Antioxidant, Anti-Inflammatory and Pro-Differentiative Effects of Chlorogenic Acid on M03-13 Human Oligodendrocyte-like Cells
Abstract
:1. Introduction
2. Results
2.1. CGA Reduces Superoxide Ions, Mitochondrial ROS and NADPHox Protein Levels
2.2. CGA Inhibits TNFα-Induced Pro-Inflammatory/Proapoptotic Pathways
2.3. CGA Exerts Inhibitory Effects on M03-13 Cell Proliferation, Blocking the Cell Cycle in the G0/G1 Phase
2.4. Effects of CGA on M03-13 Cell Differentiation
3. Discussion
4. Materials and Methods
4.1. Cell Cultures
4.2. Cell Viability Assay
4.3. Western Blotting Analysis
4.4. DHE (Dihydroethidium) and MitoSOXTM Red Analysis
4.5. Cell Cycle Analysis
4.6. CFSE Assay
4.7. Crystal Violet Staining Assay for Cell Morphology Evaluation
4.8. RNA Extraction and RT-PCR
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- La Rosa, G.; Lonardo, M.S.; Cacciapuoti, N.; Muscariello, E.; Guida, B.; Faraonio, R.; Santillo, M.; Damiano, S. Dietary Polyphenols, Microbiome, and Multiple Sclerosis: From Molecular Anti-Inflammatory and Neuroprotective Mechanisms to Clinical Evidence. Int. J. Mol. Sci. 2023, 24, 7247. [Google Scholar] [CrossRef] [PubMed]
- D’Archivio, M.; Filesi, C.; Di Benedetto, R.; Gargiulo, R.; Giovannini, C.; Masella, R. Polyphenols, dietary sources and bioavailability. Ann. Ist. Super. Sanita 2007, 43, 348–361. [Google Scholar] [PubMed]
- Wang, S.; Moustaid-Moussa, N.; Chen, L.; Mo, H.; Shastri, A.; Su, R.; Bapat, P.; Kwun, I.; Shen, C.L. Novel insights of dietary polyphenols and obesity. J. Nutr. Biochem. 2014, 25, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Behl, T.; Rana, T.; Alotaibi, G.H.; Shamsuzzaman, M.; Naqvi, M.; Sehgal, A.; Singh, S.; Sharma, N.; Almoshari, Y.; Abdellatif, A.A.H.; et al. Polyphenols inhibiting MAPK signalling pathway mediated oxidative stress and inflammation in depression. Biomed. Pharmacother. 2022, 146, 112545. [Google Scholar] [CrossRef] [PubMed]
- De Felice, B.; Damiano, S.; Montanino, C.; Del Buono, A.; La Rosa, G.; Guida, B.; Santillo, M. Effect of beta- and alpha-glucans on immune modulating factors expression in enterocyte-like Caco-2 and goblet-like LS 174T cells. Int. J. Biol. Macromol. 2020, 153, 600–607. [Google Scholar] [CrossRef] [PubMed]
- Damiano, S.; Sasso, A.; De Felice, B.; Di Gregorio, I.; La Rosa, G.; Lupoli, G.A.; Belfiore, A.; Mondola, P.; Santillo, M. Quercetin Increases MUC2 and MUC5AC Gene Expression and Secretion in Intestinal Goblet Cell-Like LS174T via PLC/PKCα/ERK1-2 Pathway. Front. Physiol. 2018, 9, 357. [Google Scholar] [CrossRef] [PubMed]
- Haskell, C.F.; Kennedy, D.O.; Milne, A.L.; Wesnes, K.A.; Scholey, A.B. The effects of L-theanine, caffeine and their combination on cognition and mood. Biol. Psychol. 2008, 77, 113–122. [Google Scholar] [CrossRef]
- Haskell, C.F.; Kennedy, D.O.; Wesnes, K.A.; Scholey, A.B. Cognitive and mood improvements of caffeine in habitual consumers and habitual non-consumers of caffeine. Psychopharmacology 2005, 179, 813–825. [Google Scholar] [CrossRef]
