Gliflozins Have an Anti-Inflammatory Effect on Renal Proximal Tubular Epithelial Cells in a Diabetic and Inflammatory Microenvironment In Vitro
Abstract
1. Introduction
2. Results
2.1. Measurement of Cytotoxicity and Oxidative Stress
2.2. Effect on the Expression of Pro-Inflammatory Cytokines
3. Discussion
4. Materials and Methods
4.1. Isolation, Culture, and Characterization of Human Renal Proximal Tubular Epithelial Cells
4.2. Stimulations
4.3. Cytotoxicity Assay
4.4. Measurement of Oxidative Stress
4.5. PCR
4.6. Immunoassays
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Faillie, J.-L. Pharmacological aspects of the safety of gliflozins. Pharmacol. Res. 2017, 118, 71–81. [Google Scholar] [CrossRef] [PubMed]
- Gerich, J.E. Role of the kidney in normal glucose homeostasis and in the hyperglycaemia of diabetes mellitus: Therapeutic implications. Diabet. Med. 2010, 27, 136–142. [Google Scholar] [CrossRef] [PubMed]
- Tentolouris, A.; Vlachakis, P.; Tzeravini, E.; Eleftheriadou, I.; Tentolouris, N. SGLT2 Inhibitors: A Review of Their Antidiabetic and Cardioprotective Effects. Int. J. Environ. Res. Public Health 2019, 16, 2965. [Google Scholar] [CrossRef] [PubMed]
- Alicic, R.Z.; Rooney, M.T.; Tuttle, K.R. Diabetic Kidney Disease: Challenges, Progress, and Possibilities. Clin. J. Am. Soc. Nephrol. 2017, 12, 2032–2045. [Google Scholar] [CrossRef] [PubMed]
- Ishibashi, Y.; Matsui, T.; Yamagishi, S. Tofogliflozin, a Highly Selective Inhibitor of SGLT2 Blocks Proinflammatory and Proapoptotic Effects of Glucose Overload on Proximal Tubular Cells Partly by Suppressing Oxidative Stress Generation. Horm. Metab. Res. 2016, 48, 191–195. [Google Scholar] [CrossRef] [PubMed]
- Prandi, F.R.; Barone, L.; Lecis, D.; Belli, M.; Sergi, D.; Milite, M.; Lerakis, S.; Romeo, F.; Barillà, F. Biomolecular Mechanisms of Cardiorenal Protection with Sodium-Glucose Co-Transporter 2 Inhibitors. Biomolecules 2022, 12, 1349. [Google Scholar] [CrossRef]
- de Nicola, L.; Gabbai, F.B.; Liberti, M.E.; Sagliocca, A.; Conte, G.; Minutolo, R. Sodium/glucose cotransporter 2 inhibitors and prevention of diabetic nephropathy: Targeting the renal tubule in diabetes. Am. J. Kidney Dis. 2014, 64, 16–24. [Google Scholar] [CrossRef]
- Matoba, K.; Takeda, Y.; Nagai, Y.; Kawanami, D.; Utsunomiya, K.; Nishimura, R. Unraveling the Role of Inflammation in the Pathogenesis of Diabetic Kidney Disease. Int. J. Mol. Sci. 2019, 20, 3393. [Google Scholar] [CrossRef]
- Winiarska, A.; Knysak, M.; Nabrdalik, K.; Gumprecht, J.; Stompór, T. Inflammation and Oxidative Stress in Diabetic Kidney Disease: The Targets for SGLT2 Inhibitors and GLP-1 Receptor Agonists. Int. J. Mol. Sci. 2021, 22, 10822. [Google Scholar] [CrossRef]
- Ojima, A.; Matsui, T.; Nishino, Y.; Nakamura, N.; Yamagishi, S. Empagliflozin, an Inhibitor of Sodium-Glucose Cotransporter 2 Exerts Anti-Inflammatory and Antifibrotic Effects on Experimental Diabetic Nephropathy Partly by Suppressing AGEs-Receptor Axis. Horm. Metab. Res. 2015, 47, 686–692. [Google Scholar] [CrossRef]
- Cowie, M.R.; Fisher, M. SGLT2 inhibitors: Mechanisms of cardiovascular benefit beyond glycaemic control. Nat. Rev. Cardiol. 2020, 17, 761–772. [Google Scholar] [CrossRef] [PubMed]
- Baer, P.C.; Koch, B.; Freitag, J.; Schubert, R.; Geiger, H. No Cytotoxic and Inflammatory Effects of Empagliflozin and Dapagliflozin on Primary Renal Proximal Tubular Epithelial Cells under Diabetic Conditions In Vitro. Int. J. Mol. Sci. 2020, 21, 391. [Google Scholar] [CrossRef] [PubMed]
