Next Article in Journal
Pomegranate Seed Oil as a Source of Conjugated Linolenic Acid (CLnA) Has No Effect on Atherosclerosis Development but Improves Lipid Profile and Affects the Expression of Lipid Metabolism Genes in apoE/LDLR−/− Mice
Next Article in Special Issue
Zebrafish as a Model of Cardiac Pathology and Toxicity: Spotlight on Uremic Toxins
Previous Article in Journal
Upregulation of Peridinin-Chlorophyll A-Binding Protein in a Toxic Strain of Prorocentrum hoffmannianum under Normal and Phosphate-Depleted Conditions
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of the Time Period during Which BMP Signaling Regulates Proliferation of Neural Progenitor Cells in Zebrafish

1
Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 33302, Taiwan
2
Department of Biological Science, College of Science, Engineering & Technology, Utah Tech University, St. George, UT 84770, USA
3
Neuroscience Research Center, Chang Gung Memorial Hospital at Linkou Medical Center, Taoyuan 333423, Taiwan
4
Department of Neurology, Chang Gung Memorial Hospital at Linkou Medical Center, Taoyuan 333423, Taiwan
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(2), 1733; https://doi.org/10.3390/ijms24021733
Submission received: 16 November 2022 / Revised: 6 January 2023 / Accepted: 13 January 2023 / Published: 15 January 2023
(This article belongs to the Special Issue Zebrafish Models for Human Disease Studies)

Abstract

:
Bone morphogenetic protein (BMP) signaling regulates neural induction, neuronal specification, and neuronal differentiation. However, the role of BMP signaling in neural progenitors remains unclear. This is because interruption of BMP signaling before or during neural induction causes severe effects on subsequent neural developmental processes. To examine the role of BMP signaling in the development of neural progenitors in zebrafish, we bypassed the effect of BMP signaling on neural induction and suppressed BMP signaling at different time points during gastrulation using a temporally controlled transgenic line carrying a dominant-negative form of Bmp receptor type 1aa and a chemical inhibitor of BMP signaling, DMH1. Inhibiting BMP signaling from 8 hpf could bypass BMP regulation on neural induction, induce the number of proliferating neural progenitors, and reduce the number of neuronal precursors. Inhibiting BMP signaling upregulates the expression of the Notch downstream gene hairy/E(spl)-related 2 (her2). Inhibiting Notch signaling or knocking down the Her2 function reduced neural progenitor proliferation, whereas inactivating BMP signaling in Notch-Her2 deficient background restored the number of proliferating neural progenitors. These results reveal the time window for the proliferation of neural progenitors during zebrafish development and a fine balance between BMP and Notch signaling in regulating the proliferation of neural progenitor cells.

1. Introduction

Neural progenitor cells are proliferative and multipotent cells that can differentiate into various cell types, such as neurons, oligodendrocytes, and astrocytes of the central nervous system [1]. These cells are generated from the neuroectoderm during early embryonic development. Studies in Xenopus and zebrafish demonstrated that during early gastrulation, secreted neural inducers, such as Noggin, Follistatin, and Chordin, inhibit bone morphogenetic protein (BMP) signaling at the dorsal side of the animal cap, where they repress the epidermal fate and induce the neural fate of the ectoderm. In contrast, the ventral ectoderm expresses a high level of BMP and differentiates into the epidermis. This process, termed neural induction, specifies the neuroectoderm within the ectoderm and is conserved in vertebrates. However, other signals, such as fibroblast growth factor (FGF) and Wnt, have also been demonstrated as key modulators in neural induction (reviewed in [2]). These signaling pathways and their downstream transcription factors not only govern neural induction, but also regulate the competence and specification of neural progenitor cells in the neuroectoderm, as well as the formation and expansion of neural plates (reviewed in [3,4]). Therefore, spatial and temporal regulation studies, such as transplantation, tissue-specific promoter-driven gene expression, and electroporation, have been performed in animal models to clarify the role of these signaling pathways in neural induction and the development of neural progenitor cells.
BMPs belong to the transforming growth factor-beta (TGF-β) superfamily, which mediates a diverse array of cellular processes, including proliferation, differentiation, and apoptosis [5]. BMPs bind to type 1 and type 2 serine/threonine transmembrane receptors (BMPR1 and BMPR2, respectively) in recipient cells. Upon binding, BMP receptors phosphorylate carboxy-terminally located serine residues in downstream transcription factors SMAD1/5/9. Upon phosphorylation, these transcription factors form complexes with the common mediator SMAD protein SMAD4, and the complex subsequently accumulates in the nucleus to activate the transcription of downstream genes, such as inhibitors of differentiation (Id) and Msx [6,7]. BMPs also initiate SMAD-independent signaling pathways, such as the MAPK, PI3K-AKT, protein kinase C, and Rho-GTPase signaling pathways (reviewed in [8]). BMP signaling exhibits pleiotropic effects on the developing nervous system and adult homeostasis. The BMP signaling gradient establishes the dorsoventral axis and negatively regulates neural induction to suppress neuroectoderm formation ([9,10], reviewed in [11]). Once the neural tube closes, BMP functions as a morphogen to regulate neural tube patterning and specify the neuronal subtypes in the dorsal neural tube (reviewed in [12]). Furthermore, BMP signaling regulates neurogenesis and gliogenesis. BMP2 and BMP4 have been shown to promote astrocyte formation by suppressing oligodendrocyte formation. [13,14]. BMP2 restricts proliferation and induces neuronal differentiation of neuroepithelial cells [15], whereas BMP4 overexpression stimulates neuronal differentiation [16]. In contrast, BMP2, 4, or 7 suppress the generation of olfactory receptor neurons [17] and reduce neurogenesis in cultured mouse fetal telencephalic neuroepithelial cells [18,19]. However, the role of BMP signaling in regulating the development of neural progenitor cells has mostly been demonstrated in in vitro studies and requires further confirmation in vivo.
In this study, we bypassed the effect of BMP signaling on the regulation of embryonic development before early gastrulation, including dorsoventral patterning, mesoderm formation, and neural induction, and examined the specific role of BMP signaling in the development of neural progenitors. We inhibited BMP signaling at distinct time points during zebrafish gastrulation using a transgenic fish line that carries the dominant-negative form of the Bmp type 1 receptor (DN-BmpR1aa) and confirmed the results using a chemical inhibitor of BMP signaling, dorsomorphin homologue 1 (DMH1). We defined the time point for the effect of BMP signaling during neural progenitor development and discovered that Notch-Her2 signaling underlies this regulation.

