Efficient Biosynthesis of Acidic/Lactonic Sophorolipids and Their Application in the Remediation of Cyanobacterial Harmful Algal Blooms
Abstract
:1. Introduction
2. Results and Discussion
2.1. Recombinant Strains Construction for Acidic and Lactonic SLs Production
2.2. Fermentation of AciSb and LacSb Strains
2.3. Fermentation of AciSb Strain in Fermenter
2.4. Study on the Degradation of Lactonic and Acidic SLs on Cyanobacteria
2.5. Determination of Optimal Ratio of Lactonic/Acidic SLs for Cyanobacteria Degradation
3. Materials and Methods
3.1. Recombinant Strain Construction
3.2. Cultivation and Fermentation
3.3. Determination of SLs
3.4. Purification of SLs
3.5. Study of Cyanobacteria Degradation
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- O’Neil, J.M.; Davis, T.W.; Burford, M.A.; Gobler, C.J. The rise of harmful cyanobacteria blooms: The potential roles of eutrophication and climate change. Harmful Algae 2012, 14, 313–334. [Google Scholar] [CrossRef]
- Wang, K.; Mou, X.; Cao, H.; Struewing, I.; Allen, J.; Lu, J. Co-occurring microorganisms regulate the succession of cyanobacterial harmful algal blooms. Environ. Pollut. 2021, 288, 117682. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Mou, X. Coordinated diel gene expression of cyanobacteria and their microbiome. Microorganisms 2021, 9, 1670. [Google Scholar] [CrossRef]
- Steffen, M.M.; Belisle, B.S.; Watson, S.B.; Boyer, G.L.; Bourbonniere, R.A.; Wilhelm, S.W. Metatranscriptomic evidence for co-occurring top-down and bottom-up controls on toxic cyanobacterial communities. Appl. Environ. Microbiol. 2015, 81, 3268–3276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Havens, K.; Fukushima, T.; Xie, P.; Iwakuma, T.; James, R.; Takamura, N.; Hanazato, T.; Yamamoto, T. Nutrient dynamics and the eutrophication of shallow lakes Kasumigaura (Japan), Donghu (PR China), and Okeechobee (USA). Environ. Pollut. 2001, 111, 263–272. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Paerl, H.W.; Qin, B.; Zhu, G.; Hall, N.S.; Wu, Y. Determining Critical Nutrient Thresholds Needed to Control Harmful Cyanobacterial Blooms in Eutrophic Lake Taihu, China. Environ. Sci. Technol. 2015, 49, 1051–1059. [Google Scholar] [CrossRef]
- Conley, D.J.; Bonsdorff, E.; Carstensen, J.; Destouni, G.; Gustafsson, B.G.; Hansson, L.-A.; Rabalais, N.N.; Voss, M.; Zillén, L. Tackling hypoxia in the Baltic Sea: Is engineering a solution? Environ. Sci. Technol. 2009, 43, 3407–3411. [Google Scholar] [CrossRef] [Green Version]
- Dodds, W.K.; Bouska, W.W.; Eitzmann, J.L.; Pilger, T.J.; Pitts, K.L.; Riley, A.J.; Schloesser, J.T.; Thornbrugh, D.J. Eutrophication of US freshwaters: Analysis of potential economic damages. Environ. Sci. Technol. 2009, 43, 12–19. [Google Scholar] [CrossRef] [Green Version]
- Qin, B.; Zhu, G.; Gao, G.; Zhang, Y.; Li, W.; Paerl, H.W.; Carmichael, W.W. A drinking water crisis in Lake Taihu, China: Linkage to climatic variability and lake management. Environ. Manag. 2010, 45, 105–112. [Google Scholar] [CrossRef]
- Baek, S.-H.; Sun, X.-X.; Lee, Y.-J.; Wang, S.-Y.; Han, K.-N.; Choi, J.-K.; Noh, J.-H.; Kim, E.-K. Mitigation of harmful algal blooms by sophorolipid. J. Microbiol. Biotechnol. 2003, 13, 651–659. [Google Scholar]
- Kim, J.-D.; Kim, B.; Lee, C.-G. Alga-lytic activity of Pseudomonas fluorescens against the red tide causing marine alga Heterosigma akashiwo (Raphidophyceae). Biol. Control 2007, 41, 296–303. [Google Scholar] [CrossRef]