- Feijóo-Bandín, S.; Aragón-Herrera, A.; Otero-Santiago, M.; Anido-Varela, L.; Moraña-Fernández, S.; Tarazón, E.; Roselló-Lletí, E.; Portolés, M.; Gualillo, O.; González-Juanatey, J.R.; et al. Role of Sodium-Glucose Co-Transporter 2 Inhibitors in the Regulation of Inflammatory Processes in Animal Models. Int. J. Mol. Sci. 2022, 23, 5634. [Google Scholar] [CrossRef] [PubMed]
- Tahara, A.; Kurosaki, E.; Yokono, M.; Yamajuku, D.; Kihara, R.; Hayashizaki, Y.; Takasu, T.; Imamura, M.; Li, Q.; Tomiyama, H.; et al. Effects of SGLT2 selective inhibitor ipragliflozin on hyperglycemia, hyperlipidemia, hepatic steatosis, oxidative stress, inflammation, and obesity in type 2 diabetic mice. Eur. J. Pharmacol. 2013, 715, 246–255. [Google Scholar] [CrossRef]
- Benetti, E.; Mastrocola, R.; Vitarelli, G.; Cutrin, J.C.; Nigro, D.; Chiazza, F.; Mayoux, E.; Collino, M.; Fantozzi, R. Empagliflozin Protects against Diet-Induced NLRP-3 Inflammasome Activation and Lipid Accumulation. J. Pharmacol. Exp. Ther. 2016, 359, 45–53. [Google Scholar] [CrossRef]
- Lee, T.-M.; Chang, N.-C.; Lin, S.-Z. Dapagliflozin, a selective SGLT2 Inhibitor, attenuated cardiac fibrosis by regulating the macrophage polarization via STAT3 signaling in infarcted rat hearts. Free Radic. Biol. Med. 2017, 104, 298–310. [Google Scholar] [CrossRef]
- Zaibi, N.; Li, P.; Xu, S.-Z. Protective effects of dapagliflozin against oxidative stress-induced cell injury in human proximal tubular cells. PLoS ONE 2021, 16, e0247234. [Google Scholar] [CrossRef]
- Das, N.A.; Carpenter, A.J.; Belenchia, A.; Aroor, A.R.; Noda, M.; Siebenlist, U.; Chandrasekar, B.; DeMarco, V.G. Empagliflozin reduces high glucose-induced oxidative stress and miR-21-dependent TRAF3IP2 induction and RECK suppression, and inhibits human renal proximal tubular epithelial cell migration and epithelial-to-mesenchymal transition. Cell. Signal. 2020, 68, 109506. [Google Scholar] [CrossRef]
- Satou, R.; Cypress, M.W.; Woods, T.C.; Katsurada, A.; Dugas, C.M.; Fonseca, V.A.; Navar, L.G. Blockade of sodium-glucose cotransporter 2 suppresses high glucose-induced angiotensinogen augmentation in renal proximal tubular cells. Am. J. Physiol. Renal Physiol. 2020, 318, F67–F75. [Google Scholar] [CrossRef]
- Xu, J.; Kitada, M.; Ogura, Y.; Liu, H.; Koya, D. Dapagliflozin Restores Impaired Autophagy and Suppresses Inflammation in High Glucose-Treated HK-2 Cells. Cells 2021, 10, 1457. [Google Scholar] [CrossRef]
- Uehara-Watanabe, N.; Okuno-Ozeki, N.; Nakamura, I.; Nakata, T.; Nakai, K.; Yagi-Tomita, A.; Ida, T.; Yamashita, N.; Kamezaki, M.; Kirita, Y.; et al. Proximal tubular epithelia-specific transcriptomics of diabetic mice treated with dapagliflozin. Heliyon 2022, 8, e10615. [Google Scholar] [CrossRef] [PubMed]
- Park, S.-H.; Belcastro, E.; Hasan, H.; Matsushita, K.; Marchandot, B.; Abbas, M.; Toti, F.; Auger, C.; Jesel, L.; Ohlmann, P.; et al. Angiotensin II-induced upregulation of SGLT1 and 2 contributes to human microparticle-stimulated endothelial senescence and dysfunction: Protective effect of gliflozins. Cardiovasc. Diabetol. 2021, 20, 65. [Google Scholar] [CrossRef] [PubMed]
- Mihaljević, V.; Zjalić, M.; Kizivat, T.; Omanović Kolarić, T.; Smolić, M.; Rođak, E.; Čović, M.; Kuna, L.; Smolić, R.; Včev, A.; et al. Molecular Mechanisms Linking Empagliflozin to Renal Protection in the LLC-PK1 Model of Diabetic Nephropathy. Biomedicines 2022, 10, 2983. [Google Scholar] [CrossRef]