2. Results

2.1. Bmpr1aa Is Expressed in the Developing Nervous system during Gastrulation and Early Segmentation

In zebrafish, neural induction occurs during gastrulation (from 5.25 h post-fertilization (hpf) to 10 hpf). During this period, the neural progenitors are specified from the ectoderm [20] and then at the end of gastrulation (10 hpf), the neuronal precursor cells are formed within neural progenitors by activating the expression of proneural genes [21]. Neural progenitors give rise to neuronal precursors that generate a variety of neurons in the nervous system during segmentation. We first analyzed the expression patterns of one of the Bmp type 1 receptors, bmpr1aa, during the gastrulation and early segmentation stages. The results of whole-mount in situ hybridization demonstrated that bmpr1aa was ubiquitously expressed in the entire embryo at 5.3 hpf and 6 hpf, and from 8 hpf onward, was expressed in the presumptive neuroectoderm and developing mesoderm (Figure 1A). At the end of gastrulation (10 hpf), strong bmpr1aa expression was detected in the developing forebrain, midbrain, trigeminal primordium, and the sensory and motor neurons of the spinal cord (Figure 1B). During the early segmentation stage (11 hpf), bmpr1aa was strongly expressed in the developing nervous system (Figure 1). This result suggested that bmpr1aa participates in the formation of neural progenitor cells after neural induction.

2.2. Temporally Inhibiting BMP Signaling by Dominant-Negative Bmpr1aa and DMH1

BMP signaling negatively regulates neural induction [22], and the disruption of BMP signaling at this stage disrupts neural developmental progress, thus hindering the analysis of BMP signaling in neural progenitor cells. In order to temporally inhibit BMP signaling, we adapted the inducible transgenic zebrafish line Tg (hsp70l: dn-bmpr1aa-eGFP) [23] which carries a dominant-negative form of Bmpr1aa (DN-Bmpr1aa) driven by a heat-shock promoter, thus facilitating temporal inactivation of BMP signaling. We first evaluated the effectiveness of this transgenic line in alerting BMP signaling by analyzing the expression of eve1, which is a downstream target of BMP signaling and is decreased in bmp mutants [24,25]. Heat-shock activation of DN-Bmpr1aa at 5.3 hpf inhibited BMP signaling, as observed by the downregulation of eve1 expression at 6 hpf and diminished eve1 expression at 7 hpf (Figure 2A,C). These results demonstrated that overexpressing DN-Bmpr1aa inhibits BMP-Bmpr1aa signaling 0.7 h after induction of heat-shock.
The BMP type 1 receptors initiate both Smad-dependent and Smad-independent signaling cascades to control various cellular processes [8,26]. To further confirm the regulation of dominant-negative Bmpr1aa, we used the chemical inhibitor dorsomorphin homologue 1 (DMH1), which specifically blocks Smad-dependent signaling [27]. We tested different concentrations of DMH1 at different time points during embryonic development and discovered that treatment with 0.5 μM DMH1 sufficiently inhibited BMP-Smad signaling demonstrated by the reduced eve1 expression (Figure 2B,D). Treatment with 0.5 μM DMH1 reduced eve1 expression, which was identical to the effect of DN-Bmpr1aa overexpression at the same time point. Hereafter, we used 0.5 μM DMH1 in the following experiments.
Id3 and Msx1b (previously named Msxb) are direct downstream targets of the BMP-Smad signaling pathway. Upon binding of BMPs, BMP receptors phosphorylate Smad1/5/9 and the phosphorylated Smad1/5/9 and Smad4 complex directly bind to the 5ʹ regulatory elements of id3 and msx1b and induce their expression [28,29,30]. To further confirm that dominant-negative Bmpr1aa and DMH1 were sufficient to inhibit BMP-Smad signaling, we examined the effect of BMP inactivation on the expression of id3 and msx1b. The result demonstrated that heat-shock activation of DN-Bmpr1aa or DMH1 treatment at 5.3 hpf inhibited the expression of id3 and msxb at 6, 7, and 9 hpf, confirming that DN-Bmpr1aa and DMH1 were sufficient to inhibit BMP-Smad signaling (Figure S1).

2.3. Inhibiting BMP Signaling from 8 hpf Bypasses the Effects of BMP Signaling on Dorsoventral Patterning and Neural Induction

Next, we identified the time point at which BMP signaling was inhibited, without affecting neural induction. Inactivation of BMP signaling during neural induction results in a reduced surface ectoderm and an expansion of the neuroectoderm [10]. The transgenic line Tg (hsp70l: dn-bmpr1aa-eGFP) and DMH1 were used to inhibit BMP-BmpR1aa-Smad signaling. We performed heat-shock induction or treatment with DMH1 at 5.3, 8, or 9 hpf for one hour, and harvested the embryos at 10 hpf for examination. In situ hybridization analysis for the expression pattern of neuroectoderm markers sox2 and sox3 demonstrated that inactivating BMP-Bmpr1 signaling at 5.3 hpf caused the expansion of sox2 and sox3 expression at 10 hpf (Figure 3A,B, arrowheads). In contrast, blocking BMP-BmpR1 signaling at 8 or 9 hpf did not alter the expression patterns of sox2 and sox3 at 10 hpf (Figure 3A,B). This result demonstrates that inhibiting BMP signaling after 8 hpf did not affect neural induction.
Inhibiting BMP signaling before early gastrulation induces the expansion of the neuroectoderm and loss of the epidermal ectoderm ([24], reviewed in [31,32]). We performed heat-shock activation of DN-Bmpr1aa or DMH1 treatment at 4 hpf, examined the expression of the surface ectoderm marker tp63 at 50% epiboly (5.3 hpf), and discovered that inhibiting BMP signaling at this time point was sufficient to inhibit the formation of surface ectoderm, as evidenced by reduced tp63 expression (Figure S2). Next, we inhibited BMP signaling at 8 or 9 hpf and found that the expression of tp63 was not altered at 10 hpf (Figure 4). Taken together, these data indicated that inhibiting BMP-Bmpr1aa-Smad signaling from 8 hpf bypassed the effect of BMP signaling on dorsoventral patterning and neural induction in zebrafish embryos.

2.4. BMP Signaling Is Essential for Suppressing Neural Progenitor Proliferation at 8 hpf to 10 hpf

Inactivating BMP signaling after 8 hpf did not affect the gross expression pattern of sox2 and sox3. However, we noticed that the sox2-expressing areas were slightly increased (although not statistically significant) by BMP inactivation (Figure 3). This might be because inactivating BMP alters the development of neural progenitors at 8–10 hpf. At this stage, neural progenitors increase in number by proliferation. Accordingly, we inactivated BMP-BmpR1 signaling at 8–10 hpf and examined neural progenitor cell proliferation. In addition to measuring the sox2-expressing areas (Figure 3C), we conducted quantitative reverse transcriptase PCR (qRT-PCR) to investigate the altered sox2-expression level after BMP signaling inactivation. The results demonstrated that inactivation of BMP-Bmpr1aa-Smad signaling upregulated sox2 expression significantly (Figure 5). In addition, we counterstained sox2 with the proliferating marker, phospohryl histone 3 (pH3), and discovered that pH3-positive neural progenitors were increased in BMP-signaling-inactivated embryos (Figure 5). This result demonstrated that BMP signaling is essential for suppressing neural progenitor proliferation. We also examined the apoptosis of neural progenitors in BMP-signal-inactivated embryos by counterstaining sox2 with the apoptotic marker cleaved caspase 3 and found no significant alteration in the number of apoptotic cells caused by inactivation of BMP signaling (Figure S3). These results demonstrate that inhibiting BMP signaling induces the proliferation of neural progenitors without affecting cell apoptosis.

