage. All the materials were planted in the field.
The publicly available data of the gene expression omnibus (GEO) database (GSE13723) was used to reveal the probable function of BnaGLY genes in the germination of winter oilseed rape with different germination rate [61]. The expression of all BnaGLYI genes in response to Sclerotinia infection was analyzed using the reported RNA-seq data (GSE81545). The inoculated leaves in both susceptible (Westar) and tolerant (ZY821) genotypes of B. napus were analyzed [40]. The RNA-seq data of a 35-day-old leaf with treatment of heat (40 °C, 3 h) and drought (withdrawing water, 3 days) (GSE156029) was used to analysis the response of BnaGLY genes to heat and drought stresses. The transcriptome data of B. napus under cold (4 °C, 12 h) and freezing (−4 °C, 12 h) (GSE129220) temperatures was downloaded from the NCBI database [62].
The data was used to generate a heatmap using the Heat map Illustrator (HemI, http://hemi.biocuckoo.org/down.php, (accessed on 15 October 2020)) package [45].

5.6. Plasmid Construction and Plant Transformation

The coding sequence of BnaA08g25110D was amplified by PCR and cloned into PBI121s [63] to generate the over-expression plasmids 35S::BnaGLYI, 35S::BnaGLYI, and 35S::BnaGLYI, respectively. Primers containing restriction enzyme sites for Xbal Ⅰ and Kpn Ⅰ were used for PCR as follows: BnaGLYI11-F: 5’ AGCTTTCGCGAGCTCGGTACCACAGAAAACTCTCAAAGCCC 3’, BnaGLYI11-R: 5’ TGCCTGCAGGTCGACTCTAGAAACACAGAGAAACACGACAC 3’. The constructs used were confirmed by PCR and sequencing.
All the plasmids were transformed into Agrobacterium tumefaciens strain GV3101, and the positive clones identified by sequencing were introduced into 5-week-old Arabidopsis plants (Columbia ecotype) using the floral dip method. Positives were selected on MS plates containing 50 mg L−1 Kanamycin. The positive transformants was detected using a forward primer designed to the CaMV 35S sequence (35s up-F: 5’ ATTGATGTGAACATGGTGGAG 3’) and a reverse primer of the gene expression (BnaGLYI11-RT-R: 5’ TTGTCTACCAGGACTGTTTTCC 3’). T1 seeds of PCR-positive transformants were harvested and grown to generation, and T3 generation was used for phenotype identification and gene expression.

5.7. RNA Isolation and Transcript Analysis

The gene expression of the definitive positive plants was analyzed by qRT-PCR. The total RNA from WT and Transgenetic plants was isolated using a polysaccharide and polyphenol total RNA isolation kit (BioTeke, RP3201, Wuxi, China). The cDNA was synthesized using a synthesis kit (EasyScript® First-Strand cDNA Synthesis SuperMix, TransGen Biotech, Beijing, China), and the qRT-PCR and data analysis were carried out as descried by Li et al. [64]. Each sample was quantified in triplicate with three biological replicates. The specific primers (BnaGLYI11-RTF: 5’ AGCTGACCTATAACTACGGCG 3’, BnaGLYI11-RTR: 5’ TTGTCTACCAGGACTGTTTTCC3’) designed are used for the detection.

5.8. Freezing Tolerance Assay

The freezing tolerance assay was performed as previously described [65], with some modifications. Briefly, seeds were grown 14 days on MS medium at 22 °C with 8 h of light daily. Before cold treatment, the 2-week-old seedlings were plated to 4 °C for three days, and then subjected to 210 min at −10 °C for cold stress treatment. After cold treatment, the seedlings were incubated at 4 °C in the dark for 12 h and then transferred to light at 22 °C. The survival rates of the seedlings were scored visually after 7 days.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24032130/s1.

Author Contributions

Designed the experiments: G.Y. and X.W. Analyzed the data: G.Y., M.Z., F.Z., W.G., L.Y., W.D. and G.G., K.X., B.C. and L.L. Wrote the paper: G.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Natural Science Foundation of China grant number 32072106, Agricultural Science and Technology Innovation Project grant number CAAS-ZDRW202105, CAAS-OCRI-ZDRW-202201 and CAAS-ASTIP, National Crop Germplasm Resources Center grant number NCGRC2022-016, China Agriculture Research System grant number CARS-12.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare that they have no conflict of interest.

Abbreviations

aa: amino acid; bp: base pair; Br: Brassica rapa; BRAD: Brassica database; CDS: Coding DNA sequence; Ch: chloroplast; Cy: cytosol; Ec: extracellular matrix; FPKM: Fragments Per Kilo base of exon sper Million fragments mapped; GLYI: glyoxalase I; GLYII: glyoxalase II; GSH: Glutathione (reduced); hai: Hours after inoculation; Kb: Kilo base pair; MG: Methylglyoxal; Mt: mitochondria; MW: molecular weight; NJ: Neighbor-joining; Nu: nucleus; GEO: gene expression omnibus; ROS: Reactive oxygen species; Os: Oryza sativa; Ou: outermembrane, Pe: periplasm; Pg: Pennisetum glaucum; PI: isoelectric point; PP: polypeptide length; ROS: Reactive oxygen species; hai: hour after imbibition