- Malínská, H.; Hüttl, M.; Marková, I.; Miklánková, D.; Hojná, S.; Papoušek, F.; Šilhavý, J.; Mlejnek, P.; Zicha, J.; Hrdlička, J.; et al. Beneficial Effects of Empagliflozin Are Mediated by Reduced Renal Inflammation and Oxidative Stress in Spontaneously Hypertensive Rats Expressing Human C-Reactive Protein. Biomedicines 2022, 10, 2066. [Google Scholar] [CrossRef] [PubMed]
- Tousoulis, D.; Economou, E.K.; Oikonomou, E.; Papageorgiou, N.; Siasos, G.; Latsios, G.; Kokkou, E.; Mourouzis, K.; Papaioannou, S.; Deftereos, S.; et al. The Role and Predictive Value of Cytokines in Atherosclerosis and Coronary Artery Disease. Curr. Med. Chem. 2015, 22, 2636–2650. [Google Scholar] [CrossRef] [PubMed]
- Mazzaferro, S.; Cianciolo, G.; de Pascalis, A.; Guglielmo, C.; Urena Torres, P.A.; Bover, J.; Tartaglione, L.; Pasquali, M.; La Manna, G. Bone, inflammation and the bone marrow niche in chronic kidney disease: What do we know? Nephrol. Dial. Transplant 2018, 33, 2092–2100. [Google Scholar] [CrossRef]
- Mittal, M.; Siddiqui, M.R.; Tran, K.; Reddy, S.P.; Malik, A.B. Reactive oxygen species in inflammation and tissue injury. Antioxid. Redox Signal. 2014, 20, 1126–1167. [Google Scholar] [CrossRef]
- Bhasin, E.; Mishra, S.; Pathak, G.; Chauhan, P.S.; Kulshreshtha, A. Cytokine database of stress and metabolic disorders (CdoSM): A connecting link between stress and cardiovascular disease, hypertension, diabetes and obesity. 3 Biotech 2022, 12, 308. [Google Scholar] [CrossRef]
- Andrade-Oliveira, V.; Foresto-Neto, O.; Watanabe, I.K.M.; Zatz, R.; Câmara, N.O.S. Inflammation in Renal Diseases: New and Old Players. Front. Pharmacol. 2019, 10, 1192. [Google Scholar] [CrossRef]
- Stenvinkel, P.; Chertow, G.M.; Devarajan, P.; Levin, A.; Andreoli, S.P.; Bangalore, S.; Warady, B.A. Chronic Inflammation in Chronic Kidney Disease Progression: Role of Nrf2. Kidney Int. Rep. 2021, 6, 1775–1787. [Google Scholar] [CrossRef]
- Bui, T.M.; Wiesolek, H.L.; Sumagin, R. ICAM-1: A master regulator of cellular responses in inflammation, injury resolution, and tumorigenesis. J. Leukoc. Biol. 2020, 108, 787–799. [Google Scholar] [CrossRef] [PubMed]
- Yao, D.; Wang, S.; Wang, M.; Lu, W. Renoprotection of dapagliflozin in human renal proximal tubular cells via the inhibition of the high mobility group box 1-receptor for advanced glycation end products-nuclear factor-κB signaling pathway. Mol. Med. Rep. 2018, 18, 3625–3630. [Google Scholar] [CrossRef] [PubMed]
- Lee, W.-C.; Chau, Y.-Y.; Ng, H.-Y.; Chen, C.-H.; Wang, P.-W.; Liou, C.-W.; Lin, T.-K.; Chen, J.-B. Empagliflozin Protects HK-2 Cells from High Glucose-Mediated Injuries via a Mitochondrial Mechanism. Cells 2019, 8, 1085. [Google Scholar] [CrossRef] [PubMed]
- Panchapakesan, U.; Pegg, K.; Gross, S.; Komala, M.G.; Mudaliar, H.; Forbes, J.; Pollock, C.; Mather, A. Effects of SGLT2 inhibition in human kidney proximal tubular cells--renoprotection in diabetic nephropathy? PLoS ONE 2013, 8, e54442. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Ko, H.Y.; Wang, H.J.; Lee, H.; Yun, M.; Kang, E.S. Effect of Dapagliflozin, a Sodium-glucose Cotransporter-2 Inhibitor, on Gluconeogenesis in Proximal Renal Tubules. Diabetes Obes. Metab. 2019, 22, 373–382. [Google Scholar] [CrossRef] [PubMed]