- Rees, K.; Allen, D.; Lader, M. The influences of age and caffeine on psychomotor and cognitive function. Psychopharmacology 1999, 145, 181–188. [Google Scholar] [CrossRef]
- Park, T.H.; Lee, H.J.; Kwon, R.W.; Lee, I.H.; Lee, S.J.; Park, J.I.; Choo, E.A.; Lee, J.B. Effects of caffeine ingestion and thermotherapy on blood orexin circulation in humans. Food Sci. Biotechnol. 2022, 31, 1207–1212. [Google Scholar] [CrossRef]
- Abrankó, L.; Clifford, M.N. An Unambiguous Nomenclature for the Acyl-quinic Acids Commonly Known as Chlorogenic Acids. J. Agric. Food Chem. 2017, 65, 3602–3608. [Google Scholar] [CrossRef] [PubMed]
- Tajik, N.; Tajik, M.; Mack, I.; Enck, P. The potential effects of chlorogenic acid, the main phenolic components in coffee, on health: A comprehensive review of the literature. Eur. J. Nutr. 2017, 56, 2215–2244. [Google Scholar] [CrossRef] [PubMed]
- Renouf, M.; Guy, P.A.; Marmet, C.; Fraering, A.L.; Longet, K.; Moulin, J.; Enslen, M.; Barron, D.; Dionisi, F.; Cavin, C.; et al. Measurement of caffeic and ferulic acid equivalents in plasma after coffee consumption: Small intestine and colon are key sites for coffee metabolism. Mol. Nutr. Food Res. 2010, 54, 760–766. [Google Scholar] [CrossRef] [PubMed]
- Grujić-Letić, N.; Rakić, B.; Sefer, E.; Rakić, D.; Nedeljković, I.; Kladar, N.; Božin, B. Determination of 5-caffeoylquinic acid (5-CQA) as one of the major classes of chlorogenic acid in commercial tea and coffee samples. Vojnosanit. Pregl. 2015, 72, 1018–1023. [Google Scholar] [CrossRef]
- Bakalbassis, E.G.; Chatzopoulou, A.; Melissas, V.S.; Tsimidou, M.; Tsolaki, M.; Vafiadis, A. Ab initio and density functional theory studies for the explanation of the antioxidant activity of certain phenolic acids. Lipids 2001, 36, 181–190. [Google Scholar] [CrossRef] [PubMed]
- Leopoldini, M.; Chiodo, S.G.; Russo, N.; Toscano, M. Detailed Investigation of the OH Radical Quenching by Natural Antioxidant Caffeic Acid Studied by Quantum Mechanical Models. J. Chem. Theory Comput. 2011, 7, 4218–4233. [Google Scholar] [CrossRef] [PubMed]
- Nabavi, S.F.; Tejada, S.; Setzer, W.N.; Gortzi, O.; Sureda, A.; Braidy, N.; Daglia, M.; Manayi, A.; Nabavi, S.M. Chlorogenic Acid and Mental Diseases: From Chemistry to Medicine. Curr. Neuropharmacol. 2017, 15, 471–479. [Google Scholar] [CrossRef] [PubMed]
- Moslehi, A.; Komeili-Movahhed, T.; Ahmadian, M.; Ghoddoosi, M.; Heidari, F. Chlorogenic acid attenuates liver apoptosis and inflammation in endoplasmic reticulum stress-induced mice. Iran. J. Basic Med. Sci. 2023, 26, 478–485. [Google Scholar]
- Gao, W.; Wang, C.; Yu, L.; Sheng, T.; Wu, Z.; Wang, X.; Zhang, D.; Lin, Y.; Gong, Y. Chlorogenic Acid Attenuates Dextran Sodium Sulfate-Induced Ulcerative Colitis in Mice through MAPK/ERK/JNK Pathway. Biomed. Res. Int. 2019, 2019, 6769789. [Google Scholar] [CrossRef]
- Solleiro-Villavicencio, H.; Rivas-Arancibia, S. Effect of Chronic Oxidative Stress on Neuroinflammatory Response Mediated by CD4(+)T Cells in Neurodegenerative Diseases. Front. Cell. Neurosci. 2018, 12, 114. [Google Scholar] [CrossRef]