2.5. BMP Signaling Is Essential for Neuronal Precursor Development between 8 hpf to 10 hpf

Neuronal precursor cells differentiate from neural progenitors from 10 hpf, as indicated by the onset of expression of many proneural genes, such as neurog1, during zebrafish development [21]. Accordingly, we examined the effect of inactivation of BMP-Bmpr1aa-Smad signaling on the formation of neural progenitors by examining neurog1 expression. Inhibition of BMP-Bmpr1aa-Smad signaling at 8 to 10 hpf reduced the number of neurog1-positive cells (Figure 6), indicating that BMP signaling is essential for the formation of neuronal precursors. These results suggest that BMP-Bmpr1aa-Smad signaling is required for repressing neural progenitor proliferation and is essential for neuronal differentiation after neural induction.

2.6. Suppression of Notch Signaling Abolished the Phenotype Caused by BMP-Signaling Inactivation

BMP signaling interacts with other molecular signaling pathways to control diverse developmental events [33]. Notch signaling is a critical regulator of neural progenitor proliferation and the suppression of neuronal differentiation [34]. A previous study showed that BMP signaling plays a role opposite to Notch signaling in governing neuronal differentiation in the olfactory bulb of developing chick embryos [35]. To evaluate whether Notch signaling plays a role in BMP-signaling-mediated neural progenitor proliferation and neuronal differentiation, we inhibited BMP signaling and concomitantly inhibited Notch signaling activity using a chemical inhibitor, N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT), from 8 hpf to 10 hpf. These embryos were analyzed for sox2 expression using in situ hybridization and qRT-PCR. DAPT treatment abolished the upregulation of sox2 expression caused by BMP signal inhibition (Figure 7). In addition, blocking Notch signaling reduced neural progenitor proliferation (Figure 7) and abolished the upregulation of proliferation of neural progenitors caused by inactivation of BMP-Bmpr1-Smad signaling (Figure 5). This result suggests an interaction between BMP and Notch signaling in regulating neural progenitor proliferation after neural induction.

2.7. BMP and Notch-Her2 Signaling Regulate the Proliferation of Neural Progenitor Cells

Our results demonstrated that inactivating BMP signaling promoted the proliferation of neural progenitors, whereas inactivation of Notch signaling reduced the proliferation of neural progenitors. Although inactivation of Notch signaling could abolish the effect of inactivation of BMP signaling on neural progenitors, the action of these two signaling pathways could be interactive or parallel. BMP signaling has been reported to antagonize Notch signaling by inhibiting the expression of downstream transcription factors to balance the proliferation and differentiation of neural progenitor cells [35,36,37]. To analyze the interaction between BMP and Notch signaling in the proliferation of neural progenitors, we examined the function of hairy/E(spl)-related 2 (Her2), which is a homologue of mammalian Hes5 and is a downstream target of Notch signaling. It has been shown to promote neural progenitor proliferation and is essential for inhibiting neuronal differentiation [38,39] in BMP-signaling-inactivated embryos. We inactivated BMP-Bmpr1-Smad signaling at 8 to10 hpf by activating DN-BmpR1aa or treatment with DMH1, followed by qRT-PCR analysis for her2 expression at 10 hpf. Expression of her2 was upregulated by inactivation of BMP signaling (Figure 8A,D), indicating that BMP-BmpR1-Smad signaling is required for suppressing her2 expression. Knocking down Her2 function by injecting her2 morpholino at the one-cell stage reduced the proliferation of neural progenitors, as described by Cheng et al. (Figure 8B,F), [38], whereas inactivation of BMP signaling in Her2 knockdown embryos recovered the number of proliferating neural progenitors (Figure 8). Taken together, although inactivation of BMP signaling induced her2 expression, in embryos lacking Her2 expression, inactivation of BMP signaling could still upregulate the proliferation of neural progenitors. This result indicated that BMP and Notch signaling regulate the proliferation of neural progenitors in both a parallel and an interactive manner, and a fine balance between BMP and Notch signaling pathways is essential for the proper proliferation of neural progenitors.

3. Discussion

Precisely controlled proliferation and differentiation of neural stem/progenitor cells ensures the proper number and type of neurons to be generated in the brain. Impaired development of neural stem/progenitor cells can cause defective brain size, neurological disorders, and brain tumors. Understanding the proliferation and differentiation of neural stem/progenitor cells could provide a potential therapeutic approach for stem-cell-based therapies. The coordination of many molecular signaling pathways with precise spatial and temporal control is essential for the development of neural stem/progenitor cells. However, the time window of a given molecular signaling pathway in regulating this event has not been fully defined. In the present study, we discovered a critical time window for BMP signaling in the regulation of neural progenitor proliferation in zebrafish. Inactivation of BMP-Bmpr1a-Smad signaling from mid-gastrulation (8 hpf) to end-gastrulation (10 hpf) promotes the proliferation of neural progenitor cells and inhibits the differentiation of neuronal precursors. To our knowledge, this is the first in vivo study to define the time window of BMP-Bmpr1a-Smad signaling in regulating embryonic neural progenitor cell proliferation.
We also discovered that BMP-Bmpr1a-Smad and Notch-Her2 signaling regulate the proliferation of neural progenitors in an opposite manner—inhibiting BMP-Bmpr1a-Smad signaling promotes neural progenitor proliferation, whereas inactivating Notch-Her2 signaling reduces neural progenitor proliferation. Although inactivating BMP signaling upregulates her2 expression, suggesting an interaction between these two signaling pathways in regulating neural progenitor proliferation, inactivating BMP signaling upregulates neural progenitor proliferation in Her2 knockdown embryos, suggesting that these two signaling pathways may also regulate neural progenitor proliferation in a parallel manner. Taken together, a proper balance between BMP and Notch signaling is essential for the development of neural progenitors.

4. Materials and Methods

4.1. Ethics Statement

All experiments were performed in strict accordance with the standard guidelines for zebrafish work and were approved by the Institutional Animal Care and Use Committee of Chang Gung University (IACUC approval numbers: CGU07-74, CGU11-118, and CGU12-118).

4.2. Fish Maintenance and Transgenic Lines

AB (wild-type) zebrafish and transgenic line Tg (hsp70l:dnBmpr1aa-GFP) [23] were purchased from the Zebrafish International Resource Center (Eugene, OR, USA) and raised, maintained, and paired under standard conditions. Embryos were staged according to the hours post-fertilization [40].

4.3. Heat Shock and DMH1 Treatment

Batches of wild-type and transgenic embryos were strictly staged, as previously described [40] to ensure minimal developmental asynchrony. Wild-type and transgenic embryos were treated with DMH1 (Merck, Taipei, Taiwan) or induced by heat shock at 37 °C.