- Uthman, L.; Homayr, A.; Juni, R.P.; Spin, E.L.; Kerindongo, R.; Boomsma, M.; Hollmann, M.W.; Preckel, B.; Koolwijk, P.; van Hinsbergh, V.W.M.; et al. Empagliflozin and Dapagliflozin Reduce ROS Generation and Restore NO Bioavailability in Tumor Necrosis Factor α-Stimulated Human Coronary Arterial Endothelial Cells. Cell. Physiol. Biochem. 2019, 53, 865–886. [Google Scholar] [CrossRef]
- Heimke, M.; Lenz, F.; Rickert, U.; Lucius, R.; Cossais, F. Anti-Inflammatory Properties of the SGLT2 Inhibitor Empagliflozin in Activated Primary Microglia. Cells 2022, 11, 3107. [Google Scholar] [CrossRef]
- Campeau, M.-A.; Leask, R.L. Empagliflozin mitigates endothelial inflammation and attenuates endoplasmic reticulum stress signaling caused by sustained glycocalyx disruption. Sci. Rep. 2022, 12, 12681. [Google Scholar] [CrossRef]
- Pirklbauer, M. Anti-inflammatory potential of Empagliflozin. Inflammopharmacology 2021, 29, 573–576. [Google Scholar] [CrossRef] [PubMed]
- Pirklbauer, M.; Bernd, M.; Fuchs, L.; Staudinger, P.; Corazza, U.; Leierer, J.; Mayer, G.; Schramek, H. Empagliflozin Inhibits Basal and IL-1β-Mediated MCP-1/CCL2 and Endothelin-1 Expression in Human Proximal Tubular Cells. Int. J. Mol. Sci. 2020, 21, 8189. [Google Scholar] [CrossRef]
- Mancini, S.J.; Boyd, D.; Katwan, O.J.; Strembitska, A.; Almabrouk, T.A.; Kennedy, S.; Palmer, T.M.; Salt, I.P. Canagliflozin inhibits interleukin-1β-stimulated cytokine and chemokine secretion in vascular endothelial cells by AMP-activated protein kinase-dependent and -independent mechanisms. Sci. Rep. 2018, 8, 5276. [Google Scholar] [CrossRef] [PubMed]
- Lee, N.; Heo, Y.J.; Choi, S.-E.; Jeon, J.Y.; Han, S.J.; Kim, D.J.; Kang, Y.; Lee, K.W.; Kim, H.J. Anti-inflammatory Effects of Empagliflozin and Gemigliptin on LPS-Stimulated Macrophage via the IKK/NF-κB, MKK7/JNK, and JAK2/STAT1 Signalling Pathways. J. Immunol. Res. 2021, 2021, 9944880. [Google Scholar] [CrossRef]
- Giannattasio, S.; Citarella, A.; Trocchianesi, S.; Filardi, T.; Morano, S.; Lenzi, A.; Ferretti, E.; Crescioli, C. Cell-Target-Specific Anti-Inflammatory Effect of Empagliflozin: In Vitro Evidence in Human Cardiomyocytes. Front. Mol. Biosci. 2022, 9, 879522. [Google Scholar] [CrossRef]
- Uhlén, M.; Fagerberg, L.; Hallström, B.M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Sivertsson, Å.; Kampf, C.; Sjöstedt, E.; Asplund, A.; et al. Proteomics. Tissue-based map of the human proteome. Science 2015, 347, 1260419. [Google Scholar] [CrossRef] [PubMed]
- Chung, Y.J.; Park, K.C.; Tokar, S.; Eykyn, T.R.; Fuller, W.; Pavlovic, D.; Swietach, P.; Shattock, M.J. Off-target effects of sodium-glucose co-transporter 2 blockers: Empagliflozin does not inhibit Na+/H+ exchanger-1 or lower Na+i in the heart. Cardiovasc. Res. 2021, 117, 2794–2806. [Google Scholar] [CrossRef] [PubMed]
- Kolijn, D.; Pabel, S.; Tian, Y.; Lódi, M.; Herwig, M.; Carrizzo, A.; Zhazykbayeva, S.; Kovács, Á.; Fülöp, G.Á.; Falcão-Pires, I.; et al. Empagliflozin improves endothelial and cardiomyocyte function in human heart failure with preserved ejection fraction via reduced pro-inflammatory-oxidative pathways and protein kinase Gα oxidation. Cardiovasc. Res. 2021, 117, 495–507. [Google Scholar] [CrossRef] [PubMed]
- La Grotta, R.; de Candia, P.; Olivieri, F.; Matacchione, G.; Giuliani, A.; Rippo, M.R.; Tagliabue, E.; Mancino, M.; Rispoli, F.; Ferroni, S.; et al. Anti-inflammatory effect of SGLT-2 inhibitors via uric acid and insulin. Cell. Mol. Life Sci. 2022, 79, 273. [Google Scholar] [CrossRef]