- Bakunina, N.; Pariante, C.M.; Zunszain, P.A. Immune mechanisms linked to depression via oxidative stress and neuroprogression. Immunology 2015, 144, 365–373. [Google Scholar] [CrossRef]
- Damiano, S.; Morano, A.; Ucci, V.; Accetta, R.; Mondola, P.; Paternò, R.; Avvedimento, V.E.; Santillo, M. Dual oxidase 2 generated reactive oxygen species selectively mediate the induction of mucins by epidermal growth factor in enterocytes. Int. J. Biochem. Cell Biol. 2015, 60, 8–18. [Google Scholar] [CrossRef] [PubMed]
- Accetta, R.; Damiano, S.; Morano, A.; Mondola, P.; Paternò, R.; Avvedimento, E.V.; Santillo, M. Reactive Oxygen Species Derived from NOX3 and NOX5 Drive Differentiation of Human Oligodendrocytes. Front. Cell. Neurosci. 2016, 10, 146. [Google Scholar] [CrossRef] [PubMed]
- Secondo, A.; De Mizio, M.; Zirpoli, L.; Santillo, M.; Mondola, P. The Cu-Zn superoxide dismutase (SOD1) inhibits ERK phosphorylation by muscarinic receptor modulation in rat pituitary GH3 cells. Biochem. Biophys. Res. Commun. 2008, 376, 143–147. [Google Scholar] [CrossRef] [PubMed]
- Viggiano, A.; Serù, R.; Damiano, S.; De Luca, B.; Santillo, M.; Mondola, P. Inhibition of long-term potentiation by CuZn superoxide dismutase injection in rat dentate gyrus: Involvement of muscarinic M1 receptor. J. Cell. Physiol. 2012, 227, 3111–3115. [Google Scholar] [CrossRef] [PubMed]
- Rani, V.; Deep, G.; Singh, R.K.; Palle, K.; Yadav, U.C. Oxidative stress and metabolic disorders: Pathogenesis and therapeutic strategies. Life Sci. 2016, 148, 183–193. [Google Scholar] [CrossRef] [PubMed]
- Block, M.L.; Calderón-Garcidueñas, L. Air pollution: Mechanisms of neuroinflammation and CNS disease. Trends Neurosci. 2009, 32, 506–516. [Google Scholar] [CrossRef]
- Sivandzade, F.; Prasad, S.; Bhalerao, A.; Cucullo, L. NRF2 and NF-қB interplay in cerebrovascular and neurodegenerative disorders: Molecular mechanisms and possible therapeutic approaches. Redox Biol. 2019, 21, 101059. [Google Scholar] [CrossRef]
- Simpson, D.S.A.; Oliver, P.L. ROS Generation in Microglia: Understanding Oxidative Stress and Inflammation in Neurodegenerative Disease. Antioxidants 2020, 9, 743. [Google Scholar] [CrossRef]
- Damiano, S.; Sasso, A.; Accetta, R.; Monda, M.; De Luca, B.; Pavone, L.M.; Belfiore, A.; Santillo, M.; Mondola, P. Effect of Mutated Cu, Zn Superoxide Dismutase (SOD1(G93A)) on Modulation of Transductional Pathway Mediated by M1 Muscarinic Receptor in SK-N-BE and NSC-34 Cells. Front. Physiol. 2018, 9, 611. [Google Scholar] [CrossRef]
- Kuhn, S.; Gritti, L.; Crooks, D.; Dombrowski, Y. Oligodendrocytes in Development, Myelin Generation and Beyond. Cells 2019, 8, 1424. [Google Scholar] [CrossRef] [PubMed]
- Damiano, S.; La Rosa, G.; Sozio, C.; Cavaliere, G.; Trinchese, G.; Raia, M.; Paternò, R.; Mollica, M.P.; Avvedimento, V.E.; Santillo, M. 5-Hydroxytryptamine Modulates Maturation and Mitochondria Function of Human Oligodendrocyte Progenitor M03-13 Cells. Int. J. Mol. Sci. 2021, 22, 2621. [Google Scholar] [CrossRef]