References

  1. Cartea, M.E.; Lema, M.; Francisco, M.; Velasco, P.; Sadowski, J.; Kole, C. Basic information on vegetable Brassica crops. In Genetics, Genomics and Breeding of Vegetable Brassicas; CRC Press: Boca Raton, FL, USA, 2011; pp. 1–34. [Google Scholar]
  2. Wang, H.Z. New-demand oriented oilseed rape industry developing strategy. Chin. J. Oil Crop Sci. 2018, 40, 613–617. (In Chinese) [Google Scholar]
  3. Zhang, Z.; Yin, Y.; Liu, F.; Wang, J.J.; Fu, T.D. Current situation and development countermeasures of Chinese rapeseed multifunctional development and utilization. Chin. J. Oil Crop Sci. 2018, 40, 618–623. (In Chinese) [Google Scholar]
  4. Clemens, S.; Aarts, M.G.; Thomine, S.; Verbruggen, N. Plant science: The key to preventing slow cadmium poisoning. Trends Plant Sci. 2013, 18, 92–99. [Google Scholar] [CrossRef] [PubMed]
  5. Rajwanshi, R.; Kumar, D.; Yusuf, M.A.; DebRoy, S.; Sarin, N.B. Stress-inducible overexpression of glyoxalase I is preferable to its constitutive overexpression for abiotic stress tolerance in transgenic Brassica juncea. Mol. Breed. 2016, 36, 76. [Google Scholar] [CrossRef]
  6. Deponte, M. Glutathione catalysis and the reaction mechanisms of glutathione-dependent enzymes. Biochim. Biophys. Acta 2013, 1830, 3217–3266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Silva, M.S.; Ferreira, A.E.N.; Gomes, R.; Tomas, A.M.; Freire, A.P.; Cordeiro, C. The glyoxalase pathway in protozoan parasites. Int. J. Med. Microbiol. 2012, 302, 225–229. [Google Scholar] [CrossRef] [PubMed]
  8. Hanssen, N.M.; Stehouwer, C.D.; Schalkwijk, C.G. Methylglyoxal and glyoxalase I in atherosclerosis. Biochem. Soc. Trans. 2014, 42, 443–449. [Google Scholar]
  9. Edwards, L.G.; Adesida, A.; Thornalley, P.J. Inhibition of human leukaemia 60 cell growth by S-D-lactoylglutathione In Vitro. Mediation by metabolism to N-D-lactoylcysteine and induction of apoptosis. Leuk. Res. 1996, 20, 17–26. [Google Scholar] [CrossRef]
  10. Marasinghe, G.P.; Sander, I.M.; Bennett, B.; Periyannan, G.; Yang, K.W.; Makaroff, C.A.; Crowder, M.W. Structural studies on a mitochondrial glyoxalase II. J. Biol. Chem. 2005, 280, 40668–40675. [Google Scholar] [CrossRef] [Green Version]
  11. Ghosh, A.; Kushwaha, H.R.; Hasan, M.R.; Pareek, A.; Sopory, S.K.; Singla-Pareek, S.L. Presence of unique glyoxalase III proteins in plants indicates the existence of shorter route for methylglyoxal detoxification. Sci. Rep. 2016, 6, 18358. [Google Scholar] [CrossRef] [Green Version]
  12. Veena, R.V.S.; Sopory, S.K. Glyoxalase I from Brassica juncea: Molecular cloning, regulation and its over-expression confer tolerance in transgenic tobacco under stress. Plant J. 1999, 17, 385–395. [Google Scholar] [PubMed]
  13. Singla-Pareek, S.L.; Reddy, M.K.; Sopory, S.K. Genetic engineering of the glyoxalase pathway in tobacco leads to enhanced salinity tolerance. Proc. Natl. Acad. Sci. USA 2003, 100, 14672–14677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Wu, C.; Ma, C.; Pan, Y.; Gong, S.; Zhao, C.; Chen, S.; Li, H. Sugar beet M14 glyoxalase I gene can enhance plant tolerance to abiotic stresses. J. Plant Res. 2013, 126, 415–425. [Google Scholar] [CrossRef] [PubMed]
  15. Viveros, M.F.; Inostroza-Blancheteau, C.; Timmermann, T.; Gonzalez, M.; Arce-Johnson, P. Overexpression of GlyI and GlyII genes in transgenic tomato (Solanum lycopersicum Mill.) plants confers salt tolerance by decreasing oxidative stress. Mol. Biol. Rep. 2013, 40, 3281–3290. [Google Scholar] [CrossRef]
  16. Hasanuzzaman, M.; Nahar, K.; Hossain, M.S.; Mahmud, J.A.; Rahman, A.; Inafuku, M.; Oku, H.; Fujita, M. Coordinated actions of Glyoxalase and antioxidant defense systems in conferring abiotic stress tolerance in Plants. Int. J. Mol. Sci. 2017, 18, 200. [Google Scholar] [CrossRef] [Green Version]
  17. Saxena, M.; Bisht, R.; Roy, S.D.; Sopory, S.K.; Bhalla-Sarin, N. Cloning and characterization of a mitochondrial glyoxalase II from Brassica juncea that is upregulated by NaCl, Zn, and ABA. Biochem. Biophys. Res. Commun. 2005, 336, 813–819. [Google Scholar] [CrossRef]
  18. Lee, D.G.; Ahsan, N.; Lee, S.H.; Lee, J.J.; Bahk, J.D.; Kang, K.Y.; Lee, B.H. Chilling stress-induced proteomic changes in rice roots. J. Plant Physiol. 2009, 166, 1–11. [Google Scholar] [CrossRef]
  19. Zhou, S.; Sauve, R.; Thannhauser, T.W. Proteome changes induced by aluminium stress in tomato roots. J. Exp. Bot. 2009, 60, 1849–1857. [Google Scholar] [CrossRef] [Green Version]
  20. Hossain, M.A.; Fujita, M. Purification of glyoxalase I from onion bulbs and molecular cloning of its cDNA. Biosci. Biotechnol. Biochem. 2009, 73, 2007–2013. [Google Scholar] [CrossRef]
