Sequence Variant Analysis of the APOCII Locus among an Arab Cohort
Abstract
:1. Introduction
2. Results
2.1. APOCII Sequence Variant Identification and Analysis
2.2. Genotype Analysis among the Studied Groups
2.3. Differences in the MAF Distribution among the Studied Groups
2.4. Haplotype Construction and Analysis
2.5. Principal Component Analysis
3. Discussion
4. Materials and Methods
4.1. Sample Description
4.2. Total gDNA Extraction and Analysis
4.3. APOCII Sequencing: Primer Design and Polymerase Chain Reaction (PCR) Amplification
4.4. Sanger Sequencing of the APOCII Target Regions
4.5. Variant Identification and Characterization
4.6. Genetic and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pennacchio, L.A.; Olivier, M.; Hubacek, J.A.; Cohen, J.C.; Cox, D.R.; Fruchart, J.C.; Krauss, R.M.; Rubin, E.M. An apolipoprotein influencing triglycerides in humans and mice revealed by comparative sequencing. Science 2001, 294, 169–173. [Google Scholar] [CrossRef] [PubMed]
- Seda, O.; Sedova, L. New apolipoprotein A-V: Comparative genomics meets metabolism. Physiol. Res. 2003, 52, 141–146. [Google Scholar] [CrossRef] [PubMed]
- Smit, M.; van der Kooij-Meijs, E.; Frants, R.R.; Havekes, L.; Klasen, E.C. Apolipoprotein gene cluster on chromosome 19. Definite localization of the APOC2 gene and the polymorphic Hpa I site associated with type III hyperlipoproteinemia. Hum. Genet. 1988, 78, 90–93. [Google Scholar] [CrossRef] [PubMed]
- Fojo, S.S.; Law, S.W.; Brewer, H.B., Jr.; Sakaguchi, A.Y.; Naylor, S.L. The localization of the gene for apolipoprotein C-II to chromosome 19. Biochem. Biophys. Res. Commun. 1984, 122, 687–693. [Google Scholar] [CrossRef]
- Chen, S.N.; Cilingiroglu, M.; Todd, J.; Lombardi, R.; Willerson, J.T.; Gotto, A.M., Jr.; Ballantyne, C.M.; Marian, A.J. Candidate genetic analysis of plasma high-density lipoprotein-cholesterol and severity of coronary atherosclerosis. BMC Med. Genet. 2009, 10, 111. [Google Scholar] [CrossRef]
- Shen, Y.; Lookene, A.; Nilsson, S.; Olivecrona, G. Functional analyses of human apolipoprotein CII by site-directed mutagenesis: Identification of residues important for activation of lipoprotein lipase. J. Biol. Chem. 2002, 277, 4334–4342. [Google Scholar] [CrossRef]
- Wolska, A.; Dunbar, R.L.; Freeman, L.A.; Ueda, M.; Amar, M.J.; Sviridov, D.O.; Remaley, A.T. Apolipoprotein C-II: New findings related to genetics, biochemistry, and role in triglyceride metabolism. Atherosclerosis 2017, 267, 49–60. [Google Scholar] [CrossRef]
- Ken-Dror, G.; Talmud, P.J.; Humphries, S.E.; Drenos, F. APOE/C1/C4/C2 gene cluster genotypes, haplotypes and lipid levels in prospective coronary heart disease risk among UK healthy men. Mol. Med. 2010, 16, 389–399. [Google Scholar] [CrossRef]