- Káradóttir, R.; Attwell, D. Neurotransmitter receptors in the life and death of oligodendrocytes. Neuroscience 2007, 145, 1426–1438. [Google Scholar] [CrossRef]
- Maes, M.; Mihaylova, I.; Kubera, M.; Leunis, J.C.; Geffard, M. IgM-mediated autoimmune responses directed against multiple neoepitopes in depression: New pathways that underpin the inflammatory and neuroprogressive pathophysiology. J. Affect. Disord. 2011, 135, 414–418. [Google Scholar] [CrossRef] [PubMed]
- di Penta, A.; Moreno, B.; Reix, S.; Fernandez-Diez, B.; Villanueva, M.; Errea, O.; Escala, N.; Vandenbroeck, K.; Comella, J.X.; Villoslada, P. Oxidative stress and proinflammatory cytokines contribute to demyelination and axonal damage in a cerebellar culture model of neuroinflammation. PLoS ONE 2013, 8, e54722. [Google Scholar] [CrossRef] [PubMed]
- Damiano, S.; Sasso, A.; De Felice, B.; Terrazzano, G.; Bresciamorra, V.; Carotenuto, A.; Orefice, N.S.; Orefice, G.; Vacca, G.; Belfiore, A.; et al. The IFN-β 1b effect on Cu Zn superoxide dismutase (SOD1) in peripheral mononuclear blood cells of relapsing-remitting multiple sclerosis patients and in neuroblastoma SK-N-BE cells. Brain Res. Bull. 2015, 118, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Couvineau, A.; Voisin, T.; Nicole, P.; Gratio, V.; Abad, C.; Tan, Y.V. Orexins as Novel Therapeutic Targets in Inflammatory and Neurodegenerative Diseases. Front. Endocrinol. 2019, 10, 709. [Google Scholar] [CrossRef]
- Lu, H.; Tian, Z.; Cui, Y.; Liu, Z.; Ma, X. Chlorogenic acid: A comprehensive review of the dietary sources, processing effects, bioavailability, beneficial properties, mechanisms of action, and future directions. Compr. Rev. Food Sci. Food Saf. 2020, 19, 3130–3158. [Google Scholar] [CrossRef]
- Heitman, E.; Ingram, D.K. Cognitive and neuroprotective effects of chlorogenic acid. Nutr. Neurosci. 2017, 20, 32–39. [Google Scholar] [CrossRef]
- Bai, C.; Zhou, X.; Yu, L.; Wu, A.; Yang, L.; Chen, J.; Tang, X.; Zou, W.; Wu, J.; Zhu, L. A Rapid and Sensitive UHPLC-MS/MS Method for Determination of Chlorogenic Acid and Its Application to Distribution and Neuroprotection in Rat Brain. Pharmaceuticals 2023, 16, 178. [Google Scholar] [CrossRef]
- Ito, H.; Sun, X.L.; Watanabe, M.; Okamoto, M.; Hatano, T. Chlorogenic acid and its metabolite m-coumaric acid evoke neurite outgrowth in hippocampal neuronal cells. Biosci. Biotechnol. Biochem. 2008, 72, 885–888. [Google Scholar] [CrossRef]
- Shehat, M.G.; Tigno-Aranjuez, J. Flow Cytometric Measurement Of ROS Production In Macrophages In Response To FcγR Cross-linking. J. Vis. Exp. 2019. [Google Scholar] [CrossRef] [PubMed]
- Breitenbach, M.; Rinnerthaler, M.; Weber, M.; Breitenbach-Koller, H.; Karl, T.; Cullen, P.; Basu, S.; Haskova, D.; Hasek, J. The defense and signaling role of NADPH oxidases in eukaryotic cells: Review. Wien. Med. Wochenschr. 2018, 168, 286–299. [Google Scholar] [CrossRef] [PubMed]