4.4. Morpholinos

her2 morpholino (CTGGAAAGAGAAGGTAAAAGTTTGG) was purchased from Gene Tools LLC. (Gene Tools, LLC., Philomath, OR, USA). Morpholinos with a random sequence that does not bind to the zebrafish genome (CCTCTTACCTCAGTTACAATTTATA) and with 5 mismatched bases to the her2 morpholino (CTaGAAAaAGAAGaTAAAAaTTTaG; mismatches are displayed by lowercase letters) were used as controls. Microinjection of morpholinos into zebrafish blastomeres was performed during the one- to two-cell stages. A detailed procedure of her2 knockdown has been described by Cheng et al. [38].

4.5. Histological Analysis

Digoxigenin-UTP-labeled riboprobes were synthesized according to the manufacturer’s instructions (Roche, Taipei, Taiwan) and in situ hybridization was performed as described previously. Color reactions were conducted using NBT/BCIP substrate (Roche, Taipei, Taiwan). To minimize variation between the control and experimental groups, we used embryos produced by a single pair of parents and used the same number of embryos for the control and experimental groups. The groups were compared under the same experimental conditions at the same time, and color reactions were initiated and stopped at precisely the same time. For immunohistochemistry, zebrafish embryos were blocked in 5% goat serum and incubated with a rabbit phospho-histone H3 antibody (1:200, Merck Millipore, distributed by Level Biotechnology Inc., Taipei, Taiwan). Phosphorylated histone H3 was detected using red-fluorochrome-conjugated secondary antibodies (Invitrogen, distributed by Level Biotechnology Inc., Taipei, Taiwan). Embryos were mounted in the Vectashield mounting medium (Vector Laboratories, Inc., distributed by Asia Bioscience Co., LTD., Taipei, Taiwan). Phospho-histone H3-positive cells were manually counted. To quantify sox2 expression by in situ hybridization, sox2-positive areas were selected and measured using ImageJ software. To detect apoptotic cells in the neuroectoderm, immunohistochemistry using rabbit monoclonal anti-active caspase-3 antibody (Abcam, distributed by Blossom Biotechnologies, Inc., Taipei, Taiwan) was applied to samples already stained with sox2 riboprobe using in situ hybridization. The caspase-3 antibody was detected using goat anti-rabbit IgG HRP (Invitrogen, distributed by Level Biotechnology Inc., Taipei, Taiwan), and 3, 3′-diaminobenzidine was used as a substrate for secondary antibody-conjugated HRP (Amresco, distributed by Protech Technology Enterprise Co., Ltd., Taipei, Taiwan). Phospho-histone H3- and caspase-3-positive cells were manually counted.

4.6. RNA Isolation and cDNA Synthesis

RNA was isolated from 20 embryos in each experiment. Samples collected from each experiment were suspended in 500 μL TRIzol reagent (Invitrogen, distributed by Level Biotechnology Inc., Taipei, Taiwan) and homogenized using a 25-gauge needle, followed by the addition of 250 μL chloroform and centrifugation to separate the aqueous phase. The aqueous solution was mixed with a half-volume of acid phenol and chloroform and subjected to centrifugation for 15 min at 4 °C. The phenol-chloroform extraction was repeated twice. RNA was extracted using 250 μL isopropanol and 70% ethanol, and the mixture was centrifuged for 30 min at 4 °C. The ethanol was then removed, and the RNA pellet was resuspended in 12 μL DEPC H2O. The first strand of cDNA was reverse-transcribed using the SuperScript III First-Strand Synthesis System (Applied Biosystems, distributed by Creative LifeSciences, Taipei, Taiwan).

4.7. Quantitative Analysis

For quantitative reverse transcriptase PCR (qRT-PCR), embryos were homogenized in TRIzol reagent (Invitrogen, distributed by Level Biotechnology Inc., Taipei, Taiwan), and total RNA was extracted using a standard method. cDNA was synthesized from total RNA through oligo(dT) priming using RevertAid First Strand cDNA synthesis kit (Bionovas, distributed by Scientific Biotech Corp., Taipei, Taiwan). qPCR was performed on an ABI StepOneTM Real-Time PCR System (Applied Biosystems, distributed by Creative LifeSciences, Taipei, Taiwan) using SYBR Green (ABclonal Technology, distributed by Interlab Co., LTD., Taipei, Taiwan). Primers for sox2 (F:5’-CACCAACTCCTCGGG AAACA-3′; R:5′-AATGGTCGCTTCTCGCTCTC-3′), her2 (F:5′-GAGATGGCTGTTATTTACCT-3′; R:5′-TTGGGTTTGTTTGTGAGC-3′), and GAPDH (F:5′-ACCCGTGCTGCTTTCTTGAC-3′; R:5′-GACCAGTTTGCCGCCTTCT-3′) were used. Gene expression levels were normalized to GAPDH and assessed using comparative Ct (40 cycles), according to the manufacturer’s instructions (7500 Real-Time PCR System, Applied Biosystems, distributed by Creative LifeSciences, Taipei, Taiwan).
Statistical analysis was performed using Student’s t-test with Microsoft Excel 2016. The significance level was set at p < 0.05. All reactions were performed in triplicate for each sample.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24021733/s1, Figure S1, DN-Bmpr1aa and DMH1 are sufficient to inhibit the expression of id3 and msx1b; Figure S2, Blocking BMP signaling from 4 hpf inhibits the development of epidermal ectoderm; Figure S3, Inactivation of BMP-Smad signaling does not affect cell apoptosis.

Author Contributions

Y.-C.C. (Yi-Chuan Cheng): Conceptualization, Methodology, Validation, Formal Analysis, Investigation, Resources, Writing—Original Draft, Writing—Review & Editing, Visualization, Supervision, Project Administration, Funding Acquisition; H.-Y.S.: Conceptualization, Methodology, Validation, Formal Analysis, Investigation, Writing—Original Draft, Visualization. C.-W.C.: Formal Analysis, Investigation, Visualization; Y.-C.C. (Yi-Chieh Chen): Formal Analysis, Investigation, Writing—Original Draft. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the Chang Gung Medical Foundation and Chang Gung Memorial Hospital (CMRPD1M0091, CMRPD1M0431, and BMRP857), and the Ministry of Science and Technology, Taiwan (106-2311-B-182-001-MY3 and 110-2320-B-182-008-MY3).