- Johansen, C.T.; Wang, J.; Mclntyre, A.A.; Martins, R.A.; Matthew, R.B.; Matthew, B.L.; Huff, M.W.; Peterfy, M.; Mehrabian, M.; Lusis, A.J.; et al. Excess of rare variants in non-genome-wide association study candidate genes in patients with hypertriglyceridemia. Circ. Cardiovasc. Genet. 2012, 5, 66–72. [Google Scholar] [CrossRef]
- Pirim, D.; Radwan, Z.H.; Wang, X.; Niemsiri, V.; Hokanson, J.E.; Hamman, R.F.; Feingold, E.; Bunker, C.H.; Demirci, F.Y.; Kamboh, M.I. Apolipoprotein E-C1-C4-C2 gene cluster region and inter-individual variation in plasma lipoprotein levels: A comprehensive genetic association study in two ethnic groups. PLoS ONE 2019, 14, e0214060. [Google Scholar] [CrossRef]
- Xenoulis, P.G.; Tate, N.M.; Bishop, M.A.; Steiner, J.M.; Suchodolski, J.S.; Furrow, E. Sequence analysis of the coding regions of the apolipoprotein C2 (APOC2) gene in Miniature Schnauzers with idiopathic hypertriglyceridemia. Vet. J. 2020, 265, 105559. [Google Scholar] [CrossRef] [PubMed]
- Abedi, A.H.; Simsir, I.Y.; Bayram, F.; Onay, H.; Ozgur, S.; Mcintyre, A.; Toth, P.; Hegele, R. Genetic variants associated with severe hypertriglyceridemia: LPL, APOC2, APOA5, GPIHBP1, LMF1, and APOE. Turk. Kardiyol. Dern. Ars. 2023, 51, 10–21. [Google Scholar] [CrossRef] [PubMed]
- Al Rashdan, I.; Al Nesef, Y. Prevalence of overweight, obesity, and metabolic syndrome among adult Kuwaitis: Results from community-based national survey. Angiology 2010, 61, 42–48. [Google Scholar] [CrossRef] [PubMed]
- Alkandari, A.; Longenecker, J.C.; Barengo, N.C.; Alkhatib, A.; Weiderpass, E.; Al-Wotayan, R.; Al Duwairi, Q.; Tuomilehto, J. The prevalence of pre-diabetes and diabetes in the Kuwaiti adult population in 2014. Diabetes Res. Clin. Pract. 2018, 144, 213–223. [Google Scholar] [CrossRef]
- Abdella, N.; Al Arouj, M.; Al Nakhi, A.; Al Assoussi, A.; Moussa, M. Non-insulin-dependent diabetes in Kuwait: Prevalence rates and associated risk factors. Diabetes Res. Clin. Pract. 1998, 42, 187–196. [Google Scholar] [CrossRef]
- Abdella, N.; Al Nakhi, A.; Al Arouj, M.; Assoussi, A.; Moussa, M. Impact of the 1997 American Diabetes Association criteria on classification of glucose intolerance among Kuwaitis below 50 years of age. Acta Diabetol. 1999, 36, 133–140. [Google Scholar] [CrossRef]
- Wang, C.I.; Zhou, X.; Ye, S.; Han, D.; Tan, X.; Zheng, F.; Shi, Q. Combined effects of apoE-CI-CII cluster and LDL-R gene polymorphisms on chromosome 19 and coronary artery disease risk. Int. J. Hyg. Environ. Health 2006, 209, 265–273. [Google Scholar] [CrossRef]
- Coassin, S.; Brandstatter, A.; Kronenberg, F. An optimized procedure for the design and evaluation of Ecotilling assays. BMC Genom. 2008, 9, 510. [Google Scholar] [CrossRef]
