Intravitreal Administration of Retinal Organoids-Derived Exosomes Alleviates Photoreceptor Degeneration in Royal College of Surgeons Rats by Targeting the Mitogen-Activated Protein Kinase Pathway
Abstract
1. Introduction
2. Results
2.1. Generation of hiPSC-Derived ROs and Characterization of Exosomes in the hiPSC-Derived ROs-Conditioned Medium
2.2. Exo-ROs Alleviate Photoreceptor Cell Apoptosis and Preserve Visual Function in RCS Rats
2.3. Changes in the Gene Expression Profile of RCS Rats after Exo-ROs Treatment
2.4. Analysis of miRNA Expression in Exo-ROs
2.5. Exosomal miRNA from hiPSC-Derived ROs Inhibits MAPK Signaling in RCS Rats
2.6. Confirmation of the Effect of Exo-ROs in an Oxidative Stress Model of RPE Cells
3. Discussion and Conclusions
4. Materials and Methods
4.1. Animals
4.2. hiPSC Cultures
4.3. Differentiation into Three-Dimensional ROs and Conditioned Media Sample Collection
4.4. Isolation of Extracellular Vesicles
4.5. Characterization of Extracellular Vesicles
4.6. Intravitreal Injections
4.7. In Vivo Study Design and Treatment Schedules
4.8. Electroretinography
4.9. Optomotor Response Test
4.10. Primary Rat RPE Cell Culture
4.11. Immunohistochemistry
4.12. Terminal Deoxynucleotidyl Transferase dUTP Nick end Labeling (TUNEL) Assays
4.13. Quantitative Reverse Transcription-Polymerase Chain Reaction (PCR)
4.14. Western Blot Analysis
4.15. RNA Sequencing and Gene Ontology-Pathway Enrichment Analysis
4.16. Statistical Analysis
4.17. eTOC Summary
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Verbakel, S.K.; van Huet, R.A.C.; Boon, C.J.F.; den Hollander, A.I.; Collin, R.W.J.; Klaver, C.C.W.; Hoyng, C.B.; Roepman, R.; Klevering, B.J. Non-syndromic retinitis pigmentosa. Prog. Retin. Eye Res. 2018, 66, 157–186. [Google Scholar] [CrossRef] [PubMed]
- Hamel, C. Retinitis pigmentosa. Orphanet J. Rare Dis. 2006, 1, 40. [Google Scholar] [CrossRef] [PubMed]
- Tsang, S.H.; Gouras, P.; Yamashita, C.K.; Kjeldbye, H.; Fisher, J.; Farber, D.B.; Goff, S.P. Retinal degeneration in mice lacking the gamma subunit of the rod cgmp phosphodiesterase. Science 1996, 272, 1026–1029. [Google Scholar] [CrossRef] [PubMed]
- Choudhury, S.; Bhootada, Y.; Gorbatyuk, O.; Gorbatyuk, M. Caspase-7 ablation modulates upr, reprograms traf2-jnk apoptosis and protects t17m rhodopsin mice from severe retinal degeneration. Cell Death Dis. 2013, 4, e528. [Google Scholar] [CrossRef]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- Kunte, M.M.; Choudhury, S.; Manheim, J.F.; Shinde, V.M.; Miura, M.; Chiodo, V.A.; Hauswirth, W.W.; Gorbatyuk, O.S.; Gorbatyuk, M.S. Er stress is involved in t17m rhodopsin-induced retinal degeneration. Investig. Ophthalmol. Vis. Sci. 2012, 53, 3792–3800. [Google Scholar] [CrossRef]
- Domènech, E.B.; Marfany, G. The relevance of oxidative stress in the pathogenesis and therapy of retinal dystrophies. Antioxidants 2020, 9, 347. [Google Scholar] [CrossRef]
- Nakanishi, T.; Shimazawa, M.; Sugitani, S.; Kudo, T.; Imai, S.; Inokuchi, Y.; Tsuruma, K.; Hara, H. Role of endoplasmic reticulum stress in light-induced photoreceptor degeneration in mice. J. Neurochem. 2013, 125, 111–124. [Google Scholar] [CrossRef]