- Liu, M.; Zhang, Y.; Yuan, Z.; Lu, L.; Liu, X.; Zhu, X.; Wang, L.; Liu, C.; Rao, Y. Cercosporin-bioinspired photoinactivation of harmful cyanobacteria under natural sunlight via bifunctional mechanisms. Water Res. 2022, 215, 118242. [Google Scholar] [CrossRef]
- Sun, X.-X.; Lee, Y.-J.; Choi, J.-K.; Kim, E.-K. Synergistic effect of sophorolipid and loess combination in harmful algal blooms mitigation. Mar. Pollut. Bull. 2004, 48, 863–872. [Google Scholar] [CrossRef]
- Sun, X.-X.; Choi, J.-K.; Kim, E.-K. A preliminary study on the mechanism of harmful algal bloom mitigation by use of sophorolipid treatment. J. Exp. Mar. Biol. Ecol. 2004, 304, 35–49. [Google Scholar] [CrossRef]
- Shah, V.; Doncel, G.F.; Seyoum, T.; Eaton, K.M.; Zalenskaya, I.; Hagver, R.; Azim, A.; Gross, R. Sophorolipids, microbial glycolipids with anti-human immunodeficiency virus and sperm-immobilizing activities. Antimicrob. Agents Chemother. 2005, 49, 4093–4100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, Y.-J.; Choi, J.-K.; Kim, E.-K.; Youn, S.-H.; Yang, E.-J. Field experiments on mitigation of harmful algal blooms using a Sophorolipid—Yellow clay mixture and effects on marine plankton. Harmful Algae 2008, 7, 154–162. [Google Scholar] [CrossRef]
- Li, Y.; Chen, Y.; Tian, X.; Chu, J. Advances in sophorolipid-producing strain performance improvement and fermentation optimization technology. Appl. Microbiol. Biotechnol. 2020, 104, 10325–10337. [Google Scholar] [CrossRef] [PubMed]
- Dierickx, S.; Castelein, M.; Remmery, J.; De Clercq, V.; Lodens, S.; Baccile, N.; De Maeseneire, S.L.; Roelants, S.L.; Soetaert, W.K. From bumblebee to bioeconomy: Recent developments and perspectives for sophorolipid biosynthesis. Biotechnol. Adv. 2021, 54, 107788. [Google Scholar] [CrossRef]
- Pal, S.; Chatterjee, N.; Das, A.K.; McClements, D.J.; Dhar, P. Sophorolipids: A comprehensive review on properties and applications. Adv. Colloid. Interface Sci. 2023, 313, 102856. [Google Scholar] [CrossRef]
- Wang, H.; Roelants, S.L.; To, M.H.; Patria, R.D.; Kaur, G.; Lau, N.S.; Lau, C.Y.; Van Bogaert, I.N.; Soetaert, W.; Lin, C.S. Starmerella bombicola: Recent advances on sophorolipid production and prospects of waste stream utilization. J. Chem. Technol. Biotechnol. 2019, 94, 999–1007. [Google Scholar] [CrossRef]
- Qazi, M.A.; Wang, Q.; Dai, Z. Sophorolipids bioproduction in the yeast Starmerella bombicola: Current trends and perspectives. Bioresour. Technol. 2022, 346, 126593. [Google Scholar] [CrossRef] [PubMed]
- Shao, L.; Song, X.; Ma, X.; Li, H.; Qu, Y. Bioactivities of sophorolipid with different structures against human esophageal cancer cells. J. Surg. Res. 2012, 173, 286–291. [Google Scholar] [CrossRef] [PubMed]
- Díaz De Rienzo, M.A.; Banat, I.M.; Dolman, B.; Winterburn, J.; Martin, P.J. Sophorolipid biosurfactants: Possible uses as antibacterial and antibiofilm agent. New Biotechnol 2015, 32, 720–726. [Google Scholar] [CrossRef] [PubMed]
- Pekin, G.; Vardar-Sukan, F.; Kosaric, N. Production of sophorolipids from Candida bombicola ATCC 22214 using Turkish corn oil and honey. Eng. Life Sci. 2005, 5, 357–362. [Google Scholar] [CrossRef]
- Zhang, M.; Shi, Y.; Zhang, L.; Zhu, S.; Yang, H.; Shen, W.; Xia, Y.; Chen, X. A CRISPR–Cas12a system for multi-gene editing (CCMGE) and metabolic pathway assembly in Starmerella bombicola. Syst. Microbiol. Biomanuf. 2022, 2, 665–675. [Google Scholar] [CrossRef]
- Shi, Y.; Zhang, L.; Zhang, M.; Chu, J.; Xia, Y.; Yang, H.; Liu, L.; Chen, X. A CRISPR-Cas9 System-Mediated Genetic Disruption and Multi-fragment Assembly in Starmerella bombicola. ACS Synth. Biol. 2022, 11, 1497–1509. [Google Scholar] [CrossRef]