- Boes, E.; Coassin, S.; Kollerits, B.; Heid, I.M.; Kronenberg, F. Genetic-epidemiological evidence on genes associated with HDL cholesterol levels: A systematic in-depth review. Exp. Gerontol. 2009, 44, 136–160. [Google Scholar] [CrossRef]
- Al-Bustan, S.A.; Al-Serri, A.; Annice, B.G.; Alnaqeeb, M.; Al-Kandari, W.; Dashti, M. A novel LPL intronic variant: G.18704C>A identified by re-sequencing Kuwaiti Arab samples is associated with high-density lipoprotein, very low-density lipoprotein and triglyceride lipid levels. PLoS ONE 2017, 13, e0192617. [Google Scholar] [CrossRef]
- Hardy, J.; Singleton, A. Genome wide association studies and human disease. N. Engl. J. Med. 2009, 360, 1759–1768. [Google Scholar] [CrossRef]
- Smith, A.J.; Palmen, J.; Putt, W.; Talmud, P.J.; Humphries, S.E.; Drenos, F. Application of statistical and functional methodologies for the investigation of genetic determinants of coronary heart disease biomarkers: Lipoprotein lipase genotype and plasma triglycerides as an exemplar. Hum. Mol. Genet. 2010, 19, 3936–3947. [Google Scholar] [CrossRef] [PubMed]
- Bahri, R.; Esteban, E.; Moral, P.; Hassine, M.; Hamda, K.B.; Chaabani, H. Apolipoprotein gene polymorphisms and plasma levels in healthy Tunisians and patients with coronary artery disease. Lipids Health Dis. 2008, 7, 46. [Google Scholar] [CrossRef] [PubMed]
- Al-Bustan, S.A.; Al-Serri, A.E.; Annice, B.G.; Alnaqeeb, M.A.; Ebrahim, G.A. Re-sequencing of the APOAI promoter region and the genetic association of the -75G>A polymorphism with increased cholesterol and low density lipoprotein levels among a sample of the Kuwaiti population. BMC Med. Genet. 2013, 14, 90. [Google Scholar] [CrossRef] [PubMed]
- Jasim, A.A.; Al-Bustan, S.A.; Al-Kandari, W.; Al-Serri, A.; AlAskar, H. Sequence analysis of APOA5 among the Kuwaiti Population identifies association of rs2072560, rs2266788, and rs662799 with TG and VLDL levels. Front. Genet. 2018, 9, 112. [Google Scholar] [CrossRef]
- Malalla, Z.H.; Al-Serri, A.E.; AlAskar, H.M.; Al-Kandari, W.Y.; Al-Bustan, S.A. Sequence analysis and variant identification at the APOC3 gene locus indicates association of rs5218 with BMI in a sample of Kuwaiti’s. Lipids Health Dis. 2019, 18, 224. [Google Scholar] [CrossRef]
- Jiang, J.; Wang, Y.; Ling, Y.; Kayoumu, A.; Liu, G.; Gao, X. A novel APOC2 gene mutation identified in a Chinese patient with severe hypertriglyceridemia and recurrent pancreatitis. Lipids Health Dis. 2016, 15, 12. [Google Scholar] [CrossRef]
- Hegele, R.A. Improving the monitoring and care of patients with familial hypercholesterolemia. J. Am. Coll. Cardiol. 2016, 67, 1286–1288. [Google Scholar] [CrossRef]
- Surendran, R.P.; Visser, M.E.; Heemelaar, S.; Wang, J.; Peter, J.; Defesche, J.C.; Kuivenhoven, J.A.; Hosseini, M.; Peterfy, M.; Kastelein, J.J.; et al. Mutations in LPL, APOC2, APOA5,GPIHBP1 and LMF1 in patients with severe hypertriglyceridaemia. J. Intern. Med. 2012, 272, 185–196. [Google Scholar] [CrossRef]