- Newton, F.; Megaw, R. Mechanisms of photoreceptor death in retinitis pigmentosa. Genes 2020, 11, 1120. [Google Scholar] [CrossRef]
- Hu, G.W.; Li, Q.; Niu, X.; Hu, B.; Liu, J.; Zhou, S.M.; Guo, S.C.; Lang, H.L.; Zhang, C.Q.; Wang, Y.; et al. Exosomes secreted by human-induced pluripotent stem cell-derived mesenchymal stem cells attenuate limb ischemia by promoting angiogenesis in mice. Stem Cell Res. Ther. 2015, 6, 10. [Google Scholar] [CrossRef]
- EL Andaloussi, S.; Mäger, I.; Breakefield, X.O.; Wood, M.J. Extracellular vesicles: Biology and emerging therapeutic opportunities. Nat. Rev. Drug Discov. 2013, 12, 347–357. [Google Scholar] [CrossRef]
- Zhang, B.; Yin, Y.; Lai, R.C.; Tan, S.S.; Choo, A.B.; Lim, S.K. Mesenchymal stem cells secrete immunologically active exosomes. Stem Cells Dev. 2014, 23, 1233–1244. [Google Scholar] [CrossRef]
- Vidal-Gil, L.; Sancho-Pelluz, J.; Zrenner, E.; Oltra, M.; Sahaboglu, A. Poly adp ribosylation and extracellular vesicle activity in rod photoreceptor degeneration. Sci. Rep. 2019, 9, 3758. [Google Scholar] [CrossRef]
- Barbato, S.; Marrocco, E.; Intartaglia, D.; Pizzo, M.; Asteriti, S.; Naso, F.; Falanga, D.; Bhat, R.S.; Meola, N.; Carissimo, A.; et al. Mir-211 is essential for adult cone photoreceptor maintenance and visual function. Sci. Rep. 2017, 7, 17004. [Google Scholar] [CrossRef]
- Ji, H.P.; Xiong, Y.; Song, W.T.; Zhang, E.D.; Gao, Z.L.; Yao, F.; Su, T.; Zhou, R.R.; Xia, X.B. Microrna-28 potentially regulates the photoreceptor lineage commitment of muller glia-derived progenitors. Sci. Rep. 2017, 7, 11374. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, Q.; Yang, G.; Wei, Y.; Li, M.; Du, E.; Li, H.; Song, Z.; Tao, Y. Rpe-derived exosomes rescue the photoreceptors during retina degeneration: An intraocular approach to deliver exosomes into the subretinal space. Drug Deliv. 2021, 28, 218–228. [Google Scholar] [CrossRef]
- Xiang, L.; Chen, X.J.; Wu, K.C.; Zhang, C.J.; Zhou, G.H.; Lv, J.N.; Sun, L.F.; Cheng, F.F.; Cai, X.B.; Jin, Z.B. Mir-183/96 plays a pivotal regulatory role in mouse photoreceptor maturation and maintenance. Proc. Natl. Acad. Sci. USA 2017, 114, 6376–6381. [Google Scholar] [CrossRef]
- Chu-Tan, J.A.; Rutar, M.; Saxena, K.; Aggio-Bruce, R.; Essex, R.W.; Valter, K.; Jiao, H.; Fernando, N.; Wooff, Y.; Madigan, M.C.; et al. Microrna-124 dysregulation is associated with retinal inflammation and photoreceptor death in the degenerating retina. Investig. Ophthalmol. Vis. Sci. 2018, 59, 4094–4105. [Google Scholar] [CrossRef] [PubMed]
- Loscher, C.J.; Hokamp, K.; Wilson, J.H.; Li, T.; Humphries, P.; Farrar, G.J.; Palfi, A. A common microrna signature in mouse models of retinal degeneration. Exp. Eye Res. 2008, 87, 529–534. [Google Scholar] [CrossRef] [PubMed]
- Deng, C.L.; Hu, C.B.; Ling, S.T.; Zhao, N.; Bao, L.H.; Zhou, F.; Xiong, Y.C.; Chen, T.; Sui, B.D.; Yu, X.R.; et al. Photoreceptor protection by mesenchymal stem cell transplantation identifies exosomal mir-21 as a therapeutic for retinal degeneration. Cell Death Differ. 2021, 28, 1041–1061. [Google Scholar] [CrossRef] [PubMed]