  21. Liang, Y.; Srivastava, S.; Rahman, M.H.; Strelkov, S.E.; Kav, N.N. Proteome changes in leaves of Brassica napus L. as a result of Sclerotinia sclerotiorum challenge. J. Agric. Food Chem. 2008, 56, 1963–1976. [Google Scholar] [CrossRef]
  22. Yan, G.; Xiao, X.; Wang, N.; Zhang, F.; Gao, G.; Xu, K.; Chen, B.; Qiao, J.; Wu, X. Genome-wide analysis and expression profiles of glyoxalase gene families in Chinese cabbage (Brassica rapa L). PLoS ONE 2018, 13, e0191159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Kaur, C.; Singla-Pareek, S.L.; Sopory, S.K. Glyoxalase and methylglyoxal as biomarkers for plant stress tolerance. Crit. Rev. Plant Sci. 2014, 33, 429–456. [Google Scholar] [CrossRef]
  24. Lin, F.; Xu, J.; Shi, J.; Li, H.; Li, B. Molecular cloning and characterization of a novel glyoxalase I gene TaGly I in wheat (Triticum aestivum L.). Mol. Biol. Rep. 2010, 37, 729–735. [Google Scholar] [CrossRef] [PubMed]
  25. Singla-Pareek, S.L.; Yadav, S.K.; Pareek, A.; Reddy, M.K.; Sopory, S.K. Transgenic tobacco overexpressing glyoxalase pathway enzymes grow and set viable seeds in zinc-spiked soils. Plant Physiol. 2006, 140, 613–623. [Google Scholar] [CrossRef] [Green Version]
  26. Tang, F.L.; Li, R.M.; Zhou, Y.; Wang, S.; Zhou, Q.; Ding, Z.; Yao, Y.; Liu, J.; Wang, Y.; Hu, X.; et al. Genome-wide Identification of Cassava Glyoxalase I genes and the potential function of MeGLYI-13 in iron toxicity tolerance. Int. J. Mol. Sci. 2022, 23, 5212. [Google Scholar] [CrossRef]
  27. Li, T.; Cheng, X.; Wang, Y.; Yin, X.; Li, Z.; Liu, R.; Liu, G.; Wang, Y.; Xu, Y. Genome-wide analysis of glyoxalase-like gene families in grape (Vitis vinifera L.) and their expression profiling in response to downy mildew infection. BMC Genom. 2019, 20, 362. [Google Scholar] [CrossRef] [Green Version]
  28. Mustafiz, A.; Singh, A.K.; Pareek, A.; Sopory, S.K.; Singla-Pareek, S.L. Genome-wide analysis of rice and Arabidopsis identifies two glyoxalase genes that are highly expressed in abiotic stresses. Funct. Integr. Genom. 2011, 11, 293–305. [Google Scholar] [CrossRef]
  29. Ghosh, A. Genome-wide identification of glyoxalase genes in medicago truncatula and their expression profiling in response to various developmental and environmental stimuli. Front. Plant Sci. 2017, 8, 836. [Google Scholar] [CrossRef]
  30. Yan, G.; Lv, X.; Gao, G.; Li, F.; Li, J.; Qiao, J.; Xu, K.; Chen, B.; Wang, L.; Xiao, X.; et al. Identification and characterization of a glyoxalase I gene in a rapeseed cultivar with seed thermotolerance. Front. Plant Sci. 2016, 7, 150. [Google Scholar] [CrossRef] [Green Version]
  31. Ghosh, A.; Islam, T. Genome-wide analysis and expression profiling of glyoxalase gene families in soybean (Glycine max) indicate their development and abiotic stress specific response. BMC Plant Biol. 2016, 16, 87. [Google Scholar] [CrossRef] [Green Version]
  32. Li, Z.G. Role of methylglyoxal and its detoxifcation system in plant thermotolerance. Acta Physiol. Plant. 2022, 44, 69. [Google Scholar] [CrossRef]
  33. Zhang, M.; Yuan, L.; Zhang, F.; Guan, W.; Yan, G.; Wu, X. Identification and expression analysis of Glyoxalase gene family in Brassica oleracea L. 2021. Available online: https://kns.cnki.net/kcms/detail/46.1068.S.20210603.1558.012.htm (accessed on 25 November 2022). (In Chinese).
  34. Espartero, J.; Sanchez-Aguayo, I.; Pardo, J.M. Molecular characterization of glyoxalase-I from a higher plant; upregulation by stress. Plant Mol. Biol. 1995, 29, 1223–1233. [Google Scholar] [CrossRef] [PubMed]
  35. Sethi, U.; Basu, A.; Guha-Mukherjee, S. Control of cell proliferation and differentiation by regulating polyamine biosynthesis in cultures of Brassica and its correlation with glyoxalase–I activity. Plant Sci. 1988, 56, 167–175. [Google Scholar] [CrossRef]
  36. Ramaswamy, O.; Pal, S.; Guha-Mukherjee, S.; Sopory, S.K. Correlation of glyoxalase I activity with cell proliferation in Datura callus culture. Plant Cell Rep. 1984, 3, 121–124. [Google Scholar] [CrossRef] [PubMed]
  37. Chalhoub, B.; Denoeud, F.; Liu, S.; Parkin, I.A.; Tang, H.; Wang, X.; Chiquet, J.; Belcram, H.; Tong, C.; Samans, B.; et al. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science 2014, 345, 950–953. [Google Scholar] [CrossRef] [Green Version]
  38. Nekrutenko, A.; Makova, K.D.; Li, W.H. The K(A)/K(S) ratio test for assessing the protein-coding potential of genomic regions: An empirical and simulation study. Genome Res. 2002, 12, 198–202. [Google Scholar] [CrossRef] [Green Version]
  39. Ghosh, A.; Pareek, A.; Sopory, S.K.; Singla-Pareek, S.L. A glutathione responsive rice glyoxalase II, OsGLYII-2, functions in salinity adaptation by maintaining better photosynthesis efficiency and anti-oxidant pool. Plant J. 2015, 80, 93–105. [Google Scholar] [CrossRef] [Green Version]