- Akira, S.; Takeda, K.; Kaisho, T. Toll-like receptors: Critical proteins linking innate and acquired immunity. Nat. Immunol. 2001, 2, 675–680. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Akira, S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol. Med. 2007, 13, 460–469. [Google Scholar] [CrossRef] [PubMed]
- Ojha, D.; Mukherjee, H.; Mondal, S.; Jena, A.; Dwivedi, V.P.; Mondal, K.C.; Malhotra, B.; Samanta, A.; Chattopadhyay, D. Anti-inflammatory activity of Odina wodier Roxb, an Indian folk remedy, through inhibition of toll-like receptor 4 signaling pathway. PLoS ONE 2014, 9, e104939. [Google Scholar] [CrossRef]
- Katoh, S.; Mitsui, Y.; Kitani, K.; Suzuki, T. Hyperoxia induces the differentiated neuronal phenotype of PC12 cells by producing reactive oxygen species. Biochem. Biophys. Res. Commun. 1997, 241, 347–351. [Google Scholar] [CrossRef] [PubMed]
- Cavaliere, F.; Benito-Muñoz, M.; Panicker, M.; Matute, C. NMDA modulates oligodendrocyte differentiation of subventricular zone cells through PKC activation. Front. Cell. Neurosci. 2013, 7, 261. [Google Scholar] [CrossRef]
- Zeis, T.; Schaeren-Wiemers, N. Lame ducks or fierce creatures? The role of oligodendrocytes in multiple sclerosis. J. Mol. Neurosci. 2008, 35, 91–100. [Google Scholar] [CrossRef]
- Steudler, J.; Ecott, T.; Ivan, D.C.; Bouillet, E.; Walthert, S.; Berve, K.; Dick, T.P.; Engelhardt, B.; Locatelli, G. Autoimmune neuroinflammation triggers mitochondrial oxidation in oligodendrocytes. Glia 2022, 70, 2045–2061. [Google Scholar] [CrossRef]
- Zhao, Y.; Wang, C.; Yang, T.; Feng, G.; Tan, H.; Piao, X.; Chen, D.; Zhang, Y.; Jiao, W.; Chen, Y.; et al. Chlorogenic Acid Alleviates Chronic Stress-Induced Intestinal Damage by Inhibiting the P38MAPK/NF-κB Pathway. J. Agric. Food Chem. 2023, 71, 9381–9390. [Google Scholar] [CrossRef] [PubMed]
- Cicek, B.; Hacimuftuoglu, A.; Yeni, Y.; Danisman, B.; Ozkaraca, M.; Mokhtare, B.; Kantarci, M.; Spanakis, M.; Nikitovic, D.; Lazopoulos, G.; et al. Chlorogenic Acid Attenuates Doxorubicin-Induced Oxidative Stress and Markers of Apoptosis in Cardiomyocytes via Nrf2/HO-1 and Dityrosine Signaling. J. Pers. Med. 2023, 13, 649. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Deng, S.; Liu, M.; Yang, M.; Li, J.; Liu, T.; Zhang, T.; Zhao, Y.; He, M.; Wu, D.; et al. Novel recombinant protein flagellin A N/C attenuates experimental autoimmune encephalomyelitis by suppressing the ROS/NF-κB/NLRP3 signaling pathway. Front. Pharmacol. 2022, 13, 956402. [Google Scholar] [CrossRef] [PubMed]
- Di Lorenzo, C.; Colombo, F.; Biella, S.; Stockley, C.; Restani, P. Polyphenols and Human Health: The Role of Bioavailability. Nutrients 2021, 13, 273. [Google Scholar] [CrossRef] [PubMed]
- Vesely, O.; Baldovska, S.; Kolesarova, A. Enhancing Bioavailability of Nutraceutically Used Resveratrol and Other Stilbenoids. Nutrients 2021, 13, 3095. [Google Scholar] [CrossRef] [PubMed]
