Subacute Ruminal Acidosis as a Potential Factor that Induces Endometrium Injury in Sheep
Abstract
1. Introduction
2. Results
2.1. High-Concentrate Feed Caused SARA, and Increased LPS and TNFα Concentrations in Rumen Fluid, Serum, and Endometrial Tissue Supernatant in Sheep
2.2. SARA Can Cause the Inflammatory Response of the Endometrium in Sheep
2.3. Effects of SARA on the Endometrial Claudin-1 and Occludin Protein Expression
2.4. Confirmation of Primary Sheep Endometrial Epithelial Cells Cultured In Vitro
2.5. Effects of LPS-Induced Endometrial Epithelial Cell Inflammation on Claudin-1 and Occludin
2.6. Effects of 17β-Estradiol and Progesterone on Epithelial Cell Relative Protein Expression Levels of Claudin-1 and Occludin
2.7. Effect of SARA on the Expression of Endometrial E2 and P4 Receptors
2.8. Mechanism of Effect of SARA on Sheep Endometrial TJs
3. Discussion
4. Materials and Methods
4.1. Establishment of a SARA Model
4.2. Enzyme-Linked Immunosorbent Assay
4.3. Hematoxylin-Eosin Staining
4.4. Immunohistochemical Staining
4.5. Total RNA Isolation and Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
4.6. Western Blotting
4.7. Endometrium Epithelial Cell Culture and Treatment
4.8. Immunofluorescence
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tsukita, S.; Yamazaki, Y.; Katsuno, T.; Tamura, A. Tight junction-based epithelial microenvironment and cell proliferation. Oncogene 2008, 27, 6930–6938. [Google Scholar] [CrossRef] [PubMed]
- Tamura, A.; Kitano, Y.; Hata, M.; Katsuno, T.; Moriwaki, K.; Sasaki, H.; Hayashi, H.; Suzuki, Y.; Noda, T.; Furuse, M.; et al. Megaintestine in Claudin-15–Deficient Mice. Gastroenterology 2008, 134, 523–534.e3. [Google Scholar] [CrossRef] [PubMed]
- Tsukita, S.; Furuse, M.; Itoh, M. Multifunctional strands in tight junctions. Nat. Rev. Mol. Cell Biol. 2001, 2, 285–293. [Google Scholar] [CrossRef]
- Van Itallie, C.M.; Anderson, J.M. Claudins and epithelial paracellular transport. Annu. Rev. Physiol. 2006, 68, 403–429. [Google Scholar] [CrossRef]
- Angelow, S.; Ahlstrom, R.; Yu, A.S.L. Biology of claudins. Am. J. Physiol. Physiol. 2008, 295, F867–F876. [Google Scholar] [CrossRef]
- Schneeberger, E.E.; Lynch, R.D. The tight junction: A multifunctional complex. Am. J. Physiol. Physiol. 2004, 286, C1213–C1228. [Google Scholar] [CrossRef] [PubMed]
- Aijaz, S.; Balda, M.S.; Matter, K. Tight Junctions: Molecular Architecture and Function. J. Int. Rev. Cytol. 2006, 248, 261–298. [Google Scholar] [CrossRef]
- Fu, Y.; He, Y.; Xiang, K.; Zhao, C.; He, Z.; Qiu, M.; Hu, X.; Zhang, N. The Role of Rumen Microbiota and Its Metabolites in Subacute Ruminal Acidosis (SARA)-Induced Inflammatory Diseases of Ruminants. Microorganisms 2022, 10, 1495. [Google Scholar] [CrossRef]
- Khafipour, E.; Krause, D.; Plaizier, J. A grain-based subacute ruminal acidosis challenge causes translocation of lipopolysaccharide and triggers inflammation. J. Dairy Sci. 2009, 92, 1060–1070. [Google Scholar] [CrossRef]
- Zhang, K.; Chang, G.; Xu, T.; Xu, L.; Guo, J.; Jin, D.; Shen, X. Lipopolysaccharide derived from the digestive tract activates inflammatory gene expression and inhibits casein synthesis in the mammary glands of lactating dairy cows. Oncotarget 2016, 7, 9652–9665. [Google Scholar] [CrossRef]
- Hu, X.; Li, S.; Mu, R.; Guo, J.; Zhao, C.; Cao, Y.; Zhang, N.; Fu, Y. The Rumen Microbiota Contributes to the Development of Mastitis in Dairy Cows. Microbiol. Spectr. 2022, 10, e0251221. [Google Scholar] [CrossRef] [PubMed]