  40. Girard, I.J.; Tong, C.; Becker, M.G.; Mao, X.; Huang, J.; de Kievit, T.; Fernando, W.G.D.; Liu, S.; Belmonte, M.F. RNA sequencing of Brassica napus reveals cellular redox control of Sclerotinia infection. J. Exp. Bot. 2017, 68, 5079–5091. [Google Scholar] [CrossRef] [Green Version]
  41. Hoque, T.S.; Hossain, M.A.; Mostofa, M.G.; Burritt, D.J.; Fujita, M.; Tran, L.S. Methylglyoxal: An emerging signaling molecule in plant abiotic stress responses and tolerance. Front. Plant Sci. 2016, 7, 1341. [Google Scholar] [CrossRef] [Green Version]
  42. Ridderstrom, M.; Cameron, A.D.; Jones, T.A.; Mannervik, B. Involvement of an active-site Zn2+ ligand in the catalytic mechanism of human glyoxalase I. J. Biol. Chem. 1998, 273, 21623–21628. [Google Scholar] [CrossRef] [Green Version]
  43. Nagaharu, U. Genome analysis in Brassica with special reference to the experimental formation of B. napus and peculiar mode of fertilization. Jpn. J. Bot. 1935, 7, 389–452. [Google Scholar]
  44. Jain, M.; Batth, R.; Kumari, S.; Mustafiz, A. Arabidopsis thaliana Contains Both Ni2+ and Zn2+ dependent Glyoxalase I enzymes and ectopic expression of the latter contributes more towards abiotic stress tolerance in E. coli. PLoS ONE 2016, 11, e0159348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Limphong, P.; Crowder, M.W.; Bennett, B.; Makaroff, C.A. Arabidopsis thaliana GLX2-1 contains a dinuclear metal binding site, but is not a glyoxalase 2. Biochem. J. 2009, 417, 323–330. [Google Scholar] [CrossRef] [Green Version]
  46. Jeffares, D.C.; Penkett, C.J.; Bahler, J. Rapidly regulated genes are intron poor. Trends Genet. 2008, 24, 375–378. [Google Scholar] [CrossRef]
  47. Chung, B.Y.; Simons, C.; Firth, A.E.; Brown, C.M.; Hellens, R.P. Effect of 5’-UTR introns on gene expression in Arabidopsis thaliana. BMC Genom. 2006, 7, 120. [Google Scholar] [CrossRef] [Green Version]
  48. Hossain, M.A.; Hossain, M.Z.; Fujita, M. Stress-induced changes of methylglyoxal level and glyoxalase I activity in pumpkin seedlings and cDNA cloning of glyoxalase I gene. Aust. J. Crop Sci. 2009, 3, 53–64. [Google Scholar]
  49. Gupta, B.K.; Sahoo, K.K.; Ghosh, A.; Tripathi, A.K.; Anwar, K.; Das, P.; Singh, A.K.; Pareek, A.; Sopory, S.K.; Singla-Pareek, S.L. Manipulation of glyoxalase pathway confers tolerance to multiple stresses in rice. Plant Cell Environ. 2018, 41, 1186–1200. [Google Scholar] [CrossRef]
  50. Yu, C.S.; Hwang, J.K. Prediction of protein subcellular localization. IEEE Comput. Soc. 2006, 64, 643–651. [Google Scholar] [CrossRef] [PubMed]
  51. Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef] [Green Version]
  52. Emanuelsson, O.; Nielsen, H.; von Heijne, G. ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci. 1999, 8, 978–984. [Google Scholar] [CrossRef] [Green Version]
  53. Yang, S.; Zhang, X.; Yue, J.X.; Tian, D.; Chen, J.Q. Recent duplications dominate NBS-encoding gene expansion in two woody species. Mol. Genet. Genom. 2008, 280, 187–198. [Google Scholar] [CrossRef] [PubMed]
  54. Zhou, T.; Wang, Y.; Chen, J.Q.; Araki, H.; Jing, Z.; Jiang, K.; Shen, J.; Tian, D. Genome-wide identification of NBS genes in japonica rice reveals significant expansion of divergent non-TIR NBS-LRR genes. Mol. Genet. Genom. 2004, 271, 402–415. [Google Scholar] [CrossRef] [PubMed]
  55. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The ClustalX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Letunic, I.; Bork, P. Interactive tree of life (iTOL) v3: An online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016, 44, W242–W245. [Google Scholar] [CrossRef]
  58. Guo, A.Y.; Zhu, Q.H.; Chen, X.; Luo, J.C. GSDS: A gene structure display server. Hereditas 2007, 29, 1023–1026. [Google Scholar] [CrossRef]
  59. Bailey, T.L.; Williams, N.; Misleh, C.; Li, W.W. MEME: Discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res. 2006, 34, W369–W373. [Google Scholar] [CrossRef]
  60. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An iIntegrative tToolkit developed for in-teractive analyses of big biological data. Mol. Plant 2020, 13, 9. [Google Scholar] [CrossRef]
  61. Boter, M.; Calleja-Cabrera, J.; Carrera-Castano, G.; Wagner, G.; Hatzig, S.V.; Snowdon, R.J.; Legoahec, L.; Bianchetti, G.; Bouchereau, A.; Nesi, N.; et al. An integrative approach to analyze seed germination in Brassica napus. Front. Plant Sci. 2019, 10, 1342. [Google Scholar] [CrossRef] [Green Version]