Institutional Review Board Statement

All experiments were performed in strict accordance with the standard guidelines for zebrafish work and were approved by the Institutional Animal Care and Use Committee of Chang Gung University (IACUC approval numbers: CGU07-74, CGU11-118, and CGU12-118).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We thank Sze-Cheng Lo and Li-Mei Pai for their helpful comments and Paul Scotting for the sox2 construct. We are grateful to the Taiwan Zebrafish Core facility at ZeTH and the Zebrafish Core in Academia Sinica for providing the zebrafish.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

Bone morphogenetic protein (BMP), dominant-negative form of the Bmp type 1 receptor (DN-BmpR1aa), dorsomorphin homologue 1 (DMH1), fibroblast growth factor (FGF), hairy/E(spl)-related 2 (Her2), hours post-fertilization (hpf), N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT), phospohryl histone 3 (pH3), quantitative reverse transcriptase PCR (qRT-PCR), transforming growth factor-beta (TGF-β).

References

  1. Florio, M.; Huttner, W.B. Neural progenitors, neurogenesis and the evolution of the neocortex. Development 2014, 141, 2182–2194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Sasai, N.; Kadoya, M.; Ong Lee Chen, A. Neural induction: Historical views and application to pluripotent stem cells. Dev. Growth Differ. 2021, 63, 26–37. [Google Scholar] [CrossRef] [PubMed]
  3. Stern, C.D. Neural induction: Old problem, new findings, yet more questions. Development 2005, 132, 2007–2021. [Google Scholar] [CrossRef] [Green Version]
  4. Lee, H.K.; Lee, H.S.; Moody, S.A. Neural transcription factors: From embryos to neural stem cells. Mol. Cells 2014, 37, 705–712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Liu, A.; Niswander, L.A. Bone morphogenetic protein signalling and vertebrate nervous system development. Nat. Rev. Neurosci. 2005, 6, 945–954. [Google Scholar] [CrossRef]
  6. Miyazono, K.; Miyazawa, K. Id: A target of BMP signaling. Sci. STKE 2002, 2002, pe40. [Google Scholar] [CrossRef] [PubMed]
  7. Ramos, C.; Robert, B. msh/Msx gene family in neural development. Trends Genet. 2005, 21, 624–632. [Google Scholar] [CrossRef]
  8. Chen, H.L.; Panchision, D.M. Concise review: Bone morphogenetic protein pleiotropism in neural stem cells and their derivatives—Alternative pathways, convergent signals. Stem. Cells 2007, 25, 63–68. [Google Scholar] [CrossRef]
  9. Hawley, S.H.; Wunnenberg-Stapleton, K.; Hashimoto, C.; Laurent, M.N.; Watabe, T.; Blumberg, B.W.; Cho, K.W. Disruption of BMP signals in embryonic Xenopus ectoderm leads to direct neural induction. Genes Dev. 1995, 9, 2923–2935. [Google Scholar] [CrossRef] [Green Version]
  10. Wilson, P.A.; Hemmati-Brivanlou, A. Induction of epidermis and inhibition of neural fate by Bmp-4. Nature 1995, 376, 331–333. [Google Scholar] [CrossRef]
  11. Yan, Y.; Wang, Q. BMP Signaling: Lighting up the Way for Embryonic Dorsoventral Patterning. Front. Cell Dev. Biol. 2021, 9, 799772. [Google Scholar] [CrossRef] [PubMed]
  12. Le Dreau, G. BuMPing Into Neurogenesis: How the Canonical BMP Pathway Regulates Neural Stem Cell Divisions Throughout Space and Time. Front. Neurosci. 2021, 15, 819990. [Google Scholar] [CrossRef] [PubMed]
  13. Mabie, P.C.; Mehler, M.F.; Kessler, J.A. Multiple roles of bone morphogenetic protein signaling in the regulation of cortical cell number and phenotype. J. Neurosci. 1999, 19, 7077–7088. [Google Scholar] [CrossRef]
  14. Gomes, W.A.; Mehler, M.F.; Kessler, J.A. Transgenic overexpression of BMP4 increases astroglial and decreases oligodendroglial lineage commitment. Dev. Biol. 2003, 255, 164–177. [Google Scholar] [CrossRef] [Green Version]
  15. Ille, F.; Atanasoski, S.; Falk, S.; Ittner, L.M.; Marki, D.; Buchmann-Moller, S.; Wurdak, H.; Suter, U.; Taketo, M.M.; Sommer, L. Wnt/BMP signal integration regulates the balance between proliferation and differentiation of neuroepithelial cells in the dorsal spinal cord. Dev. Biol. 2007, 304, 394–408. [Google Scholar] [CrossRef] [Green Version]
  16. Li, W.; Cogswell, C.A.; LoTurco, J.J. Neuronal differentiation of precursors in the neocortical ventricular zone is triggered by BMP. J. Neurosci. 1998, 18, 8853–8862. [Google Scholar] [CrossRef] [Green Version]
  17. Shou, J.; Rim, P.C.; Calof, A.L. BMPs inhibit neurogenesis by a mechanism involving degradation of a transcription factor. Nat. Neurosci. 1999, 2, 339–345. [Google Scholar] [CrossRef] [Green Version]
  18. Yanagisawa, M.; Takizawa, T.; Ochiai, W.; Uemura, A.; Nakashima, K.; Taga, T. Fate alteration of neuroepithelial cells from neurogenesis to astrocytogenesis by bone morphogenetic proteins. Neurosci. Res. 2001, 41, 391–396. [Google Scholar] [CrossRef] [PubMed]
  19. Nakashima, K.; Takizawa, T.; Ochiai, W.; Yanagisawa, M.; Hisatsune, T.; Nakafuku, M.; Miyazono, K.; Kishimoto, T.; Kageyama, R.; Taga, T. BMP2-mediated alteration in the developmental pathway of fetal mouse brain cells from neurogenesis to astrocytogenesis. Proc. Natl. Acad. Sci. USA 2001, 98, 5868–5873. [Google Scholar] [CrossRef] [Green Version]
  20. Woo, K.; Fraser, S.E. Specification of the zebrafish nervous system by nonaxial signals. Science 1997, 277, 254–257. [Google Scholar] [CrossRef]
  21. Korzh, V.; Sleptsova, I.; Liao, J.; He, J.; Gong, Z. Expression of zebrafish bHLH genes ngn1 and nrd defines distinct stages of neural differentiation. Dev. Dyn 1998, 213, 92–104. [Google Scholar] [CrossRef]
  22. Nguyen, V.H.; Schmid, B.; Trout, J.; Connors, S.A.; Ekker, M.; Mullins, M.C. Ventral and lateral regions of the zebrafish gastrula, including the neural crest progenitors, are established by a bmp2b/swirl pathway of genes. Dev. Biol. 1998, 199, 93–110. [Google Scholar] [CrossRef] [Green Version]
  23. Pyati, U.J.; Webb, A.E.; Kimelman, D. Transgenic zebrafish reveal stage-specific roles for Bmp signaling in ventral and posterior mesoderm development. Development 2005, 132, 2333–2343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Mullins, M.C.; Hammerschmidt, M.; Kane, D.A.; Odenthal, J.; Brand, M.; van Eeden, F.J.; Furutani-Seiki, M.; Granato, M.; Haffter, P.; Heisenberg, C.P.; et al. Genes establishing dorsoventral pattern formation in the zebrafish embryo: The ventral specifying genes. Development 1996, 123, 81–93. [Google Scholar] [CrossRef] [PubMed]
  25. Joly, J.S.; Joly, C.; Schulte-Merker, S.; Boulekbache, H.; Condamine, H. The ventral and posterior expression of the zebrafish homeobox gene eve1 is perturbed in dorsalized and mutant embryos. Development 1993, 119, 1261–1275. [Google Scholar] [CrossRef] [PubMed]