- Fujii, M.; Matano, M.; Toshimitsu, K.; Takano, A.; Mikami, Y.; Nishikori, S.; Sugimoto, S.; Sato, T. Human intestinal organoids maintain self-renewal capacity and cellular diversity in niche-inspired culture condition. Cell Stem Cell 2018, 23, 787–793.e6. [Google Scholar] [CrossRef]
- Huch, M.; Koo, B.K. Modeling mouse and human development using organoid cultures. Development 2015, 142, 3113–3125. [Google Scholar] [CrossRef]
- Lancaster, M.A.; Knoblich, J.A. Organogenesis in a dish: Modeling development and disease using organoid technologies. Science 2014, 345, 1247125. [Google Scholar] [CrossRef]
- Lancaster, M.A.; Renner, M.; Martin, C.A.; Wenzel, D.; Bicknell, L.S.; Hurles, M.E.; Homfray, T.; Penninger, J.M.; Jackson, A.P.; Knoblich, J.A. Cerebral organoids model human brain development and microcephaly. Nature 2013, 501, 373–379. [Google Scholar] [CrossRef]
- Rossi, G.; Manfrin, A.; Lutolf, M.P. Progress and potential in organoid research. Nat. Rev. Genet. 2018, 19, 671–687. [Google Scholar] [CrossRef]
- Cowan, C.S.; Renner, M.; De Gennaro, M.; Gross-Scherf, B.; Goldblum, D.; Hou, Y.; Munz, M.; Rodrigues, T.M.; Krol, J.; Szikra, T.; et al. Cell types of the human retina and its organoids at single-cell resolution. Cell 2020, 182, 1623–1640.e34. [Google Scholar] [CrossRef]
- Zhong, X.; Gutierrez, C.; Xue, T.; Hampton, C.; Vergara, M.N.; Cao, L.H.; Peters, A.; Park, T.S.; Zambidis, E.T.; Meyer, J.S.; et al. Generation of three-dimensional retinal tissue with functional photoreceptors from human ipscs. Nat. Commun. 2014, 5, 4047. [Google Scholar] [CrossRef]
- Fathi, M.; Ross, C.T.; Hosseinzadeh, Z. Functional 3-dimensional retinal organoids: Technological progress and existing challenges. Front. Neurosci. 2021, 15, 668857. [Google Scholar] [CrossRef]
- Zhou, J.; Flores-Bellver, M.; Pan, J.; Benito-Martin, A.; Shi, C.; Onwumere, O.; Mighty, J.; Qian, J.; Zhong, X.; Hogue, T.; et al. Human retinal organoids release extracellular vesicles that regulate gene expression in target human retinal progenitor cells. Sci. Rep. 2021, 11, 21128. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, Y.; Liu, H.; Tang, W.H. Exosomes: Biogenesis, biologic function and clinical potential. Cell Biosci. 2019, 9, 19. [Google Scholar]
- Kyosseva, S.V. Mitogen-activated protein kinase signaling. Int. Rev. Neurobiol. 2004, 59, 201–220. [Google Scholar] [PubMed]
- Arthur, J.S.; Ley, S.C. Mitogen-activated protein kinases in innate immunity. Nat. Rev. Immunol. 2013, 13, 679–692. [Google Scholar] [CrossRef] [PubMed]
- Yue, J.; López, J.M. Understanding mapk signaling pathways in apoptosis. Int. J. Mol. Sci. 2020, 21, 2346. [Google Scholar] [CrossRef] [PubMed]
- Roth, S.; Shaikh, A.R.; Hennelly, M.M.; Li, Q.; Bindokas, V.; Graham, C.E. Mitogen-activated protein kinases and retinal ischemia. Investig. Ophthalmol. Vis. Sci. 2003, 44, 5383–5395. [Google Scholar] [CrossRef]