  62. Xin, H.; Xianchao, N.; Pan, X.; Wei, L.; Min, Y.; Yu, K.; Qin, L.; Hua, W. Comparative transcriptome analyses revealed conserved and novel responses to cold and freezing stress in Brassica napus L. G3 Genes|Genomes|Genet. 2019, 9, 2723–2737. [Google Scholar] [CrossRef] [Green Version]
  63. Liu, F.; Xiong, X.J.; Wu, L.; Fu, D.H.; Hayward, A.; Zeng, X. Braltp1, a lipid transfer protein gene involved in epicuticular wax deposition, cell proliferation and flower development in Brassica napus. PLoS ONE 2014, 9, e110272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Li, J.; Gao, G.; Xu, K.; Chen, B.Y.; Yan, G.X.; Li, F.; Qiao, J.W.; Zhang, T.Y.; Wu, X.M. Genome-wide survey and expression analysis of the putative non-specific lipid transfer proteins in Brassica rapa L. PLoS ONE 2014, 9, e84556. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Ye, K.; Li, H.; Ding, Y.; Shi, Y.; Song, C.; Gong, Z.; Yang, S. Brassinosteroid-insensitive 2 negatively regulates the stability of transcription factor ICE1 in response to cold stress in Arabidopsis. Plant Cell 2019, 31, 2682–2696. [Google Scholar] [PubMed]
Figure 1. Chromosomal localization of BnaGLYI (a) and BnaGLYII (b) genes in the B. napus chromosomes. Duplicated genes are connected by black lines.
Figure 1. Chromosomal localization of BnaGLYI (a) and BnaGLYII (b) genes in the B. napus chromosomes. Duplicated genes are connected by black lines.
Ijms 24 02130 g001
Figure 2. Phylogenetic relationship and gene structure of BnaGLYI and BnaGLYII. (a) BnaGLYI, (b) BnaGLYII. An unrooted tree was generated by MEGA 7.0 software (the bootstrap value is 1000) using the full-length amino acid sequences. Exons and untranslated regions (UTR) are indicated by rectangles (red and blue) and introns by lines. CDS and amino acid sequences of BnaGLYI and BnaGLYII are listed in additional data sheet (Table S5 and S6).
Figure 2. Phylogenetic relationship and gene structure of BnaGLYI and BnaGLYII. (a) BnaGLYI, (b) BnaGLYII. An unrooted tree was generated by MEGA 7.0 software (the bootstrap value is 1000) using the full-length amino acid sequences. Exons and untranslated regions (UTR) are indicated by rectangles (red and blue) and introns by lines. CDS and amino acid sequences of BnaGLYI and BnaGLYII are listed in additional data sheet (Table S5 and S6).
Ijms 24 02130 g002
Figure 3. Phylogenetic relationships of BnaGLYΙ (a) and BnaGLYII (b) from various plant species. A phylogenetic tree was constructed based on the multiple alignment results, using MEGA 7.0 software with the Neighbor-Joining method. Bootstrap support from 1,000 reiterations is indicated above the branches. The 112 GLYI proteins from B. napus (35), B. rapa (16), B. oleracea (15), Arabidopsis (11) G. max (24) and O sativa (11) were used in phylogenetic analysis of BnaGLYΙ (a), and the 81 GLYII proteins from B. napus (30), B. rapa (15), B. oleracea (16), Arabidopsis (5), G. max (24) and O sativa (3) were used in phylogenetic analysis of BnaGLYΙI (b). Only the first splice variants were considered in the case of multiple members, respectively. “At”, “Bra”, “Bol”, “Gm” and “Os” refer to the proteins in A. thaliana, B. rapa, B. oleracea, G. max and O sativa. Proteins from B. napus, B. rapa, B. oleracea, Arabidopsis, G. max and O sativa are marked with solid circles, red triangles, check marks, stars, blue triangles and squares, respectively. The sequences used in the analysis are listed in additional data sheet (Table S7).
Figure 3. Phylogenetic relationships of BnaGLYΙ (a) and BnaGLYII (b) from various plant species. A phylogenetic tree was constructed based on the multiple alignment results, using MEGA 7.0 software with the Neighbor-Joining method. Bootstrap support from 1,000 reiterations is indicated above the branches. The 112 GLYI proteins from B. napus (35), B. rapa (16), B. oleracea (15), Arabidopsis (11) G. max (24) and O sativa (11) were used in phylogenetic analysis of BnaGLYΙ (a), and the 81 GLYII proteins from B. napus (30), B. rapa (15), B. oleracea (16), Arabidopsis (5), G. max (24) and O sativa (3) were used in phylogenetic analysis of BnaGLYΙI (b). Only the first splice variants were considered in the case of multiple members, respectively. “At”, “Bra”, “Bol”, “Gm” and “Os” refer to the proteins in A. thaliana, B. rapa, B. oleracea, G. max and O sativa. Proteins from B. napus, B. rapa, B. oleracea, Arabidopsis, G. max and O sativa are marked with solid circles, red triangles, check marks, stars, blue triangles and squares, respectively. The sequences used in the analysis are listed in additional data sheet (Table S7).
Ijms 24 02130 g003
Figure 4. Multiple sequence alignment of GLY domain of all BnaGLYI and BnaGLYII proteins. (a) The conserved amino acids (H/QEH/QE) of BnaGLYI were marked by red boxes. (b) The red boxes indicate the most conserved metal binding motif (THHHXDH) and active site motif (G/CHT) of BnaGLYII proteins.