  26. Shih, H.Y.; Hsu, S.Y.; Ouyang, P.; Lin, S.J.; Chou, T.Y.; Chiang, M.C.; Cheng, Y.C. Bmp5 Regulates Neural Crest Cell Survival and Proliferation via Two Different Signaling Pathways. Stem. Cells 2017, 35, 1003–1014. [Google Scholar] [CrossRef]
  27. Hao, J.; Ho, J.N.; Lewis, J.A.; Karim, K.A.; Daniels, R.N.; Gentry, P.R.; Hopkins, C.R.; Lindsley, C.W.; Hong, C.C. In vivo structure-activity relationship study of dorsomorphin analogues identifies selective VEGF and BMP inhibitors. ACS Chem. Biol. 2010, 5, 245–253. [Google Scholar] [CrossRef] [Green Version]
  28. Hao, J.; Lee, R.; Chang, A.; Fan, J.; Labib, C.; Parsa, C.; Orlando, R.; Andresen, B.; Huang, Y. DMH1, a small molecule inhibitor of BMP type i receptors, suppresses growth and invasion of lung cancer. PLoS ONE 2014, 9, e90748. [Google Scholar] [CrossRef] [PubMed]
  29. Xia, L.; Wang, S.; Zhang, H.; Yang, Y.; Wei, J.; Shi, Y.; Zou, C.; Liu, J.; Luo, M.; Huang, A.; et al. The HBx and HBc of hepatitis B virus can influence Id1 and Id3 by reducing their transcription and stability. Virus Res. 2020, 284, 197973. [Google Scholar] [CrossRef] [PubMed]
  30. Esteves, F.F.; Springhorn, A.; Kague, E.; Taylor, E.; Pyrowolakis, G.; Fisher, S.; Bier, E. BMPs regulate msx gene expression in the dorsal neuroectoderm of Drosophila and vertebrates by distinct mechanisms. PLoS Genet. 2014, 10, e1004625. [Google Scholar] [CrossRef]
  31. Little, S.C.; Mullins, M.C. Extracellular modulation of BMP activity in patterning the dorsoventral axis. Birth Defects Res. C Embryo Today 2006, 78, 224–242. [Google Scholar] [CrossRef] [PubMed]
  32. Wilm, T.P.; Solnica-Krezel, L. Radar breaks the fog: Insights into dorsoventral patterning in zebrafish. Proc. Natl. Acad. Sci. USA 2003, 100, 4363–4365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Guo, X.; Wang, X.F. Signaling cross-talk between TGF-beta/BMP and other pathways. Cell Res. 2009, 19, 71–88. [Google Scholar] [CrossRef] [PubMed]
  34. Imayoshi, I.; Sakamoto, M.; Yamaguchi, M.; Mori, K.; Kageyama, R. Essential roles of Notch signaling in maintenance of neural stem cells in developing and adult brains. J. Neurosci. 2010, 30, 3489–3498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Maier, E.; Nord, H.; von Hofsten, J.; Gunhaga, L. A balance of BMP and notch activity regulates neurogenesis and olfactory nerve formation. PLoS ONE 2011, 6, e17379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Machold, R.P.; Kittell, D.J.; Fishell, G.J. Antagonism between Notch and bone morphogenetic protein receptor signaling regulates neurogenesis in the cerebellar rhombic lip. Neural. Dev. 2007, 2, 5. [Google Scholar] [CrossRef] [Green Version]
  37. Takizawa, T.; Ochiai, W.; Nakashima, K.; Taga, T. Enhanced gene activation by Notch and BMP signaling cross-talk. Nucleic Acids Res. 2003, 31, 5723–5731. [Google Scholar] [CrossRef] [PubMed]
  38. Cheng, Y.C.; Chiang, M.C.; Shih, H.Y.; Ma, T.L.; Yeh, T.H.; Huang, Y.C.; Lin, C.Y.; Lin, S.J. The transcription factor hairy/E(spl)-related 2 induces proliferation of neural progenitors and regulates neurogenesis and gliogenesis. Dev. Biol. 2015, 397, 116–128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Ohtsuka, T.; Sakamoto, M.; Guillemot, F.; Kageyama, R. Roles of the basic helix-loop-helix genes Hes1 and Hes5 in expansion of neural stem cells of the developing brain. J. Biol. Chem. 2001, 276, 30467–30474. [Google Scholar] [CrossRef] [Green Version]
  40. Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
Figure 1. The expression of bmpr1aa during gastrulation and early segmentation. (A) A schematic illustration of the lateral view of zebrafish embryo showing the regions of neuroectoderm (neural) and surface ectoderm (epi) with dorsal to the right. (B) Zebrafish embryos were analyzed using whole-mount in situ hybridization. These images show the lateral view of the embryos with dorsal to the right and ventral to the left. (C) Dorsal view of flat-mounted embryos with anterial to the top. (B) The bmpr1aa is ubiquitously expressed before 8 hpf, and gradually expressed in neural tissue from 8 hpf. (C) bmpr1aa is expressed in developing brain at 10 hpf (end of gastrulation) and 11 hpf (early segmentation). fb, forebrain; mb, midbrain; hb, hindbrain; epi, epidermal; sn, sensory neuron; psm, presomatic mesoderm.
Figure 1. The expression of bmpr1aa during gastrulation and early segmentation. (A) A schematic illustration of the lateral view of zebrafish embryo showing the regions of neuroectoderm (neural) and surface ectoderm (epi) with dorsal to the right. (B) Zebrafish embryos were analyzed using whole-mount in situ hybridization. These images show the lateral view of the embryos with dorsal to the right and ventral to the left. (C) Dorsal view of flat-mounted embryos with anterial to the top. (B) The bmpr1aa is ubiquitously expressed before 8 hpf, and gradually expressed in neural tissue from 8 hpf. (C) bmpr1aa is expressed in developing brain at 10 hpf (end of gastrulation) and 11 hpf (early segmentation). fb, forebrain; mb, midbrain; hb, hindbrain; epi, epidermal; sn, sensory neuron; psm, presomatic mesoderm.
Ijms 24 01733 g001
Figure 2. DN-Bmpr1aa and DMH1 sufficiently inhibited expression of eve1 at different time points. All panels are animal pole views with ventral to the left. Expression of eve1 was examined using in situ hybridization. (A) Tg (hsp70l:dnBmpr1aa-GFP) embryos were heat shock-treated at 5.3 hpf and harvested at 6, 7, and 9 hpf showing that eve1 expression was gradually downregulated. (B) Different concentrations of DMH1 were applied to embryos from 5.3 hpf, which inhibited eve1 expression. n, total number of embryos analyzed from three independent experiments. (C,D) qRT-PCR confirmed the expression levels of eve1 of in situ hybridization in (A,B). The percentages in each panel in (A,B) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD); ****, p < 0.0001.
Figure 2. DN-Bmpr1aa and DMH1 sufficiently inhibited expression of eve1 at different time points. All panels are animal pole views with ventral to the left. Expression of eve1 was examined using in situ hybridization. (A) Tg (hsp70l:dnBmpr1aa-GFP) embryos were heat shock-treated at 5.3 hpf and harvested at 6, 7, and 9 hpf showing that eve1 expression was gradually downregulated. (B) Different concentrations of DMH1 were applied to embryos from 5.3 hpf, which inhibited eve1 expression. n, total number of embryos analyzed from three independent experiments. (C,D) qRT-PCR confirmed the expression levels of eve1 of in situ hybridization in (A,B). The percentages in each panel in (A,B) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD); ****, p < 0.0001.
Ijms 24 01733 g002