- Lemaitre, R.N.; King, I.B.; Kadagambe, E.K.; Wu, J.H.Y.; McKnight, B.; Manichaikul, A.; Guan, W.; Sun, Q.; Chasman, D.I.; Foy, M.; et al. Genetic loci associated with circulating levels of very long—Chain saturated fatty acids. J. Lipid Res. 2015, 56, 176–184. [Google Scholar] [CrossRef]
- Marioni, R.E.; Harris, S.E.; Zhang, Q.; McRae, A.F.; Hagenaars, S.P.; Hill, W.D.; Davies, G.; Ritchie, C.W.; Gale, C.R.; Starr, J.C.; et al. GWAS on family history of Alzheimer’s disease. Transl. Psychiatry 2018, 8, 99. [Google Scholar] [CrossRef] [PubMed]
- Richardson, T.G.; Leyden, G.M.; Wang, Q.; Bell, J.A.; Elsworth, B.; Smith, G.D.; Holmes, M.V. Characterising metabolomic signatures of lipid-modifying therapies through drug target mendelian randomisation. PLoS Biol. 2022, 20, e3001547. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, J.C.G.; Pinto, P.; Leitao, L.P.C.; Vinagre, L.W.M.S.; Monte, N.; Fernandes, M.R.; Khayat, A.S.; de Assumpcao, P.P.; Santos, N.P.C.D.; Santos, S.E.B.D. Influence of APOE locus on poor prognosis of COVID-19. Heliyon 2021, 6, e07379. [Google Scholar] [CrossRef] [PubMed]
- Schwartzentruber, J.; Cooper, S.; Liu, J.Z.; Barrio-Hernandez, I.; Bello, E.; Kumasaka, N.; Young, A.M.H.; Franklin, R.J.M.; Johnson, T.; Estrada, K.; et al. Genome-wide meta-analysis, fine–mapping and integrative prioritization implicate new Alzheimer’s disease risk genes. Nat. Genet. 2021, 53, 393–402. [Google Scholar]
- Koskeridis, F.; Evangelou, E.; Said, S.; Boyle, J.J.; Elliott, P.; Dehghan, A.; Tzoulaki, I. Pleiotropic genetic architecture and novel loci for C-reactive protein levels. Nat. Commun. 2022, 13, 6939. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, T.J.; Theusch, E.; Haldar, T.; Ranatunga, D.K.; Jorgenson, E.; Medina, M.W.; Kvale, M.N.; Kwok, P.; Schaefer, C.; Krauss, R.M.; et al. A large electronic-health-record-based genome-wide study of serum lipids. Nat. Genet. 2018, 50, 401–413. [Google Scholar] [CrossRef]
- Sinnott-Armstrong, N.; Tanigawa, Y.; Amar, D.; Mars, N.; Benner, C.; Aguirre, M.; Venkataraman, G.R.; Wainberg, M.; Ollila, H.M.; Kiiskinen, T.; et al. Genetics of 35 blood and urine biomarkers in the UK Biobank. Nat. Genet. 2021, 53, 185–194. [Google Scholar] [CrossRef]
- Miller, S.A.; Dykes, D.D.; Polesky, H.F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988, 16, 1215. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef]
- McLaren, W.; Pritchard, B.; Rios, D.; Chen, Y.; Flicek, P.; Cunningham, F. Deriving the consequences of geomic variants with the Ensembl API and SNP Effect Predictor. Bioinformatics 2010, 10, 1093. [Google Scholar]
- Raymond, M.; Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Hered. 1995, 86, 248–249. [Google Scholar] [CrossRef]