Figure 4. Multiple sequence alignment of GLY domain of all BnaGLYI and BnaGLYII proteins. (a) The conserved amino acids (H/QEH/QE) of BnaGLYI were marked by red boxes. (b) The red boxes indicate the most conserved metal binding motif (THHHXDH) and active site motif (G/CHT) of BnaGLYII proteins.
Ijms 24 02130 g004
Figure 5. Relative expressions of the BnaGLYI (a) and BnaGLYII (b) genes in different tissues of B. napus confirmed by qRT-PCR. The normalized relative quantity in the root was set as “1”.
Figure 5. Relative expressions of the BnaGLYI (a) and BnaGLYII (b) genes in different tissues of B. napus confirmed by qRT-PCR. The normalized relative quantity in the root was set as “1”.
Ijms 24 02130 g005aIjms 24 02130 g005b
Figure 6. Expression profiles of the BnaGLY genes in response to P. brassicae infection. Relative expression data of available BnaGLYI (a) and BnaGLYII (b) genes under P. brassicae infection were obtained from BrassicaEDB database (https://biodb.swu.edu.cn/brassica/, accessed on 15 June 2020). The expression level of the inoculated leaves in susceptible (Westar) and tolerant (ZY821) genotypes were analyzed. Note: CK: Control condition; TR: Treatment under P. brassicae infection.
Figure 6. Expression profiles of the BnaGLY genes in response to P. brassicae infection. Relative expression data of available BnaGLYI (a) and BnaGLYII (b) genes under P. brassicae infection were obtained from BrassicaEDB database (https://biodb.swu.edu.cn/brassica/, accessed on 15 June 2020). The expression level of the inoculated leaves in susceptible (Westar) and tolerant (ZY821) genotypes were analyzed. Note: CK: Control condition; TR: Treatment under P. brassicae infection.
Ijms 24 02130 g006
Figure 7. Expression profiles of the BnaGLY genes in response to heat and drought stresses. Relative expression data of available BnaGLYI (a) and BnaGLYII (b) genes under heat (40 °C, 3 h) and drought (withdrawing water, 3 days) treatment were obtained from NCBI GEO database (GSE156029, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE156029, (accessed on 16 December 2022)).
Figure 7. Expression profiles of the BnaGLY genes in response to heat and drought stresses. Relative expression data of available BnaGLYI (a) and BnaGLYII (b) genes under heat (40 °C, 3 h) and drought (withdrawing water, 3 days) treatment were obtained from NCBI GEO database (GSE156029, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE156029, (accessed on 16 December 2022)).
Ijms 24 02130 g007
Figure 8. Expression of BnaGLY genes under different low-temperature treatments. (a) BnaGLYI genes; (b) BnaGLYI genes. The expression levels of each gene (log2 (FPKM values + 1)) in each sample is indicated by different color rectangles. The transcripts of each gene in leaves treated with chilling and freezing, with or without cold acclimation, were determined using the data from GEO (GSE129220). HX17 and HX58 were two early maturing semi-winter rapeseed varieties. This shows the expression level of BnGLY genes in the two B. napus varieties with different cold tolerances under cold accumulations at chilling (CA) and freezing (FA) temperature and cold shocks at the same temperature (CB and FB) condition. MA and MB were the control with and without cold accumulations, respectively.
Figure 8. Expression of BnaGLY genes under different low-temperature treatments. (a) BnaGLYI genes; (b) BnaGLYI genes. The expression levels of each gene (log2 (FPKM values + 1)) in each sample is indicated by different color rectangles. The transcripts of each gene in leaves treated with chilling and freezing, with or without cold acclimation, were determined using the data from GEO (GSE129220). HX17 and HX58 were two early maturing semi-winter rapeseed varieties. This shows the expression level of BnGLY genes in the two B. napus varieties with different cold tolerances under cold accumulations at chilling (CA) and freezing (FA) temperature and cold shocks at the same temperature (CB and FB) condition. MA and MB were the control with and without cold accumulations, respectively.
Ijms 24 02130 g008
Figure 9. The function of the BnaGLYI11 gene in response to cold stress. (a) The expression level of BnaGLYI11 in overexpression A. thaliana lines OE-3 and OE-7 in 7-day-old seedling. (b) Survival rate after −10 °C for cold stress treatment. Two-week-old seedlings grown on MS medium (22 °C with 8 h of light daily) were treated at −10 °C for 210 min after 4 °C for three days. After cold treatment, the seedlings were incubated at 4 °C in the dark for 12 h and then transferred to normal grown conditions. The survival rates of the seedlings were scored visually after 7 days. WT: wild-type (Col-0), OE: BnaGLYI11 gene overexpression lines. (c) phenotype of wild-type (Col-0) and transgenic BnaGLYI11 gene after −10 °C treatment. Asterisks represent the statistical significance between the means for each treatment. ** p < 0.001. Vertical bars in the graph represent mean ± SD.