- Alessandrini, A.; Namura, S.; Moskowitz, M.A.; Bonventre, J.V. Mek1 protein kinase inhibition protects against damage resulting from focal cerebral ischemia. Proc. Natl. Acad. Sci. USA 1999, 96, 12866–12869. [Google Scholar] [CrossRef]
- Yang, L.P.; Zhu, X.A.; Tso, M.O. Role of nf-kappab and mapks in light-induced photoreceptor apoptosis. Investig. Ophthalmol. Vis. Sci. 2007, 48, 4766–4776. [Google Scholar] [CrossRef]
- Lee, S.H.; Han, J.W.; Yang, J.Y.; Jun, H.O.; Bang, J.H.; Shin, H.; Choi, J.H.; Lee, J.; Madrakhimov, S.B.; Chung, K.H.; et al. Role of mtorc1 activity during early retinal development and lamination in human-induced pluripotent stem cell-derived retinal organoids. Cell Death Discov. 2022, 8, 56. [Google Scholar] [CrossRef]
- Huang, X.; Gao, H.; Xu, H. Editorial: Stem cell-based therapy in retinal degeneration. Front. Neurosci. 2022, 16, 879659. [Google Scholar] [CrossRef]
- Anthony, D.F.; Shiels, P.G. Exploiting paracrine mechanisms of tissue regeneration to repair damaged organs. Transplant. Res. 2013, 2, 10. [Google Scholar] [CrossRef]
- Bian, B.; Zhao, C.; He, X.; Gong, Y.; Ren, C.; Ge, L.; Zeng, Y.; Li, Q.; Chen, M.; Weng, C.; et al. Exosomes derived from neural progenitor cells preserve photoreceptors during retinal degeneration by inactivating microglia. J. Extracell. Vesicles 2020, 9, 1748931. [Google Scholar] [CrossRef]
- Hartman, R.R.; Kompella, U.B. Intravitreal, subretinal, and suprachoroidal injections: Evolution of microneedles for drug delivery. J. Ocul. Pharmacol. Ther. 2018, 34, 141–153. [Google Scholar] [CrossRef]
- Peng, Y.; Tang, L.; Zhou, Y. Subretinal injection: A review on the novel route of therapeutic delivery for vitreoretinal diseases. Ophthalmic Res. 2017, 58, 217–226. [Google Scholar] [CrossRef]
- Park, S.W.; Kim, J.H.; Park, W.J.; Kim, J.H. Limbal approach-subretinal injection of viral vectors for gene therapy in mice retinal pigment epithelium. J. Vis. Exp. 2015, 102, e53030. [Google Scholar] [CrossRef]
- Zhang, W.; Wang, Y.; Kong, Y. Exosomes derived from mesenchymal stem cells modulate mir-126 to ameliorate hyperglycemia-induced retinal inflammation via targeting hmgb1. Investig. Ophthalmol. Vis. Sci. 2019, 60, 294–303. [Google Scholar] [CrossRef]
- Jiang, Y.; Zhang, Y.; Zhang, L.; Wang, M.; Zhang, X.; Li, X. Therapeutic effect of bone marrow mesenchymal stem cells on laser-induced retinal injury in mice. Int. J. Mol. Sci. 2014, 15, 9372–9385. [Google Scholar] [CrossRef]
- Yu, B.; Shao, H.; Su, C.; Jiang, Y.; Chen, X.; Bai, L.; Zhang, Y.; Li, Q.; Zhang, X.; Li, X. Exosomes derived from mscs ameliorate retinal laser injury partially by inhibition of mcp-1. Sci. Rep. 2016, 6, 34562. [Google Scholar] [CrossRef]
- Lai, R.C.; Yeo, R.W.; Lim, S.K. Mesenchymal stem cell exosomes. Semin. Cell Dev. Biol. 2015, 40, 82–88. [Google Scholar] [CrossRef]
- Lai, R.C.; Yeo, R.W.; Tan, K.H.; Lim, S.K. Exosomes for drug delivery—A novel application for the mesenchymal stem cell. Biotechnol. Adv. 2013, 31, 543–551. [Google Scholar] [CrossRef]