- Ma, X.-j.; Li, H.; Shao, L.-j.; Shen, J.; Song, X. Effects of nitrogen sources on production and composition of sophorolipids by Wickerhamiella domercqiae var. sophorolipid CGMCC 1576. Appl. Microbiol. Biotechnol. 2011, 91, 1623–1632. [Google Scholar]
- Zhang, X.-W.; Fu, J.; Song, S.; Zhang, P.; Yang, X.-H.; Zhang, L.-R.; Luo, Y.; Liu, C.-H.; Zhu, H.-L. Interspecific competition between Microcystis aeruginosa and Anabaena flos-aquae from Taihu Lake, China. Z. Naturforsch. C J. Biosci. 2014, 69, 53–60. [Google Scholar] [CrossRef]
- Aminot, A.; Rey, F. Chlorophyll a: Determination by spectroscopic methods. ICES Tech. Mar. Environ. Sci. 2001, 30, 17. [Google Scholar]
- Wang, X.; Zhu, Y.; Hou, D.; Teng, F.; Cai, Z.; Tao, Y. Production of β-Cyclocitral and Its Precursor β-Carotene in Microcystis aeruginosa: Variation at Population and Single-Cell Levels. Toxins 2022, 14, 201. [Google Scholar] [CrossRef]
- Balaji-Prasath, B.; Wang, Y.; Su, Y.P.; Hamilton, D.P.; Lin, H.; Zheng, L.; Zhang, Y. Methods to control harmful algal blooms: A review. Environ. Chem. Lett. 2022, 20, 3133–3152. [Google Scholar] [CrossRef]
- Song, X.; Zhang, Y.; Yu, Z. An eco-environmental assessment of harmful algal bloom mitigation using modified clay. Harmful Algae 2021, 107, 102067. [Google Scholar] [CrossRef] [PubMed]
Name | Genotype | Reference |
---|---|---|
Wild type | S. bombicola ATCC 22214 | This study |
AciSb | S. bombicola ATCC 22214, ΔPXA1::PENO-CYP52M1-PTEF1-CPR-hph, ΔSBLE::PTEF1-UGTB1-Tgki | This study |
LacSb | S. bombicola ATCC 22214, ΔPXA1::PENO-CYP52M1-PTEF1-CPR-hph, PPGKI-SBLE-Tgki | This study |
Primers | Sequences | Restriction Sites |
---|---|---|
PTEF1-F | tcgtacaagtggcttacaaaacgcgtgtcctatggcttctgctttg | Mlu I |
PTEF1-R | actggtttctcgatggccatactagtttttcaaattaagttttttg | BamH I |
UGTB-F | caaaaaacttaatttgaaaaactagtatggccatcgagaaaccagt | |
UGTB-R | ctcgcatgtatgcacgtctacccgggtttgaaaaaatttatttctagacagttatatattaagaagctaattcactaa | |
SBLE-F | cgcgcggatcttccagagatgggcccattggaacctagcccataag | Apa I |
SBLE-R | gcacgcctgccgttcgacgagggcccaaacctactgctctgccgat | Apa I |
RSBL-F | cggggtacccctgagcacgtattccgcta | |
RSBL-R | cgacgcgttttgtaagccacttgtacgac |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xia, Y.; Shi, Y.; Chu, J.; Zhu, S.; Luo, X.; Shen, W.; Chen, X. Efficient Biosynthesis of Acidic/Lactonic Sophorolipids and Their Application in the Remediation of Cyanobacterial Harmful Algal Blooms. Int. J. Mol. Sci. 2023, 24, 12389. https://doi.org/10.3390/ijms241512389
Xia Y, Shi Y, Chu J, Zhu S, Luo X, Shen W, Chen X. Efficient Biosynthesis of Acidic/Lactonic Sophorolipids and Their Application in the Remediation of Cyanobacterial Harmful Algal Blooms. International Journal of Molecular Sciences. 2023; 24(15):12389. https://doi.org/10.3390/ijms241512389
Chicago/Turabian StyleXia, Yuanyuan, Yibo Shi, Jieyu Chu, Shiying Zhu, Xiaozhou Luo, Wei Shen, and Xianzhong Chen. 2023. "Efficient Biosynthesis of Acidic/Lactonic Sophorolipids and Their Application in the Remediation of Cyanobacterial Harmful Algal Blooms" International Journal of Molecular Sciences 24, no. 15: 12389. https://doi.org/10.3390/ijms241512389
APA StyleXia, Y., Shi, Y., Chu, J., Zhu, S., Luo, X., Shen, W., & Chen, X. (2023). Efficient Biosynthesis of Acidic/Lactonic Sophorolipids and Their Application in the Remediation of Cyanobacterial Harmful Algal Blooms. International Journal of Molecular Sciences, 24(15), 12389. https://doi.org/10.3390/ijms241512389