SNP ID | Location | Genomic Location | Type | Region | |
---|---|---|---|---|---|
1 | rs10425530 | g.162 G>A | 44945438 | SNP | APOC4 3′UTR |
2 | rs371259300 | g.185-184 Del A | 44945460 | INDEL | APOC4 3′UTR |
3 | rs111782345 | g.496 G>A | 44945772 | SNP | 5′UTR |
4 | rs112698600 | g.538 C>T | 44945814 | SNP | 5′UTR |
5 | rs111356234 | g.584 G>A | 44945860 | SNP | 5′UTR |
6 | rs12721063 | g.633 G>A | 44945909 | SNP | 5′UTR |
7 | rs2288912 | g.666 C>G | 44945942 | SNP | 5′UTR |
8 | KUA ApoCII 1 | g.678 G>A | 44945954 | SNP | 5′UTR |
9 | rs71338739 | g.955_959 Del TGTG | 44946192 | INDEL | Intron 1 |
10 | rs12709886 | g.1160 C>T | 44946436 | SNP | Intron 1 |
11 | rs9304644 | g.1500 C>T | 44946776 | SNP | Intron 1 |
12 | rs527585098 | g.1531 G>A | 44946807 | SNP | Intron 1 |
13 | rs12721076 | g.1719 T>C | 44946995 | SNP | Intron 1 |
14 | KUA ApoCII 2 | g.1776 T>C | 44947052 | SNP | Intron 1 |
15 | rs9304645 | g.1795 G>A | 44947071 | SNP | Intron 1 |
16 | rs9304646 | g.1875 T>C | 44947151 | SNP | Intron 1 |
17 | rs113329239 | g.1878-1879 Del AAA | 44947153_44947154 | INDEL | Intron 1 |
18 | rs920667500 | g.1985 T>C | 44947261 | SNP | Intron 1 |
19 | rs534276172 | g.1986 G>T | 44947262 | SNP | Intron 1 |
20 | rs11879392 | g.2244 C>G | 44947520 | SNP | Intron 1 |
21 | rs10419086 | g.2319 A>G | 44947595 | SNP | Intron 1 |
22 | rs4803774 | g.2339 A>G | 44947615 | SNP | Intron 1 |
23 | rs4803775 | g.2395 T>C | 44947671 | SNP | Intron 1 |
24 | rs772477913 | g.2543 T>C | 44947819 | SNP | Intron 1 |
25 | rs151176577 | g.2569 G>A | 44947845 | SNP | Intron 1 |
26 | rs12721058 | g.2598 C>G | 44947874 | SNP | Intron 1 |
27 | KUA ApoCII 3 | g.2620 A>C | 44947896 | SNP | Intron 1 |
28 | rs10420434 | g.2657 G>A | 44947933 | SNP | Intron 1 |
29 | KUA ApoCII 4 | g.2747 C>T | 44948023 | SNP | Intron 1 |
30 | rs555315266 | g.2802 G>A | 44948078 | SNP | Intron 1 |
31 | rs7256684 | g.2909 A>G | 44948185 | SNP | Intron 1 |
32 | rs12721060 | g.3001 T>G | 44948277 | SNP | Intron 1 |
33 | rs1019828365 | g.3082 C>T | 44948358 | SNP | Intron 1 |
34 | rs5120 | g.3087 T>A | 44948363 | SNP | Intron 1 |
35 | rs7257095 | g.3114 C>G | 44948390 | SNP | Intron 1 |
36 | rs10422603 | g.3123 T>G | 44948399 | SNP | Intron 1 |
37 | rs569591876 | g.3147_3148 Del C | 44948423_44948424 | INDEL | Intron 1 |
38 | rs373211202 | g.3173 C>A | 44948449 | SNP | Intron 1 |
39 | rs112265403 | g.3662 C>T | 44948938 | SNP | Intron 3 |
40 | rs10622462 | g.3736_3737 Ins CCT | 44949012_44949013 | INDEL | Intron 3 |
41 | rs3745152 | g.3738 G>T | 44949014 | SNP | Intron 3 |
42 | rs4803776 | g.3802 T>C | 44949078 | SNP | Intron 3 |
43 | rs180809422 | g.3822 A>C | 44949098 | SNP | Intron 3 |
44 | rs150448996 | g.4162 Ins -/T | 44949437_44949438 | INDEL | 3′UTR |
45 | KUA ApoCII 5 | g.4190 G>C | 44949466 | SNP | 3′UTR |