- Bilal, M.S.; Abaker, J.A.; Aabdin, Z.U.; Xu, T.; Dai, H.; Zhang, K.; Liu, X.; Shen, X. Lipopolysaccharide derived from the digestive tract triggers an inflammatory response in the uterus of mid-lactating dairy cows during SARA. BMC Veter- Res. 2016, 12, 284. [Google Scholar] [CrossRef] [PubMed]
- Eckel, E.F.; Ametaj, B.N. Invited review: Role of bacterial endotoxins in the etiopathogenesis of periparturient diseases of transition dairy cows. J. Dairy Sci. 2016, 99, 5967–5990. [Google Scholar] [CrossRef] [PubMed]
- Tobioka, H.; Isomura, H.; Kokai, Y.; Tokunaga, Y.; Yamaguchi, J.; Sawada, N. Occludin expression decreases with the progression of human endometrial carcinoma. Hum. Pathol. 2004, 35, 159–164. [Google Scholar] [CrossRef]
- Lewis, G.S. Steroidal regulation of uterine resistance to bacterial infection in livestock. Reprod. Biol. Endocrinol. 2003, 1, 117. [Google Scholar] [CrossRef]
- Mendoza-Rodríguez, C.A.; González-Mariscal, L.; Cerbón, M. Changes in the distribution of ZO-1, occludin, and claudins in the rat uterine epithelium during the estrous cycle. Cell Tissue Res. 2005, 319, 315–330. [Google Scholar] [CrossRef]
- Herath, S.; Fischer, D.P.; Werling, D.; Williams, E.; Lilly, S.T.; Dobson, H.; Bryant, C.E.; Sheldon, I.M. Expression and Function of Toll-Like Receptor 4 in the Endometrial Cells of the Uterus. Endocrinology 2006, 147, 562–570. [Google Scholar] [CrossRef]
- Braniste, V.; Leveque, M.; Buisson-Brenac, C.; Bueno, L.; Fioramonti, J.; Houdeau, E. Oestradiol decreases colonic permeability through oestrogen receptor β-mediated up-regulation of occludin and junctional adhesion molecule-A in epithelial cells. J. Physiol. 2009, 587, 3317–3328. [Google Scholar] [CrossRef]
- Guillomot, M.; Fléchon, J.-E.; Wintenberger-Torres, S. Conceptus attachment in the Ewe: An ultrastructural study. Placenta 1981, 2, 169–181. [Google Scholar] [CrossRef]
- Guillomot, M.; Betteridge, K.J.; Harvey, D.; Goff, A.K. Endocytotic activity in the endometrium during conceptus attachment in the cow. Reproduction 1986, 78, 27–36. [Google Scholar] [CrossRef]
- Hu, M.; Zhang, Y.; Li, X.; Cui, P.; Li, J.; Brännström, M.; Shao, L.R.; Billig, H. Alterations of endometrial epithelial–mesenchymal transition and MAPK signalling components in women with PCOS are partially modulated by metformin in vitro. Mol. Hum. Reprod. 2020, 26, 312–326. [Google Scholar] [CrossRef] [PubMed]
- Gozho, G.; Plaizier, J.; Krause, D.; Kennedy, A.; Wittenberg, K. Subacute Ruminal Acidosis Induces Ruminal Lipopolysaccharide Endotoxin Release and Triggers an Inflammatory Response. J. Dairy Sci. 2005, 88, 1399–1403. [Google Scholar] [CrossRef] [PubMed]
- DeVries, T.; Dohme, F.; Beauchemin, K. Repeated Ruminal Acidosis Challenges in Lactating Dairy Cows at High and Low Risk for Developing Acidosis: Feed Sorting. J. Dairy Sci. 2008, 91, 3958–3967. [Google Scholar] [CrossRef]
- Korhonen, R.; Korpela, R.; Moilanen, E. Signalling mechanisms involved in the induction of inducible nitric oxide synthase by Lactobacillus rhamnosus GG, endotoxin, and lipoteichoic acid. Inflammation 2002, 26, 207–214. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.K.; Jiang, Y.; Gupta, S. Effects of Bacterial Toxins on Endothelial Tight Junction In Vitro: A Mechanism-Based Investigation. Toxicol. Mech. Methods 2007, 17, 331–347. [Google Scholar] [CrossRef] [PubMed]
- Jing, L.; Zhang, R.; Liu, Y.; Zhu, W.; Mao, S. Intravenous lipopolysaccharide challenge alters ruminal bacterial microbiota and disrupts ruminal metabolism in dairy cattle. Br. J. Nutr. 2014, 112, 170–182. [Google Scholar] [CrossRef] [PubMed]
- Minuti, A.; Ahmed, S.; Trevisi, E.; Piccioli-Cappelli, F.; Bertoni, G.; Jahan, N.; Bani, P. Experimental acute rumen acidosis in sheep: Consequences on clinical, rumen, and gastrointestinal permeability conditions and blood chemistry1. J. Anim. Sci. 2014, 92, 3966–3977. [Google Scholar] [CrossRef]
- Minuti, A.; Palladino, A.; Khan, M.; Alqarni, S.; Agrawal, A.; Piccioli-Capelli, F.; Hidalgo, F.; Cardoso, F.; Trevisi, E.; Loor, J. Abundance of ruminal bacteria, epithelial gene expression, and systemic biomarkers of metabolism and inflammation are altered during the peripartal period in dairy cows. J. Dairy Sci. 2015, 98, 8940–8951. [Google Scholar] [CrossRef]
- Mueller, M.D.; Lebovic, D.I.; Garrett, E.; Taylor, R.N. Neutrophils infiltrating the endometrium express vascular endothelial growth factor: Potential role in endometrial angiogenesis. Fertil. Steril. 2000, 74, 107–112. [Google Scholar] [CrossRef]
- Hibi, T.; Inoue, N.; Ogata, H.; Naganuma, M. Introduction and overview: Recent advances in the immunotherapy of inflammatory bowel disease. J. Gastroenterol. 2003, 38 (Suppl. 15), 36–42. [Google Scholar]
- Esposito, E. TNF-Alpha as a Therapeutic Target in Inflammatory Diseases, Ischemia- Reperfusion Injury and Trauma. Curr. Med. Chem. 2009, 16, 3152–3167. [Google Scholar] [CrossRef] [PubMed]
- Amoozadeh, Y.; Dan, Q.; Anwer, S.; Huang, H.H.; Barbieri, V.; Waheed, F.; Maishan, M.; Szászi, K. Tumor Necrosis Factor-α Increases Claudin-1, 4, and 7 Expression in Tubular Cells: Role in Permeability Changes. J. Cell. Physiol. 2017, 232, 2210–2220. [Google Scholar] [CrossRef] [PubMed]
- Iida, M.; Ohtomo, S.; Wada, N.A.; Ueda, O.; Tsuboi, Y.; Kurata, A.; Jishage, K.-I.; Horiba, N. TNF-α induces Claudin-1 expression in renal tubules in Alport mice. PLoS ONE 2022, 17, e0265081. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Liu, Z.; Shen, P.; Zhao, C.; Liu, B.; Shu, C.; Hu, X.; Fu, Y. Kynurenic acid ameliorates lipopolysaccharide-induced endometritis by regulating the GRP35/NF-κB signaling pathway. Toxicol. Appl. Pharmacol. 2022, 438, 115907. [Google Scholar] [CrossRef]
- Li, S.; Wang, Y.; Feng, L.; Yu, Z.; Qiu, M.; Wang, Y.; Zhang, N.; Hu, X.; Fu, Y. Bacillus subtilis ameliorates Escherichia coli-induced endometritis in mice via maintaining endometrial barrier and inhibiting inflammatory response. Microb. Pathog. 2022, 166, 105487. [Google Scholar] [CrossRef]
- Johnson, M.L.; Redmer, D.A.; Reynolds, L.P. Effects of Ovarian Steroids on Uterine Growth, Morphology, and Cell Proliferation in Ovariectomized, Steroid-Treated Ewes. Biol. Reprod. 1997, 57, 588–596. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, L.P.; Kirsch, J.D.; Kraft, K.C.; Knutson, D.L.; McClaflin, W.J.; Redmer, D.A. Time-Course of the Uterine Response to Estradiol-17β in Ovariectomized Ewes: Uterine Growth and Microvascular Development1. Biol. Reprod. 1998, 59, 606–612. [Google Scholar] [CrossRef]
- Magness, R.R.; Phernetton, T.M.; Zheng, J. Systemic and uterine blood flow distribution during prolonged infusion of 17β-estradiol. Am. J. Physiol. Circ. Physiol. 1998, 275, H731–H743. [Google Scholar] [CrossRef]
- Aberdeen, G.W.; Wiegand, S.J.; Bonagura, T.W.; Pepe, G.J.; Albrecht, E.D. Vascular Endothelial Growth Factor Mediates the Estrogen-Induced Breakdown of Tight Junctions between and Increase in Proliferation of Microvessel Endothelial Cells in the Baboon Endometrium. Endocrinology 2008, 149, 6076–6083. [Google Scholar] [CrossRef]
- Vasquez-Hidalgo, M.; Kelany, K.; Grazul-Bilska, A.; Bauer, M.; Swanson, K.; Perry, G.; Vonnahme, K. Acute effects of estradiol-17β on plasma volume and uterine cell proliferation in sheep. Theriogenology 2021, 176, 12–17. [Google Scholar] [CrossRef]
- Furuse, M.; Hata, M.; Furuse, K.; Yoshida, Y.; Haratake, A.; Sugitani, Y.; Noda, T.; Kubo, A.; Tsukita, S. Claudin-based tight junctions are crucial for the mammalian epidermal barrier: A lesson from claudin-1-deficient mice. J. Cell Biol. 2002, 156, 1099–1111. [Google Scholar] [CrossRef] [PubMed]
- Nitta, T.; Hata, M.; Gotoh, S.; Seo, Y.; Sasaki, H.; Hashimoto, N.; Furuse, M.; Tsukita, S. Size-selective loosening of the blood-brain barrier in claudin-5-deficient mice. J. Cell Biol. 2003, 161, 653–660. [Google Scholar] [CrossRef] [PubMed]
- Gow, A.; Southwood, C.M.; Li, J.S.; Pariali, M.; Riordan, G.P.; E Brodie, S.; Danias, J.; Bronstein, J.M.; Kachar, B.; A Lazzarini, R. CNS Myelin and Sertoli Cell Tight Junction Strands Are Absent in Osp/Claudin-11 Null Mice. Cell 1999, 99, 649–659. [Google Scholar] [CrossRef] [PubMed]
- Ben-Yosef, T.; Belyantseva, I.A.; Saunders, T.; Hughes, E.D.; Kawamoto, K.; Van Itallie, C.M.; Beyer, L.A.; Halsey, K.; Gardner, D.J.; Wilcox, E.R.; et al. Claudin 14 knockout mice, a model for autosomal recessive deafness DFNB29, are deaf due to cochlear hair cell degeneration. Hum. Mol. Genet. 2003, 12, 2049–2061. [Google Scholar] [CrossRef] [PubMed]
- Ye, L.; Martin, T.A.; Parr, C.; Harrison, G.M.; Mansel, R.E.; Jiang, W.G. Biphasic effects of 17-beta-estradiol on expression of occludin and transendothelial resistance and paracellular permeability in human vascular endothelial cells. J. Cell. Physiol. 2003, 196, 362–369. [Google Scholar] [CrossRef]
- Kang, H.S.; Ahn, H.S.; Kang, H.J.; Gye, M.C. Effect of estrogen on the expression of occludin in ovariectomized mouse brain. Neurosci. Lett. 2006, 402, 30–34. [Google Scholar] [CrossRef]
- Sumanasekera, W.K.; Sumanasekera, G.U.; Mattingly, K.A.; Dougherty, S.M.; Keynton, R.S.; Klinge, C.M. Estradiol and dihydrotestosterone regulate endothelial cell barrier function after hypergravity-induced alterations in MAPK activity. Am. J. Physiol. Physiol. 2007, 293, C566–C573. [Google Scholar] [CrossRef]
- Ryan, K.; Guadagnin, A.; Glosson, K.; Bascom, S.; Rowson, A.; Steelman, A.; Cardoso, F. Increased dietary calcium inclusion in fully acidified prepartum diets improved postpartum uterine health and fertility when fed to Holstein cows. Theriogenology 2020, 142, 338–347. [Google Scholar] [CrossRef]
- Satterfield, M.C.; Dunlap, K.A.; Hayashi, K.; Burghardt, R.C.; Spencer, T.E.; Bazer, F.W. Tight and Adherens Junctions in the Ovine Uterus: Differential Regulation by Pregnancy and Progesterone. Endocrinology 2007, 148, 3922–3931. [Google Scholar] [CrossRef]
- Wenbo, G. Synthesis of Melatonin in Sheep Epididymis and Its Regulation on Physiological Function of Epididymis Epithelial Cells. PhD Dissertation, Gansu Agricultural University, Lanzhou, China, 2021. Available online: https://kns.cnki.net/KCMS/detail/detail.aspx?dbname=CDFDLAST2022&filename=1021626709.nh (accessed on 24 December 2022).
- Ge, W.; Duan, H.; Xiao, L.; Lv, J.; Jiang, Y.; Ding, Z.; Hu, J.; Zhang, Y.; Zhao, X. 17β-estradiol protects sheep oviduct epithelial cells against lipopolysaccharide-induced inflammation in vitro. Mol. Immunol. 2020, 127, 21–30. [Google Scholar] [CrossRef]
- Ge, W.-B.; Xiao, L.-F.; Duan, H.-W.; Li, Z.-S.; Jiang, Y.-T.; Yang, S.-S.; Hu, J.-J.; Zhang, Y.; Zhao, X.-X. Melatonin protects against lipopolysaccharide-induced epididymitis in sheep epididymal epithelial cells in vitro. Immunol. Lett. 2019, 214, 45–51. [Google Scholar] [CrossRef] [PubMed]
- Duan, H.; Xiao, L.; Hu, J.; Zhang, Y.; Zhao, X.; Ge, W.; Jiang, Y.; Song, L.; Yang, S.; Luo, W. Expression of oestrogen receptor, androgen receptor and progesterone nuclear receptor in sheep uterus during the oestrous cycle. Reprod. Domest. Anim. 2019, 54, 1305–1312. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Wang, M.; Pan, Y.; Xie, Y.; Han, J.; Zhang, X.; Niayale, R.; He, H.; Li, Q.; Zhao, T.; et al. Anti-inflammatory Effect of Astragalin and Chlorogenic Acid on Escherichia coli-Induced Inflammation of Sheep Endometrial Epithelium Cells. Front. Veter- Sci. 2020, 7, 201. [Google Scholar] [CrossRef]
- Young, G.D.; Winokur, T.S.; Cerfolio, R.J.; Van Tine, B.A.; Chow, L.T.; Okoh, V.; Garver, R.I. Differential expression and biodistribution of cytokeratin 18 and desmoplakins in non-small cell lung carcinoma subtypes. Lung Cancer 2002, 36, 133–141. [Google Scholar] [CrossRef]
- Woelfle, U.; Sauter, G.; Santjer, S.; Brakenhoff, R.; Pantel, K. Down-Regulated Expression of Cytokeratin 18 Promotes Progression of Human Breast Cancer. Clin. Cancer Res. 2004, 10, 2670–2674. [Google Scholar] [CrossRef]











| Genes | Sequences (5′−3′) | Accession No. |
|---|---|---|
| TLR4 | F: GGTTTCCACAAGAGCCGTAA | NM_001135930.1 |
| R: CTGTTCAGAAGGCGATAGA | ||
| NFκB | F: CCAGCATCAAAATCCCCAGC | EF121765.1 |
| R: GTGAAGGGTTGGAGACCTCA | ||
| TNF–α | F: GGGAACACAGACAGAGGGGACA | EF446377.1 |
| R: CCTGCGAGTAGATGAGGTAAAG | ||
| ERα | F:GACCGAAGAGGAGGGAGAATG | AY033393.1 |
| R:CGGGCTGTTCTTCTTAGTGTGTT | ||
| ERβ | F:ACACCTCTCTCCTTTAGCCATCC | AF177936.1 |
| R:TCCTTTTCAATGTCTCCCTGTTC | ||
| PGR | F:GTCAGGCTGGCATGGTTCTT | Z66555.1 |
| R:GGGCTTGGCTTTCATTTGG | ||
| β-actin | F: GTCACCAACTTGGGACGACA | U39357 |
| R: AGGCGTACAGGGACAGCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zeng, J.; Lv, J.; Duan, H.; Yang, S.; Wu, J.; Yan, Z.; Zhang, R.; Hu, J.; Zhang, Y. Subacute Ruminal Acidosis as a Potential Factor that Induces Endometrium Injury in Sheep. Int. J. Mol. Sci. 2023, 24, 1192. https://doi.org/10.3390/ijms24021192
Zeng J, Lv J, Duan H, Yang S, Wu J, Yan Z, Zhang R, Hu J, Zhang Y. Subacute Ruminal Acidosis as a Potential Factor that Induces Endometrium Injury in Sheep. International Journal of Molecular Sciences. 2023; 24(2):1192. https://doi.org/10.3390/ijms24021192
Chicago/Turabian StyleZeng, Jianlin, Jianshu Lv, Hongwei Duan, Shuai Yang, Jianxin Wu, Zhenxing Yan, Rong Zhang, Junjie Hu, and Yong Zhang. 2023. "Subacute Ruminal Acidosis as a Potential Factor that Induces Endometrium Injury in Sheep" International Journal of Molecular Sciences 24, no. 2: 1192. https://doi.org/10.3390/ijms24021192
APA StyleZeng, J., Lv, J., Duan, H., Yang, S., Wu, J., Yan, Z., Zhang, R., Hu, J., & Zhang, Y. (2023). Subacute Ruminal Acidosis as a Potential Factor that Induces Endometrium Injury in Sheep. International Journal of Molecular Sciences, 24(2), 1192. https://doi.org/10.3390/ijms24021192