Figure 3. Suppression of BMP signaling after 8 hpf does not affect neural induction. In situ hybridization of heat-shock induced Tg (hsp70l:dnBmpr1aa-GFP) (A) and DMH1-treated (B) embryos analyzed at 10 hpf. The upper panels in (A,B) indicate anterior part of embryos with dorsal to the bottom, and the lower panels indicate the lateral view with anterior to the left. (A) Inhibition of BMP signaling by heatshock-induced DN-Bmpr1aa at 5.3 hpf for one hour disrupted the expression pattern and caused ectopic expression of sox2 and sox3 (arrowheads), whereas heat shock treatment after 8 hpf did not alter the expression pattern of sox2 and sox3. (B) DMH1 treatment at 5.3 for one hour phenocopies the effect of heat-shocked Tg (hsp70l:dnBmpr1aa-GFP), which is the alternating pattern and ectopic expression of sox2 and sox3. DMH1 treatment after 8 hpf had no effect on the expression pattern of sox2 and sox3. n, total number of embryos analyzed from three independent experiments. (C) sox2-expressing areas were measured using ImageJ. It should be noted that inhibiting BMP signaling using DN-Bmpr1aa or DMH1 slightly increased sox2-expressing areas; however, this was not statistically significant. n, total number of embryos analyzed from three independent experiments. The percentages in each panel in (A,B) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). n.s., not significant.
Figure 3. Suppression of BMP signaling after 8 hpf does not affect neural induction. In situ hybridization of heat-shock induced Tg (hsp70l:dnBmpr1aa-GFP) (A) and DMH1-treated (B) embryos analyzed at 10 hpf. The upper panels in (A,B) indicate anterior part of embryos with dorsal to the bottom, and the lower panels indicate the lateral view with anterior to the left. (A) Inhibition of BMP signaling by heatshock-induced DN-Bmpr1aa at 5.3 hpf for one hour disrupted the expression pattern and caused ectopic expression of sox2 and sox3 (arrowheads), whereas heat shock treatment after 8 hpf did not alter the expression pattern of sox2 and sox3. (B) DMH1 treatment at 5.3 for one hour phenocopies the effect of heat-shocked Tg (hsp70l:dnBmpr1aa-GFP), which is the alternating pattern and ectopic expression of sox2 and sox3. DMH1 treatment after 8 hpf had no effect on the expression pattern of sox2 and sox3. n, total number of embryos analyzed from three independent experiments. (C) sox2-expressing areas were measured using ImageJ. It should be noted that inhibiting BMP signaling using DN-Bmpr1aa or DMH1 slightly increased sox2-expressing areas; however, this was not statistically significant. n, total number of embryos analyzed from three independent experiments. The percentages in each panel in (A,B) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). n.s., not significant.
Ijms 24 01733 g003
Figure 4. Epidermal ectoderm was unaffected after blocking BMP signaling from 8 hpf. Left panels are lateral views of embryos with ventral to the left. In situ hybridization showed no apparent change in the tp63-expressing region in BMP signal-depleted embryos from 8 hpf onward. n, total number of embryos analyzed from three independent experiments. The tp63 signals were measured using ImageJ and quantified (right panels). n, total number of embryos analyzed from three independent experiments. The percentages in each panel indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). n.s., not significant.
Figure 4. Epidermal ectoderm was unaffected after blocking BMP signaling from 8 hpf. Left panels are lateral views of embryos with ventral to the left. In situ hybridization showed no apparent change in the tp63-expressing region in BMP signal-depleted embryos from 8 hpf onward. n, total number of embryos analyzed from three independent experiments. The tp63 signals were measured using ImageJ and quantified (right panels). n, total number of embryos analyzed from three independent experiments. The percentages in each panel indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). n.s., not significant.
Ijms 24 01733 g004
Figure 5. Inhibiting BMP signaling induces the proliferation of neural progenitors. (A,C) Dorsal view of flat-mounted embryos with the anterior on the top. In situ hybridization of 10 hpf embryos demonstrated increased expression of sox2 by heat shock-induced DN-Bmpr1aa (A) or DMH1 treatment (C) at 8 to 10 hpf. The upper panels in (A,C) are bright-field images and bottom panels are fluorescent images of the same; the expression of sox2 was pseudo-colored with fluorescent red and counterstained with proliferating marker phospho-histone H3 (pH3) antibody (fluorescent green) to give a better representation of the double-stained cells (fluorescent yellow). (B,D) The expression of sox2 was quantified by qRT-PCR (left panel of (B,D)). pH3-positive cells in the sox2-positive areas were manually counted and analyzed, shown on the right panel of (B,D). n, total number of embryos analyzed from three independent experiments. The percentages in each panel in (A,C) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). * p < 0.05; ** p < 0.01.
Figure 5. Inhibiting BMP signaling induces the proliferation of neural progenitors. (A,C) Dorsal view of flat-mounted embryos with the anterior on the top. In situ hybridization of 10 hpf embryos demonstrated increased expression of sox2 by heat shock-induced DN-Bmpr1aa (A) or DMH1 treatment (C) at 8 to 10 hpf. The upper panels in (A,C) are bright-field images and bottom panels are fluorescent images of the same; the expression of sox2 was pseudo-colored with fluorescent red and counterstained with proliferating marker phospho-histone H3 (pH3) antibody (fluorescent green) to give a better representation of the double-stained cells (fluorescent yellow). (B,D) The expression of sox2 was quantified by qRT-PCR (left panel of (B,D)). pH3-positive cells in the sox2-positive areas were manually counted and analyzed, shown on the right panel of (B,D). n, total number of embryos analyzed from three independent experiments. The percentages in each panel in (A,C) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). * p < 0.05; ** p < 0.01.
Ijms 24 01733 g005
Figure 6. Inhibiting BMP signaling reduces the formation of neuronal precursors. All panels show dorsal views of flat-mounted embryos with the anterior on the top. (A,C) In situ hybridization of 10 hpf embryos focusing on the midbrain and hindbrain regions showing that neurog1-positive cells were reduced by heat-shock-induced DN-BmpR1aa (A) or DMH1 treatment (C) at 8 to 10 hpf. This was quantified by the cell-count analysis shown in (B,D), respectively. n, total number of embryos analyzed from three independent experiments. The percentages in each panel in (A,C) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). ** p < 0.01; *** p < 0.001.