- Atienzar-Aroca, S.; Flores-Bellver, M.; Serrano-Heras, G.; Martinez-Gil, N.; Barcia, J.M.; Aparicio, S.; Perez-Cremades, D.; Garcia-Verdugo, J.M.; Diaz-Llopis, M.; Romero, F.J.; et al. Oxidative stress in retinal pigment epithelium cells increases exosome secretion and promotes angiogenesis in endothelial cells. J. Cell. Mol. Med. 2016, 20, 1457–1466. [Google Scholar] [CrossRef]
- Hajrasouliha, A.R.; Jiang, G.; Lu, Q.; Lu, H.; Kaplan, H.J.; Zhang, H.G.; Shao, H. Exosomes from retinal astrocytes contain antiangiogenic components that inhibit laser-induced choroidal neovascularization. J. Biol. Chem. 2013, 288, 28058–28067. [Google Scholar] [CrossRef]
- Johnson, T.V.; Bull, N.D.; Hunt, D.P.; Marina, N.; Tomarev, S.I.; Martin, K.R. Neuroprotective effects of intravitreal mesenchymal stem cell transplantation in experimental glaucoma. Investig. Ophthalmol. Vis. Sci. 2010, 51, 2051–2059. [Google Scholar] [CrossRef] [PubMed]
- Mead, B.; Ahmed, Z.; Tomarev, S. Mesenchymal stem cell-derived small extracellular vesicles promote neuroprotection in a genetic dba/2j mouse model of glaucoma. Investig. Ophthalmol. Vis. Sci. 2018, 59, 5473–5480. [Google Scholar] [CrossRef]
- Mead, B.; Hill, L.J.; Blanch, R.J.; Ward, K.; Logan, A.; Berry, M.; Leadbeater, W.; Scheven, B.A. Mesenchymal stromal cell-mediated neuroprotection and functional preservation of retinal ganglion cells in a rodent model of glaucoma. Cytotherapy 2016, 18, 487–496. [Google Scholar] [CrossRef] [PubMed]
- Mead, B.; Tomarev, S. Bone marrow-derived mesenchymal stem cells-derived exosomes promote survival of retinal ganglion cells through mirna-dependent mechanisms. Stem Cells Transl. Med. 2017, 6, 1273–1285. [Google Scholar] [CrossRef] [PubMed]
- Su, W.; Li, Z.; Jia, Y.; Zhu, Y.; Cai, W.; Wan, P.; Zhang, Y.; Zheng, S.G.; Zhuo, Y. Microrna-21a-5p/pdcd4 axis regulates mesenchymal stem cell-induced neuroprotection in acute glaucoma. J. Mol. Cell Biol. 2017, 9, 289–301. [Google Scholar] [CrossRef]
- Safwat, A.; Sabry, D.; Ragiae, A.; Amer, E.; Mahmoud, R.H.; Shamardan, R.M. Adipose mesenchymal stem cells-derived exosomes attenuate retina degeneration of streptozotocin-induced diabetes in rabbits. J. Circ. Biomark. 2018, 7, 1849454418807827. [Google Scholar] [CrossRef]
- Klettner, A.; Roider, J. Constitutive and oxidative-stress-induced expression of vegf in the rpe are differently regulated by different mitogen-activated protein kinases. Graefes Arch. Clin. Exp. Ophthalmol. 2009, 247, 1487–1492. [Google Scholar] [CrossRef]
- McCubrey, J.A.; Lahair, M.M.; Franklin, R.A. Reactive oxygen species-induced activation of the map kinase signaling pathways. Antioxid. Redox Signal 2006, 8, 1775–1789. [Google Scholar] [CrossRef]
- Roduit, R.; Schorderet, D.F. Map kinase pathways in uv-induced apoptosis of retinal pigment epithelium arpe19 cells. Apoptosis 2008, 13, 343–353. [Google Scholar] [CrossRef]
- Du, H.; Sun, X.; Guma, M.; Luo, J.; Ouyang, H.; Zhang, X.; Zeng, J.; Quach, J.; Nguyen, D.H.; Shaw, P.X.; et al. Jnk inhibition reduces apoptosis and neovascularization in a murine model of age-related macular degeneration. Proc. Natl. Acad. Sci. USA 2013, 110, 2377–2382. [Google Scholar] [CrossRef]
- Joussen, A.M.; Wolf, S.; Kaiser, P.K.; Boyer, D.; Schmelter, T.; Sandbrink, R.; Zeitz, O.; Deeg, G.; Richter, A.; Zimmermann, T.; et al. The developing regorafenib eye drops for neovascular age-related macular degeneration (dream) study: An open-label phase ii trial. Br. J. Clin. Pharmacol. 2019, 85, 347–355. [Google Scholar] [CrossRef]
- Chapman, P.B.; Hauschild, A.; Robert, C.; Haanen, J.B.; Ascierto, P.; Larkin, J.; Dummer, R.; Garbe, C.; Testori, A.; Maio, M.; et al. Improved survival with vemurafenib in melanoma with braf v600e mutation. N. Engl. J. Med. 2011, 364, 2507–2516. [Google Scholar] [CrossRef]
- Hauschild, A.; Grob, J.J.; Demidov, L.V.; Jouary, T.; Gutzmer, R.; Millward, M.; Rutkowski, P.; Blank, C.U.; Miller, W.H., Jr.; Kaempgen, E.; et al. Dabrafenib in braf-mutated metastatic melanoma: A multicentre, open-label, phase 3 randomised controlled trial. Lancet 2012, 380, 358–365. [Google Scholar] [CrossRef]
- Infante, J.R.; Fecher, L.A.; Falchook, G.S.; Nallapareddy, S.; Gordon, M.S.; Becerra, C.; DeMarini, D.J.; Cox, D.S.; Xu, Y.; Morris, S.R.; et al. Safety, pharmacokinetic, pharmacodynamic, and efficacy data for the oral mek inhibitor trametinib: A phase 1 dose-escalation trial. Lancet Oncol. 2012, 13, 773–781. [Google Scholar] [CrossRef]
- Rajool Dezfuly, A.; Safaee, A.; Salehi, H. Therapeutic effects of mesenchymal stem cells-derived extracellular vesicles’ mirnas on retinal regeneration: A review. Stem Cell Res. Ther. 2021, 12, 530. [Google Scholar] [CrossRef]
- Li, Z.; Zhu, J.; Kuang, G.; Chen, J.; Lu, X. Protective effects on retinal ganglion cells by mir-133 via mapk/erk2 signaling pathway in the n-methyl-d-aspartate-induced apoptosis model. Nanosci. Nanotechnol. Lett. 2018, 10, 1726–1731. [Google Scholar] [CrossRef]
- Zhang, G.; Cui, Z.; Li, J.; Zhang, D.; Li, Z.; Lin, Z.; Yin, H.; Ran, J.; Wang, Y.; Liu, Y. Mir-122-5p regulates proliferation and apoptosis of chicken granulosa cells of hierarchal follicles by targeting mapk3. Gene 2022, 824, 146397. [Google Scholar] [CrossRef]
- Liu, X.; Dong, C.; Ma, S.; Wang, Y.; Lin, T.; Li, Y.; Yang, S.; Zhang, W.; Zhang, R.; Zhao, G. Nanocomplexes loaded with mir-128-3p for enhancing chemotherapy effect of colorectal cancer through dual-targeting silence the activity of pi3k/akt and mek/erk pathway. Drug Deliv. 2020, 27, 323–333. [Google Scholar] [CrossRef]
- Vestad, B.; Llorente, A.; Neurauter, A.; Phuyal, S.; Kierulf, B.; Kierulf, P.; Skotland, T.; Sandvig, K.; Haug, K.B.F.; Ovstebo, R. Size and concentration analyses of extracellular vesicles by nanoparticle tracking analysis: A variation study. J. Extracell. Vesicles 2017, 6, 1344087. [Google Scholar] [CrossRef]
- Jung, M.K.; Mun, J.Y. Sample preparation and imaging of exosomes by transmission electron microscopy. J. Vis. Exp. 2018, 131, e56482. [Google Scholar] [CrossRef]
- Andreu, Z.; Yanez-Mo, M. Tetraspanins in extracellular vesicle formation and function. Front. Immunol. 2014, 5, 442. [Google Scholar] [CrossRef] [PubMed]
- Putri, G.H.; Anders, S.; Pyl, P.T.; Pimanda, J.E.; Zanini, F. Analysing high-throughput sequencing data in python with htseq 2.0. Bioinformatics 2022, 38, 2943–2945. [Google Scholar] [CrossRef] [PubMed]