- Zügner, E.; Yang, H.-C.; Kotzbeck, P.; Boulgaropoulos, B.; Sourij, H.; Hagvall, S.; Elmore, C.S.; Esterline, R.; Moosmang, S.; Oscarsson, J.; et al. Differential In Vitro Effects of SGLT2 Inhibitors on Mitochondrial Oxidative Phosphorylation, Glucose Uptake and Cell Metabolism. Int. J. Mol. Sci. 2022, 23, 7966. [Google Scholar] [CrossRef]
- Baer, P.C.; Nockher, W.A.; Haase, W.; Scherberich, J.E. Isolation of proximal and distal tubule cells from human kidney by immunomagnetic separation. Technical note. Kidney Int. 1997, 52, 1321–1331. [Google Scholar] [CrossRef]
- Baer, P.C.; Bereiter-Hahn, J.; Schubert, R.; Geiger, H. Differentiation status of human renal proximal and distal tubular epithelial cells in vitro: Differential expression of characteristic markers. Cells Tissues Organs (Print) 2006, 184, 16–22. [Google Scholar] [CrossRef]
- EMA. Assessment Report-Empagliflozin-EMA/CHMP/137741/2014. Available online: https://www.ema.europa.eu/en/documents/assessment-report/jardiance-epar-public-assessment-report_en.pdf (accessed on 24 November 2022).
- EMA. Assessment Report-Dapagliflozin-EMA/689976/2012. Available online: https://www.ema.europa.eu/en/documents/assessment-report/forxiga-epar-public-assessment-report_en.pdf (accessed on 24 November 2022).
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Forward | Primer Reverse | Product Length (bp) | NCBI Reference Sequence |
---|---|---|---|---|
ICAM-1 | CAACCTCAGCCTCGCTATGG | CGGGGCAGGATGACTTTTGA | 135 | NM_003041.3 |
IL-6 | AAA GAT GGC TGA AAA AGA TGG ATG C | ACA GCT CTG GCT TGT TCC TCA CTA C | 150 | NM_000600.4 |
IL-1β | AGCTGATGGCCCTAAACAGA | AGATTCGTAGCTGGATGCCG | 83 | NM_000576.3 |
MCP-1 | CCCCAGTCACCTGCTGTTAT | AGATCTCCTTGGCCACAATG | 135 | NM_002982.4 |
TNF-α | CGGGACGTGGAGCTGGCCGAGGAG | CACCAGCTGGTTATCTCTCAGCTC | 354 | NM_000594.4 |
β-Actin | ACT GGA ACG GTG AAG GGT GAC | AGA GAA GTG GGG TGG CTT TT | 169 | NM_001101 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Koch, B.; Fuhrmann, D.C.; Schubert, R.; Geiger, H.; Speer, T.; Baer, P.C. Gliflozins Have an Anti-Inflammatory Effect on Renal Proximal Tubular Epithelial Cells in a Diabetic and Inflammatory Microenvironment In Vitro. Int. J. Mol. Sci. 2023, 24, 1811. https://doi.org/10.3390/ijms24031811
Koch B, Fuhrmann DC, Schubert R, Geiger H, Speer T, Baer PC. Gliflozins Have an Anti-Inflammatory Effect on Renal Proximal Tubular Epithelial Cells in a Diabetic and Inflammatory Microenvironment In Vitro. International Journal of Molecular Sciences. 2023; 24(3):1811. https://doi.org/10.3390/ijms24031811
Chicago/Turabian StyleKoch, Benjamin, Dominik C. Fuhrmann, Ralf Schubert, Helmut Geiger, Thimoteus Speer, and Patrick C. Baer. 2023. "Gliflozins Have an Anti-Inflammatory Effect on Renal Proximal Tubular Epithelial Cells in a Diabetic and Inflammatory Microenvironment In Vitro" International Journal of Molecular Sciences 24, no. 3: 1811. https://doi.org/10.3390/ijms24031811
APA StyleKoch, B., Fuhrmann, D. C., Schubert, R., Geiger, H., Speer, T., & Baer, P. C. (2023). Gliflozins Have an Anti-Inflammatory Effect on Renal Proximal Tubular Epithelial Cells in a Diabetic and Inflammatory Microenvironment In Vitro. International Journal of Molecular Sciences, 24(3), 1811. https://doi.org/10.3390/ijms24031811