Figure 9. The function of the BnaGLYI11 gene in response to cold stress. (a) The expression level of BnaGLYI11 in overexpression A. thaliana lines OE-3 and OE-7 in 7-day-old seedling. (b) Survival rate after −10 °C for cold stress treatment. Two-week-old seedlings grown on MS medium (22 °C with 8 h of light daily) were treated at −10 °C for 210 min after 4 °C for three days. After cold treatment, the seedlings were incubated at 4 °C in the dark for 12 h and then transferred to normal grown conditions. The survival rates of the seedlings were scored visually after 7 days. WT: wild-type (Col-0), OE: BnaGLYI11 gene overexpression lines. (c) phenotype of wild-type (Col-0) and transgenic BnaGLYI11 gene after −10 °C treatment. Asterisks represent the statistical significance between the means for each treatment. ** p < 0.001. Vertical bars in the graph represent mean ± SD.
Ijms 24 02130 g009
Table 1. Detail information of BnaGLYI genes identified in Brassica napus L. genomes.
Table 1. Detail information of BnaGLYI genes identified in Brassica napus L. genomes.
Gene SymbolLocus IdentifierLocationGene Start (bp)Gene Stop (bp)StrandNo. of IntronsCDS Length (bp)PP Length (aa)MW (kDa)pILocalization
BnaGLYI01BnaA02g19970DA021233727212338438250416818,818.685.81Cy a; Nu b
BnaGLYI02BnaA03g10440DA0347006614701804+358219421,785.918.43Cy a; Mt b
BnaGLYI03BnaA05g35240DA05670044672049341413815,252.225.46Cy a; Nu b
BnaGLYI04BnaA06g04170DA0625471232548306351617219,274.77.77Cy a; Ch b
BnaGLYI05BnaA06g04580DA0627080142710119+771423826,635.178.33Cy a; Om a; Ch b,c
BnaGLYI06BnaA06g07360DA0639156593923909+2636481216134,984.628.86Cy a,b
BnaGLYI07BnaA06g10060DA0653426125343786+252517519,778.795.68Cy a; Ch b
BnaGLYI08BnaA07g13890DA071226344012263994+055518520,887.374.78Cy a,b
BnaGLYI09BnaA07g26290DA0719358162193614778102634237,894.446.48Cy a; Ch b,c
BnaGLYI10BnaA08g23870DA081684351316844540252517519,846.965.88Cy a; Ch b
BnaGLYI11BnaA08g25110DA081735780517359871785228431,872.415.26Cy a,b
BnaGLYI12BnaA09g49270DA093281419932815336+241413815,394.225.84Cy a; Ch b
BnaGLYI13BnaA09g49870DA093309320033095241+1132344148,072.125.72Cy a;Om a;Cysk b
BnaGLYI14BnaA09g56790DA0938899683891223+250416818,943.895.86Cy a; Ch b
BnaGLYI15BnaA10g04310DA10227233422738341133844648,973.025.45Om a; Cy b
BnaGLYI16BnaA10g11070DA1093462889347612358819621,9596.71Cy a; Mt b
BnaGLYI17BnaC02g23290DC022028101220282133250416818,762.535.66Cy a; Nu b
BnaGLYI18BnaC02g46640DC0223947132395834+250416818,804.615.66Cy a; Nu b
BnaGLYI19BnaC03g13130DC0363130426314254+358219421,712.867.77Cy a; Ch b
BnaGLYI20BnaC03g51010DC033547907035480133445315116,992.135.25Cy a; Nu b
BnaGLYI21BnaC05g04530DC03223148522334891133844648,857.975.65Cy a,b; Om a
BnaGLYI22BnaC05g05340DC0526097872610529241713915,596.415.94Cy a,b
BnaGLYI23BnaC05g05770DC0528482402850316+770823626,438.958.74Cy a; Pe a;Ch b,c
BnaGLYI24BnaC05g08770DC0546596514665014+19217572580,672.517.49Cy a,b; Om a
BnaGLYI25BnaC05g11680DC0568007396802181+252517519,733.755.68Cy a; Ch b
BnaGLYI26BnaC06g28360DC0629576211295786068103834638,368.976.19Cy a;Ch b,c
BnaGLYI27BnaC08g15100DC081965883519661229+785228431,814.275.26Cy a,b
BnaGLYI28BnaC08g16660DC082057696620578018+252517519,821.865.89Cy a; Ch b
BnaGLYI29BnaC08g38920DC083493045934931660252217419,568.625.86Cy a; Mt b
BnaGLYI30BnaC08g44820DC0837849659378511601132344148,162.215.46Cy a; Cysk b
BnaGLYI31BnaC09g53670DC0936445313644929+039913315,196.727.77Cy a,b
BnaGLYI32BnaCnng38880DCnn3752158537522696241413815,502.366.2Cy a; Ch b
BnaGLYI33BnaCnng47290DCnn4676425146765432543214416,180.325.39Cy a,b
BnaGLYI34BnaCnng47280DCnn4675803646759221532410812,264.15.01Cy a; Nu b
BnaGLYI35BnaCnng59150DCnn5886258058863862341413815,253.165.45Cy a; Nu b
Abbreviations: CDS: coding DNA sequence, PP: polypeptide length, MW: molecular weight, PI: isoelectric point, bp: base pair, aa: amino acid, kDa: kilodalton, Ch: chloroplast, Cy: cytosol, Mt: mitochondria, Nu: nucleus, Pe: periplasm, Ou: outermembrane, Ec: extracellular matrix. a Localization prediction by pSORT (http://www.genscript.com/wolf-psort.html, (accessed on 20 May 2020)). b Localization prediction by TargetP 1.1 Server (http://www.cbs.dtu.dk/services/TargetP/, (accessed on 20 May 2020)). c Chloroplast localization signal confirmed by ChloroP (http://www.cbs.dtu.dk/services/ChloroP/, (accessed on 20 May 2020)).