- Quinlan, A.R.; Hall, I.M. Bedtools: A flexible suite of utilities for comparing genomic features. Bioinformatics 2010, 26, 841–842. [Google Scholar] [CrossRef] [PubMed]
- Gentleman, R.C.; Carey, V.J.; Bates, D.M.; Bolstad, B.; Dettling, M.; Dudoit, S.; Ellis, B.; Gautier, L.; Ge, Y.; Gentry, J.; et al. Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 2004, 5, R80. [Google Scholar] [CrossRef]
- Bindea, G.; Mlecnik, B.; Hackl, H.; Charoentong, P.; Tosolini, M.; Kirilovsky, A.; Fridman, W.H.; Pagès, F.; Trajanoski, Z.; Galon, J. Cluego: A cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics 2009, 25, 1091–1093. [Google Scholar] [CrossRef]
Gene | Forward 5′-3′ | Reverse 5′-3′ |
---|---|---|
MAPK2K4 | AGAGACTGAGAACCCACAGCAT | CTACTCCGCATCACTACATCCA |
MAPK1 | TGTTGCAGATCCAGACCATG | CAGCCCACAGACCAAATATCA |
MAPK8 | ATTTGGAGGAGCGAACTAAG | CTGCTGTCTGTATCCGAGGC |
MAPK10 | TCGAGACCGTTTCAGTCCAT | CCACGGACCAAATATCCACT |
c-FOS | GTCCGTCTCTAGTGCCAACTTTAT | GTCTTCACCACTCCCGCTCT |
c-Jun | TCCCCCATCGACATGGAGTCTC | CCAGTCCATCTTGTGTACCCTTG |
GAPDH | CTGAGTATGTCGTGGAGTCTA | CTGCTTCACCACCTTCTTGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, J.W.; Chang, H.S.; Yang, J.Y.; Choi, H.S.; Park, H.S.; Jun, H.O.; Choi, J.H.; Paik, S.-S.; Chung, K.H.; Shin, H.J.; et al. Intravitreal Administration of Retinal Organoids-Derived Exosomes Alleviates Photoreceptor Degeneration in Royal College of Surgeons Rats by Targeting the Mitogen-Activated Protein Kinase Pathway. Int. J. Mol. Sci. 2023, 24, 12068. https://doi.org/10.3390/ijms241512068
Han JW, Chang HS, Yang JY, Choi HS, Park HS, Jun HO, Choi JH, Paik S-S, Chung KH, Shin HJ, et al. Intravitreal Administration of Retinal Organoids-Derived Exosomes Alleviates Photoreceptor Degeneration in Royal College of Surgeons Rats by Targeting the Mitogen-Activated Protein Kinase Pathway. International Journal of Molecular Sciences. 2023; 24(15):12068. https://doi.org/10.3390/ijms241512068
Chicago/Turabian StyleHan, Jung Woo, Hun Soo Chang, Jin Young Yang, Han Sol Choi, Hyo Song Park, Hyoung Oh Jun, Ji Hye Choi, Sun-Sook Paik, Kyung Hwun Chung, Hee Jeong Shin, and et al. 2023. "Intravitreal Administration of Retinal Organoids-Derived Exosomes Alleviates Photoreceptor Degeneration in Royal College of Surgeons Rats by Targeting the Mitogen-Activated Protein Kinase Pathway" International Journal of Molecular Sciences 24, no. 15: 12068. https://doi.org/10.3390/ijms241512068
APA StyleHan, J. W., Chang, H. S., Yang, J. Y., Choi, H. S., Park, H. S., Jun, H. O., Choi, J. H., Paik, S.-S., Chung, K. H., Shin, H. J., Nam, S., Son, J.-H., Lee, S. H., Lee, E. J., Seo, K. Y., Lyu, J., Kim, J. W., Kim, I.-B., & Park, T. K. (2023). Intravitreal Administration of Retinal Organoids-Derived Exosomes Alleviates Photoreceptor Degeneration in Royal College of Surgeons Rats by Targeting the Mitogen-Activated Protein Kinase Pathway. International Journal of Molecular Sciences, 24(15), 12068. https://doi.org/10.3390/ijms241512068