- Kiernan, B.W.; Ffrench-Constant, C. Oligodendrocyte precursor (O-2A progenitor cell) migration; a model system for the study of cell migration in the developing central nervous system. Dev. Suppl. 1993, 119, 219–225. [Google Scholar] [CrossRef]
- Barres, B.A.; Raff, M.C. Proliferation of oligodendrocyte precursor cells depends on electrical activity in axons. Nature 1993, 361, 258–260. [Google Scholar] [CrossRef]
- Baron, W.; de Jonge, J.C.; de Vries, H.; Hoekstra, D. Regulation of oligodendrocyte differentiation: Protein kinase C activation prevents differentiation of O2A progenitor cells toward oligodendrocytes. Glia 1998, 22, 121–129. [Google Scholar] [CrossRef]
- Shen, H.Y.; Huang, N.; Reemmer, J.; Xiao, L. Adenosine Actions on Oligodendroglia and Myelination in Autism Spectrum Disorder. Front. Cell. Neurosci. 2018, 12, 482. [Google Scholar] [CrossRef]
- Klotz, L.; Antel, J.; Kuhlmann, T. Inflammation in multiple sclerosis: Consequences for remyelination and disease progression. Nat. Rev. Neurol. 2023, 19, 305–320. [Google Scholar] [CrossRef]
- Roelofs, B.A.; Ge, S.X.; Studlack, P.E.; Polster, B.M. Low micromolar concentrations of the superoxide probe MitoSOX uncouple neural mitochondria and inhibit complex IV. Free Radic. Biol. Med. 2015, 86, 250–258. [Google Scholar] [CrossRef]
- McCloy, R.A.; Rogers, S.; Caldon, C.E.; Lorca, T.; Castro, A.; Burgess, A. Partial inhibition of Cdk1 in G 2 phase overrides the SAC and decouples mitotic events. Cell Cycle 2014, 13, 1400–1412. [Google Scholar] [CrossRef]
Gene | Forward Primer 5′ → 3′ | Reverse Primer 3′ → 5′ |
---|---|---|
MBP | CGAAGGCCAGAGACCAGGAT | CATGGGTGATCCAGAGCGACT |
PLP | ATGGAATGCTTTCCCTGGCA | GTAAGTGGCAGCAATCATGA |
18S | GCGCTACACTGACTGGCTC | CATCCAATCGGTAGTAGCGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
La Rosa, G.; Sozio, C.; Pipicelli, L.; Raia, M.; Palmiero, A.; Santillo, M.; Damiano, S. Antioxidant, Anti-Inflammatory and Pro-Differentiative Effects of Chlorogenic Acid on M03-13 Human Oligodendrocyte-like Cells. Int. J. Mol. Sci. 2023, 24, 16731. https://doi.org/10.3390/ijms242316731
La Rosa G, Sozio C, Pipicelli L, Raia M, Palmiero A, Santillo M, Damiano S. Antioxidant, Anti-Inflammatory and Pro-Differentiative Effects of Chlorogenic Acid on M03-13 Human Oligodendrocyte-like Cells. International Journal of Molecular Sciences. 2023; 24(23):16731. https://doi.org/10.3390/ijms242316731
Chicago/Turabian StyleLa Rosa, Giuliana, Concetta Sozio, Luca Pipicelli, Maddalena Raia, Anna Palmiero, Mariarosaria Santillo, and Simona Damiano. 2023. "Antioxidant, Anti-Inflammatory and Pro-Differentiative Effects of Chlorogenic Acid on M03-13 Human Oligodendrocyte-like Cells" International Journal of Molecular Sciences 24, no. 23: 16731. https://doi.org/10.3390/ijms242316731
APA StyleLa Rosa, G., Sozio, C., Pipicelli, L., Raia, M., Palmiero, A., Santillo, M., & Damiano, S. (2023). Antioxidant, Anti-Inflammatory and Pro-Differentiative Effects of Chlorogenic Acid on M03-13 Human Oligodendrocyte-like Cells. International Journal of Molecular Sciences, 24(23), 16731. https://doi.org/10.3390/ijms242316731