46 | rs1130742 | g.4279 C>T | 44949555 | SNP | 3′UTR |
47 | rs10421404 | g.4312 G>A | 44949588 | SNP | downstream |
48 | rs78403558 | g.4325_4239 Del C(T)4 | 44949602_44949604 | INDEL | downstream |
49 | rs7257468 | g.4611 C>T | 44949887 | SNP | downstream |
50 | rs7258345 | g.4618 T>G | 44949894 | SNP | downstream |
51 | rs7257476 | g.4632 C>T | 44949908 | SNP | downstream |
52 | rs12709889 | g.4706 G>A | 44949982 | SNP | downstream |
Start | End | Size (bp) | Gene Region | Total | INDELs | SNPs | TRS | TRSV | |
---|---|---|---|---|---|---|---|---|---|
1 | 1 | 25 | 5 | APOCIV 3′UTR | 2 | 1 | 1 | 1 | 0 |
2 | 25 | 770 | 745 | 5′UTR | 6 | 0 | 6 | 5 | 1 |
3 | 771 | 799 | 29 | Exon 1 | 0 | 0 | 0 | 0 | 0 |
4 | 500 | 3202 | 2403 | Intron 1 | 30 | 3 | 27 | 18 | 9 |
5 | 3203 | 3247 | 45 | Exon 2 | 0 | 0 | 0 | 0 | 0 |
6 | 3248 | 3424 | 177 | Intron 2 | 0 | 0 | 0 | 0 | 0 |
7 | 3425 | 3584 | 160 | Exon 3 | 0 | 0 | 0 | 0 | 0 |
8 | 3585 | 3882 | 298 | Intron 3 | 5 | 1 | 4 | 2 | 2 |
9 | 3883 | 3973 | 91 | Exon 4 | 0 | 0 | 0 | 0 | 0 |
10 | 3974 | 4980 | 1007 | 3′UTR Downstream | 3 6 | 1 1 | 2 5 | 1 4 | 1 1 |
1 | 4980 | 4980 | All | 52 | 7 | 45 | 31 | 14 |
Variant ID | Gene Position | Region | MAF | Sample Group |
---|---|---|---|---|
KUA ApoCII1 | g.678 G>A | 5′UTR | 0.0025 | Non-Arab Diabetic |
KUA ApoCII2 | g.1776 T>C | Intron 1 | 0.0025 | Arab Diabetic |
KUA ApoCII3 | g.2620 A>C | Intron 1 | 0.0025 | HTG |
KUA ApoCII4 | g.2747 C>T | Intron 1 | 0.0025 | HTG |
KUA ApoCII5 | g.4190 G>C | 3′UTR | 0.0025 | Arab Controls |
SNP1 | SNP2 | r2 > 0.80 | Distance in bp |
---|---|---|---|
rs9304644 | rs7256684 | 0.95 | 1409 |
rs9304644 | rs9304646 | 0.94 | 375 |
rs9304646 | rs7256684 | 0.93 | 1034 |
rs7256684 | rs10622462 Ins. | 0.93 | 827 |
rs9304644 | rs10622462 Ins. | 0.90 | 2236 |
rs9304646 | rs10622462 Ins. | 0.86 | 1861 |
rs4803774 | rs7256684 | 0.83 | 570 |
rs4803775 | rs5120 | 0.83 | 692 |
rs9304645 | rs10422603 | 0.81 | 1328 |
rs9304644 | rs4803774 | 0.81 | 839 |
Block | Haplotype | Frequency (n = 100) | T2DM-nonAP, Control Frequencies | p Value |
---|---|---|---|---|
Block 1 | TCAATGAT | 0.424 | 0.409, 0.439 | 0.6682 |
CCAGCGGA | 0.279 | 0.200, 0.358 | 0.0125 | |
CGAGCGGA | 0.14 | 0.200, 0.080 | 0.0145 | |
TCGACAAA | 0.075 | 0.070, 0.080 | 0.7873 | |
CCAATGGA | 0.021 | 0.040, 0.002 | 0.0592 | |
TCAGCGAT | 0.015 | 0.030, 0.000 | 0.0864 | |
TCAGCGGA | 0.011 | 0.000, 0.022 | 0.1428 | |
CCAATGAT | 0.01 | 0.020, 0.000 | 0.1573 | |
Block 2 | GT | 0.72 | 0.740, 0.700 | 0.5287 |
TC | 0.22 | 0.180, 0.260 | 0.1721 | |
GC | 0.06 | 0.080, 0.040 | 0.2337 |
Variant ID | Region | Global MAF | SNP Change | Population MAF | Predicted Consequence | Reference |
---|---|---|---|---|---|---|
rs5120 | Intron 1 | 0.67 | T>A | African Black 0.185 | TC | [10] |
rs10422888 | 3′flanking | 0.132 | A>G | African Black 0.078 | LDL-C & TC | [10] |
rs12709885 | C4-3′/C2-5′ | <0.01 | A>T | African Black 0.018 | Apo B, apoA1 | [10] |
rs2288912 | C4-3′/C2-5′ | T = 0.66 | C>A, G, T | African Black 0.258 | All LDL related traits | [10] |
rs75463753 | C2-Intron1 | A = 0.02 | G>A | African Black 0.108 | LDL-C & TC | [10] |
APOC2 p. Val40Ter | 118del | NA | European <0.01 | Severe HTG | [4,17,29] | |
rs111628497 | NA | G>A, C | European <0.01 | HTG | [17] | |
rs5127 | 3′UTR | 0.000 | G>T | European <0.01 | High HDL-C & apoA1, lower risk of CHD | [8] |
Sex | Males | Females | Total |
---|---|---|---|
Number | 94 | 106 | 200 |
Age (years) (Mean ± Std) | 46.68 ± 14.5 | 48.10 ± 12.93 | 47.43 ± 13.44 |
BMI n (%) | |||
˂25 | 24 (25.53) | 17 (16.04) | 41 (20.5) |
25–30 | 39 (41.49) | 39 (36.79) | 78 (39.0) |
>30 | 31 (32.98) | 50 (47.17) | 81 (40.5) |
Primer Name | Forward Primer | Reverse Primer | Size (bp) | AT (°C) | |
---|---|---|---|---|---|
1 | APOCII5′UTR | TTGTCTGTGGGGACAAGGAC | ACGGGCACAGAGAGGATTTA | 766 | 63 |
2 | APOCIIF1 | GGGGTTGTGGCTGTGGAG | GCTGGGATTACAGGCATGAG | 592 | 53 |
3 | APOCIIF2 | CCACCACACTCCACAAATCA | ACCGCAACCTCTGTCTTCC | 746 | 63 |
4 | APOCIIF3 | CGGATCACTTGATGTCAGGA | CACTGAGCCCAGCCTAGAAG | 601 | 53 |
5 | APOCIIF4 | GGGCAGAGCCCTAAGGTAAC | AGCTGGAATCACAAGCACCT | 602 | 53 |
6 | APOCIIF5 | AGGCAGGCAAATCACTTGAG | TCCAACATTCTGTGATTCTACTCC | 596 | 63 |
7 | APOCIIF6 | AGGCAGGAGAATTGCTTGAA | GGCTAGGCATCTCATCTTGC | 608 | 53 |
8 | APOCIIF7 | CCAGCAAGATGAGATGCCTA | GGGAGCTCAGTCTGAACCTG | 602 | 53 |
9 | APOCIIF8 | CCCTCCTCCCTCTAACCATC | CACTGCTTTATTCCCATGGAC | 413 | 53 |
10 | APOCII3′UTR | GGCACTGCTTTTCTGAGGAC | CTCCGGTAGGCCATAAATGA | 845 | 63 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Bustan, S.A.; Alrashid, M.H.; Al-Serri, A.E.; Annice, B.G.; Bahbahani, H.M. Sequence Variant Analysis of the APOCII Locus among an Arab Cohort. Int. J. Mol. Sci. 2023, 24, 16293. https://doi.org/10.3390/ijms242216293
Al-Bustan SA, Alrashid MH, Al-Serri AE, Annice BG, Bahbahani HM. Sequence Variant Analysis of the APOCII Locus among an Arab Cohort. International Journal of Molecular Sciences. 2023; 24(22):16293. https://doi.org/10.3390/ijms242216293
Chicago/Turabian StyleAl-Bustan, Suzanne A., Maryam H. Alrashid, Ahmad E. Al-Serri, Babitha G. Annice, and Hussain M. Bahbahani. 2023. "Sequence Variant Analysis of the APOCII Locus among an Arab Cohort" International Journal of Molecular Sciences 24, no. 22: 16293. https://doi.org/10.3390/ijms242216293
APA StyleAl-Bustan, S. A., Alrashid, M. H., Al-Serri, A. E., Annice, B. G., & Bahbahani, H. M. (2023). Sequence Variant Analysis of the APOCII Locus among an Arab Cohort. International Journal of Molecular Sciences, 24(22), 16293. https://doi.org/10.3390/ijms242216293