Figure 6. Inhibiting BMP signaling reduces the formation of neuronal precursors. All panels show dorsal views of flat-mounted embryos with the anterior on the top. (A,C) In situ hybridization of 10 hpf embryos focusing on the midbrain and hindbrain regions showing that neurog1-positive cells were reduced by heat-shock-induced DN-BmpR1aa (A) or DMH1 treatment (C) at 8 to 10 hpf. This was quantified by the cell-count analysis shown in (B,D), respectively. n, total number of embryos analyzed from three independent experiments. The percentages in each panel in (A,C) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). ** p < 0.01; *** p < 0.001.
Ijms 24 01733 g006
Figure 7. Suppressing Notch signaling abolished the upregulation of neural progenitor proliferation caused by BMP-BmpR1 inactivation (A,C) All panels are dorsal views of flat-mounted embryos at 10 hpf with the anterior on the top analyzed using in situ hybridization for sox2 expression and immunohistochemistry with phospho-histone H3 (pH3) antibody. Embryos at 8 hpf were treated with heat-shock-induced DN-BmpR1aa or treated with DHM1 for one hour. The upper panel shows bright field images and the bottom panel shows fluorescent images taken from identical embryos of the upper row; the expression of sox2 was pseudo-colored with fluorescent red and counterstained with proliferating marker pH3 (fluorescent green). (B,D) The results of in situ hybridization were confirmed by quantitative reverse transcriptase PCR (qRT-PCR) and the proliferating neural progenitors (fluorescent yellow) were subjected for cell counts (B). n, total number of embryos analyzed from three independent experiments. The percentages in each panel in (A,C) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 7. Suppressing Notch signaling abolished the upregulation of neural progenitor proliferation caused by BMP-BmpR1 inactivation (A,C) All panels are dorsal views of flat-mounted embryos at 10 hpf with the anterior on the top analyzed using in situ hybridization for sox2 expression and immunohistochemistry with phospho-histone H3 (pH3) antibody. Embryos at 8 hpf were treated with heat-shock-induced DN-BmpR1aa or treated with DHM1 for one hour. The upper panel shows bright field images and the bottom panel shows fluorescent images taken from identical embryos of the upper row; the expression of sox2 was pseudo-colored with fluorescent red and counterstained with proliferating marker pH3 (fluorescent green). (B,D) The results of in situ hybridization were confirmed by quantitative reverse transcriptase PCR (qRT-PCR) and the proliferating neural progenitors (fluorescent yellow) were subjected for cell counts (B). n, total number of embryos analyzed from three independent experiments. The percentages in each panel in (A,C) indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). * p < 0.05; ** p < 0.01; *** p < 0.001.
Ijms 24 01733 g007
Figure 8. Inactivating BMP signaling upregulates neural progenitor proliferation in response to Her2 knockdown. Heat-shock treatment of Tg (hsp70l:dnBmpr1aa-GFP) or DMH1 was performed at 8–10 hpf embryos and harvested at 10 hpf. (A,D) qRT-PCR analysis demonstrated increased her2 expression by activating DN-Bmpr1aa (A) and DMH1 treatment (D). (B,E) In situ hybridization of sox2 expression demonstrating BMP inactivation by activating DN-Bmpr1aa or DMH1 treatment upregulated sox2 expression and the number of proliferating neural progenitors revealed by sox2 expression and pH3 counterstaining. Injection of her2 morpholino at the one-cell stage significantly reduced sox2 expression and the number of proliferating neural progenitors in embryos with or without BMP inactivation. (C,F) The results of in situ hybridization were confirmed by qRT-PCR, and the number of pH3-positive cells in sox2-expressing areas was counted manually. n, total number of embryos analyzed from three independent experiments. The percentages in each panel in B and E indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). * p < 0.05; ** p < 0.01.
Figure 8. Inactivating BMP signaling upregulates neural progenitor proliferation in response to Her2 knockdown. Heat-shock treatment of Tg (hsp70l:dnBmpr1aa-GFP) or DMH1 was performed at 8–10 hpf embryos and harvested at 10 hpf. (A,D) qRT-PCR analysis demonstrated increased her2 expression by activating DN-Bmpr1aa (A) and DMH1 treatment (D). (B,E) In situ hybridization of sox2 expression demonstrating BMP inactivation by activating DN-Bmpr1aa or DMH1 treatment upregulated sox2 expression and the number of proliferating neural progenitors revealed by sox2 expression and pH3 counterstaining. Injection of her2 morpholino at the one-cell stage significantly reduced sox2 expression and the number of proliferating neural progenitors in embryos with or without BMP inactivation. (C,F) The results of in situ hybridization were confirmed by qRT-PCR, and the number of pH3-positive cells in sox2-expressing areas was counted manually. n, total number of embryos analyzed from three independent experiments. The percentages in each panel in B and E indicate the proportion of embryos displaying the same phenotype as that shown in the photographs of the total embryos examined. Quantitative data are presented as mean ± standard deviation (SD). * p < 0.05; ** p < 0.01.
Ijms 24 01733 g008
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shih, H.-Y.; Chang, C.-W.; Chen, Y.-C.; Cheng, Y.-C. Identification of the Time Period during Which BMP Signaling Regulates Proliferation of Neural Progenitor Cells in Zebrafish. Int. J. Mol. Sci. 2023, 24, 1733. https://doi.org/10.3390/ijms24021733

AMA Style

Shih H-Y, Chang C-W, Chen Y-C, Cheng Y-C. Identification of the Time Period during Which BMP Signaling Regulates Proliferation of Neural Progenitor Cells in Zebrafish. International Journal of Molecular Sciences. 2023; 24(2):1733. https://doi.org/10.3390/ijms24021733

Chicago/Turabian Style

Shih, Hung-Yu, Chia-Wei Chang, Yi-Chieh Chen, and Yi-Chuan Cheng. 2023. "Identification of the Time Period during Which BMP Signaling Regulates Proliferation of Neural Progenitor Cells in Zebrafish" International Journal of Molecular Sciences 24, no. 2: 1733. https://doi.org/10.3390/ijms24021733

APA Style

Shih, H.-Y., Chang, C.-W., Chen, Y.-C., & Cheng, Y.-C. (2023). Identification of the Time Period during Which BMP Signaling Regulates Proliferation of Neural Progenitor Cells in Zebrafish. International Journal of Molecular Sciences, 24(2), 1733. https://doi.org/10.3390/ijms24021733

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop