Synergistic Effect of Saccharin and Caffeine on Antiproliferative Activity in Human Ovarian Carcinoma Ovcar-3 Cells
Abstract
:1. Introduction
2. Results
2.1. Anti-Proliferative Activity of Saccharin or Caffeine Single-Drug Treatment in Ovcar-3 Cells
2.2. Anti-Proliferative Activity of Saccharin and Caffeine Combination Treatment in Ovcar-3 Cells
2.3. Clonogenic Assay
2.4. Apoptosis Induced by Saccharin Combined with Caffeine in Ovcar-3 Cells
2.5. Reverse Transcription Polymerase Chain Reaction (RT-PCR)
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Viability Assay
4.3. Analysis of Cytotoxic Synergy
4.4. Clonogenic Assay
4.5. Flow Cytometry Analysis of Apoptotic Cells Using Annexin V-FITC and Propidium Iodide (PI)-PE
4.6. Reverse Transcription Polymerase Chain Reaction (RT-PCR) Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Torre, L.A.; Trabert, B.; DeSantis, C.E.; Miller, K.D.; Samimi, G.; Runowicz, C.D.; Gaudet, M.M.; Jemal, A.; Siegel, R.L. Ovarian Cancer Statistics, 2018. CA Cancer J. Clin. 2018, 68, 284–296. [Google Scholar] [CrossRef] [PubMed]
- Luesley, D.; Blackledge, G.; Kelly, K.; Wade-Evans, T.; Fielding, J.; Lawton, F.; Hilton, C.; Rollason, T.; Jordan, J.; Latief, T.; et al. Failure of second-look laparotomy to influence survival in epithelial ovarian cancer. Lancet 1988, 332, 599–603. [Google Scholar] [CrossRef]
- Cho, K.R.; Shih, I.-M. Ovarian Cancer. Annu. Rev. Pathol. 2009, 4, 287–313. [Google Scholar] [CrossRef] [PubMed]
- Jacob, R.E.; Murphy, M.K.; Creim, J.A.; Carson, J.P. Detecting Radiation-Induced Injury Using Rapid 3D Variogram Analysis of CT Images of Rat Lungs. Acad. Radiol. 2013, 20, 1264–1271. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, R.; Kaye, S.B. Ovarian Cancer: Strategies for Overcoming Resistance to Chemotherapy. Nat. Rev. Cancer 2003, 3, 502–516. [Google Scholar] [CrossRef]
- Yap, T.A.; Carden, C.P.; Kaye, S.B. Beyond Chemotherapy: Targeted Therapies in Ovarian Cancer. Nat. Rev. Cancer 2009, 9, 167–181. [Google Scholar] [CrossRef]
- Gimba, C.E.; Abechi, S.E.; Elizabeth, O. Investigations of Sodium Lauryl Sulphate and Saccharin Concentrations in Brands of Toothpaste. Res. J. Chem. Sci. 2014, 4, 58–61. [Google Scholar]
- Weihrauch, M.R.; Diehl, V. Artificial Sweeteners—Do They Bear a Carcinogenic Risk? Ann. Oncol. 2004, 15, 1460–1465. [Google Scholar] [CrossRef]
- Scozzafava, A.; Mastrolorenzo, A.; Supuran, C.T. Carbonic Anhydrase Inhibitors and Activators and Their Use in Therapy. Expert Opin. Ther. Pat. 2006, 16, 1627–1664. [Google Scholar] [CrossRef]
- Liu, H.; Zhou, Y.; Tang, L. Caffeine Induces Sustained Apoptosis of Human Gastric Cancer Cells by Activating the Caspase-9/Caspase-3 Signalling Pathway. Mol. Med. Rep. 2017, 16, 2445–2454. [Google Scholar] [CrossRef]
- Barone, J.J.; Roberts, H.R. Caffeine Consumption. Food Chem. Toxicol. 1996, 34, 119–129. [Google Scholar] [CrossRef] [PubMed]
- Khalil, H.; Tummala, H.; Chakarov, S.; Zhelev, N.; Lane, D. Targeting ATM Pathway for Therapeutic Intervention in Cancer. Biodiscovery 2012, 1, e8920. [Google Scholar] [CrossRef]
- Ward, S.; Sotsios, Y.; Dowden, J.; Bruce, I.; Finan, P. Therapeutic Potential of Phosphoinositide 3-Kinase Inhibitors. Chem. Biol. 2003, 10, 207–213. [Google Scholar] [CrossRef]
- Lu, P.-Z.; Lai, C.-Y.; Chan, W.-H. Caffeine Induces Cell Death via Activation of Apoptotic Signal and Inactivation of Survival Signal in Human Osteoblasts. Int. J. Mol. Sci. 2008, 9, 698–718. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; Ma, W.Y.; Hashimoto, T.; Bode, A.M.; Yang, C.S.; Dong, Z. Induction of Apoptosis by Caffeine Is Mediated by the P53, Bax, and Caspase 3 Pathways. Cancer Res. 2003, 63, 4396–4401. [Google Scholar]
- Katiyar, S.K.; Roy, A.M.; Baliga, M.S. Silymarin Induces Apoptosis Primarily through a P53-Dependent Pathway Involving Bcl-2/Bax, Cytochrome c Release, and Caspase Activation. Mol. Cancer Ther. 2005, 4, 207–216. [Google Scholar] [CrossRef]
- Vousden, K.H.; Lane, D.P. P53 in Health and Disease. Nat. Rev. Mol. Cell Biol. 2007, 8, 275–283. [Google Scholar] [CrossRef]
- Kuwana, T.; Mackey, M.R.; Perkins, G.; Ellisman, M.H.; Latterich, M.; Schneiter, R.; Green, D.R.; Newmeyer, D.D. Bid, Bax, and Lipids Cooperate to Form Supramolecular Openings in the Outer Mitochondrial Membrane. Cell 2002, 111, 331–342. [Google Scholar] [CrossRef]
- Kim, H.-E.; Du, F.; Fang, M.; Wang, X. Formation of Apoptosome Is Initiated by Cytochrome c -Induced DATP Hydrolysis and Subsequent Nucleotide Exchange on Apaf-1. Proc. Natl. Acad. Sci. USA 2005, 102, 17545–17550. [Google Scholar] [CrossRef]
- Köhler, K.; Hillebrecht, A.; Schulze Wischeler, J.; Innocenti, A.; Heine, A.; Supuran, C.T.; Klebe, G. Saccharin Inhibits Carbonic Anhydrases: Possible Explanation for Its Unpleasant Metallic Aftertaste. Angew. Chem. Int. Ed. 2007, 46, 7697–7699. [Google Scholar] [CrossRef]
- D’Ascenzio, M.; Guglielmi, P.; Carradori, S.; Secci, D.; Florio, R.; Mollica, A.; Ceruso, M.; Akdemir, A.; Sobolev, A.P.; Supuran, C.T. Open Saccharin-Based Secondary Sulfonamides as Potent and Selective Inhibitors of Cancer-Related Carbonic Anhydrase IX and XII Isoforms. J. Enzym. Inhib. Med. Chem. 2017, 32, 51–59. [Google Scholar] [CrossRef] [PubMed]
- Caneba, C.A.; Yang, L.; Baddour, J.; Curtis, R.; Win, J.; Hartig, S.; Marini, J.; Nagrath, D. Nitric Oxide Is a Positive Regulator of the Warburg Effect in Ovarian Cancer Cells. Cell Death Dis. 2014, 5, e1302. [Google Scholar] [CrossRef] [PubMed]
- Švastová, E.; Hulíková, A.; Rafajová, M.; Zat’ovičová, M.; Gibadulinová, A.; Casini, A.; Cecchi, A.; Scozzafava, A.; Supuran, C.T.; Pastorek, J.; et al. Hypoxia Activates the Capacity of Tumor-Associated Carbonic Anhydrase IX to Acidify Extracellular PH. FEBS Lett. 2004, 577, 439–445. [Google Scholar] [CrossRef] [PubMed]
- Bui, M.H.T.; Seligson, D.; Han, K.R.; Pantuck, A.J.; Dorey, F.J.; Huang, Y.; Horvath, S.; Leibovich, B.C.; Chopra, S.; Liao, S.Y.; et al. Carbonic Anhydrase IX Is an Independent Predictor of Survival in Advanced Renal Clear Cell Carcinoma: Implications for Prognosis and Therapy. Clin. Cancer Res. 2003, 9, 802–811. [Google Scholar] [PubMed]
- Thiry, A.; Dogné, J.-M.; Masereel, B.; Supuran, C.T. Targeting Tumor-Associated Carbonic Anhydrase IX in Cancer Therapy. Trends Pharmacol. Sci. 2006, 27, 566–573. [Google Scholar] [CrossRef]
- Sergeeva, T.F.; Shirmanova, M.V.; Zlobovskaya, O.A.; Gavrina, A.I.; Dudenkova, V.V.; Lukina, M.M.; Lukyanov, K.A.; Zagaynova, E.V. Relationship between Intracellular PH, Metabolic Co-Factors and Caspase-3 Activation in Cancer Cells during Apoptosis. Biochim. Et Biophys. Acta (BBA)-Mol. Cell Res. 2017, 1864, 604–611. [Google Scholar] [CrossRef]
- Abarikwu, S.O.; Pant, A.B.; Farombi, E.O. 4-Hydroxynonenal Induces Mitochondrial-Mediated Apoptosis and Oxidative Stress in SH-SY5Y Human Neuronal Cells. Basic Clin. Pharmacol. Toxicol. 2012, 110, 441–448. [Google Scholar] [CrossRef]
- Beierle, E.A.; Dai, W.; Iyengar, R.; Langham, M.R.; Copeland, E.M.; Chen, M.K. Differential Expression of Bcl-2 and Bax May Enhance Neuroblastoma Survival. J. Pediatr. Surg. 2003, 38, 486–491. [Google Scholar] [CrossRef]
- Hormozi, M.; Salehi Marzijerani, A.; Baharvand, P. Effects of Hydroxytyrosol on Expression of Apoptotic Genes and Activity of Antioxidant Enzymes in LS180 Cells. Cancer Manag. Res. 2020, 12, 7913–7919. [Google Scholar] [CrossRef]






| Gene | Forward Primer Sequence, 5′-3′ | Reverse Primer Sequence, 5′-3′ | References |
|---|---|---|---|
| GAPDH | CATGACCACATCCATGCCATCACT | TGAGGTCCACCACCCTGTGCTGTA | [27] |
| P53 | GAAGACCCAGGTCCAGATGA | CTCCGTCATGTGCTGTGACT | [27] |
| BAX | ACCAAGAAGCTGAGCGAGTGTC | ACAAAGATGGTCACGGTCTGCC | [28] |
| Bcl-2 | TCGCCCTGTGGATGACTGA | CAGAGACAGCCAGGAGAAATCA | [29] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, S.J.; Park, S.-Y.; Bak, S.; Lee, M.-W.; Lim, D.J.; Kim, H.-D.; Kim, D.-G.; Kim, S.W. Synergistic Effect of Saccharin and Caffeine on Antiproliferative Activity in Human Ovarian Carcinoma Ovcar-3 Cells. Int. J. Mol. Sci. 2023, 24, 14445. https://doi.org/10.3390/ijms241914445
Lee SJ, Park S-Y, Bak S, Lee M-W, Lim DJ, Kim H-D, Kim D-G, Kim SW. Synergistic Effect of Saccharin and Caffeine on Antiproliferative Activity in Human Ovarian Carcinoma Ovcar-3 Cells. International Journal of Molecular Sciences. 2023; 24(19):14445. https://doi.org/10.3390/ijms241914445
Chicago/Turabian StyleLee, Sun Ju, Sang-Yong Park, Subin Bak, Min-Woo Lee, Dae Jin Lim, Hyeong-Dong Kim, Dong-Gil Kim, and Suhng Wook Kim. 2023. "Synergistic Effect of Saccharin and Caffeine on Antiproliferative Activity in Human Ovarian Carcinoma Ovcar-3 Cells" International Journal of Molecular Sciences 24, no. 19: 14445. https://doi.org/10.3390/ijms241914445
APA StyleLee, S. J., Park, S.-Y., Bak, S., Lee, M.-W., Lim, D. J., Kim, H.-D., Kim, D.-G., & Kim, S. W. (2023). Synergistic Effect of Saccharin and Caffeine on Antiproliferative Activity in Human Ovarian Carcinoma Ovcar-3 Cells. International Journal of Molecular Sciences, 24(19), 14445. https://doi.org/10.3390/ijms241914445