Table 2. Basic characteristics of BnaGLYII genes identified in Brassica napus L. genomes.
Table 2. Basic characteristics of BnaGLYII genes identified in Brassica napus L. genomes.
Gene SymbolLocus
Identifier
LocationGene Start (bp)Gene Stop (bp)StrandNo. of IntronsCDS Length (bp)PP Length (aa)MW
(kDa)
pILocalization
BnaGLYII01BnaA01g03370DA011597636160085010105635239,338.987.93Cy a; Ch b,c
BnaGLYII02BnaA02g25890DA021896211518965111+12184861668,076.646.62Cy a,b
BnaGLYII03BnaA03g14380DA0366117236613870+798732936,085.298.81Cy a; Ch b,c
BnaGLYII04BnaA03g20230DA03962433396270348102634237,496.849.04Ec a; Ch b,c
BnaGLYII05BnaA03g33050DA031599486015997418+10107435839,988.967.17Cy a; Ch b,c
BnaGLYII06BnaA04g25070DA041818384018186578799333136,397.628.82Ec a; Ch b,c
BnaGLYII07BnaA05g03320DA0518543301860877202868956106,401.82 8.51Ou a; Ch b,c
BnaGLYII08BnaA05g11390DA0563766636378817798132735,883.928.07Pe a; Ch b,c
BnaGLYII09BnaA05g28080DA052005758520059255+677725928,689.476.1Pe a; Cy b
BnaGLYII10BnaA06g00850DA06603532606586+8116738943,530.787.74Cy a; Pea; Nu b
BnaGLYII11BnaA06g22690DA061584823415855367+2334501150126,907.019.02Cy a; Chb,c
BnaGLYII12BnaA08g01070DA08806559808627+778626228,574.496.19Pe a; Nu b
BnaGLYII13BnaA09g28480DA09213519082135494011156652257,465.816.19Cy a,b
BnaGLYII14BnaA09g50050DA093317640433178430+796932335,263.317.16Cy a; Ch b,c
BnaGLYII15BnaAnng27360DAnn31283476312863044208569577,448.795.81Cy a; Nu b
BnaGLYII16BnaC01g04650DC012443496244645710105935339,822.416.96Cy a; Ch b,c
BnaGLYII17BnaC01g28980DC0127137154271399524207669277,157.535.81Cy a; Mt b
BnaGLYII18BnaC02g47740DC0238272653830275+12184861668,049.536.43Cy a,b
BnaGLYII19BnaC03g17440DC0389207768922877+797532535,687.848.85Cy a; Mt b; Ch c
BnaGLYII20BnaC03g24200DC031355774913560223798132735,840.978.85Ec a; Pe a; Ch b, c
BnaGLYII21BnaC03g38140DC032339503623397633+10107735939,993.977.14Cy a; Ch b,c
BnaGLYII22BnaC03g50930DC03353366913534152016268289498,725.648.7Cy a; Ch b,c
BnaGLYII23BnaC03g69760DC035948975859491865787029031,928.748.57Cy a; Ch b,c
BnaGLYII24BnaC04g02920DC04206637920788253157451915212,357.588.24Ou a; Ch b,c
BnaGLYII25BnaC04g48930DC044733053847333344799633236,386.598.7Ec a; Ch b,c
BnaGLYII26BnaC05g20710DC051419556314198830+11156652257,524.856.47Cy a,b
BnaGLYII27BnaC06g06420DC0668950476896947790930333,196.017.21Pe a; Ch b,c
BnaGLYII28BnaC08g44630DC083774724137749209798432835,631.656.83Pe a; Ch b,c
BnaGLYII29BnaCnng30690DCnn2916758829174293+10244881693,535.335.21Cy a,b
BnaGLYII30BnaCnng46950DCnn4637968746381389677725928,653.355.72Pe a; Ch b,c
Abbreviations: CDS: coding DNA sequence, PP: polypeptide length, MW: molecular weight, PI: isoelectric point, bp: base pair, aa: amino acid, kDa: kilodalton, Ch: chloroplast, Cy: cytosol, Mt: mitochondria, Nu: nucleus, Pe: periplasm, Ou: outermembrane, Ec: extracellular matrix. a Localization prediction by pSORT (http://www.genscript.com/wolf-psort.html, (accessed on 20 May 2020)). b Localization prediction by TargetP 1.1 Server (http://www.cbs.dtu.dk/services/TargetP/, (accessed on 20 May 2020)). c Chloroplast localization signal confirmed by ChloroP ((http://www.cbs.dtu.dk/services/ChloroP/, accessed on 20 May 2020)).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yan, G.; Zhang, M.; Guan, W.; Zhang, F.; Dai, W.; Yuan, L.; Gao, G.; Xu, K.; Chen, B.; Li, L.; et al. Genome-Wide Identification and Functional Characterization of Stress Related Glyoxalase Genes in Brassica napus L. Int. J. Mol. Sci. 2023, 24, 2130. https://doi.org/10.3390/ijms24032130

AMA Style

Yan G, Zhang M, Guan W, Zhang F, Dai W, Yuan L, Gao G, Xu K, Chen B, Li L, et al. Genome-Wide Identification and Functional Characterization of Stress Related Glyoxalase Genes in Brassica napus L. International Journal of Molecular Sciences. 2023; 24(3):2130. https://doi.org/10.3390/ijms24032130

Chicago/Turabian Style

Yan, Guixin, Meili Zhang, Wenjie Guan, Fugui Zhang, Wenjun Dai, Lili Yuan, Guizhen Gao, Kun Xu, Biyun Chen, Lixia Li, and et al. 2023. "Genome-Wide Identification and Functional Characterization of Stress Related Glyoxalase Genes in Brassica napus L." International Journal of Molecular Sciences 24, no. 3: 2130. https://doi.org/10.3390/ijms24032130

APA Style

Yan, G., Zhang, M., Guan, W., Zhang, F., Dai, W., Yuan, L., Gao, G., Xu, K., Chen, B., Li, L., & Wu, X. (2023). Genome-Wide Identification and Functional Characterization of Stress Related Glyoxalase Genes in Brassica napus L. International Journal of Molecular Sciences, 24(3), 2130. https://doi.org/10.3390/ijms24032130

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop