Transcriptome-Wide Identification and Response Pattern Analysis of the Salix integra NAC Transcription Factor in Response to Pb Stress
Abstract
1. Introduction
2. Results
2.1. Identification of Pb Response SiNAC Transcription Factors
2.2. Classification and Naming of SiNACs
2.3. Transcript Structure Analysis of SiNACs and Domain and Motif Prediction of SiNACs
2.4. Temporal Expression Profile and STEM Analysis of SiNACs under Pb Stress
2.5. Protein Sequence Analysis and Structure Prediction of 7 Candidate SiNACs
2.6. Functional Enrichment Analysis of Associated Genes of 7 Candidate SiNACs
2.7. Subcellular Localization of SiNAC004 and SiNAC120
2.8. Expression Verification of Seven Candidate SiNACs under Pb Stress
3. Discussion
3.1. The Number and Characteristics of Pb Response SiNAC Transcripts
3.2. Motif and Pb Response Characteristics of SiNAC of the ATAF and NAP Subfamilies
3.3. Target Pathway Prediction Analysis of 7 Candidate SiNACs
4. Materials and Methods
4.1. Identification and Characterization of SiNAC Transcription Factors
4.2. Phylogenetic Tree Construction
4.3. Transcript Structure Analysis and Domain and Motif Prediction
4.4. Temporal Expression Profile and STEM Analysis of SiNACs under Pb Stress
4.5. Subcellular Localization and Expression Verification of Candidate SiNACs under Pb Stress
4.5.1. Plant Culture and Pb Treatment
4.5.2. Subcellular Localization of SiNAC004 and SiNAC120
4.5.3. Real-Time Quantitative PCR (RT-qPCR)
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Olsen, A.N.; Ernst, H.A.; Leggio, L.L.; Skriver, K. NAC transcription factors: Structurally distinct, functionally diverse. Trends Plant Sci. 2005, 10, 79–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ooka, H.; Satoh, K.; Doi, K.; Nagata, T.; Otomo, Y.; Murakami, K.; Matsubara, K.; Osato, N.; Kawai, J.; Carninci, P.; et al. Comprehensive Analysis of NAC Family Genes in Oryza sativa and Arabidopsis thaliana. DNA Res. 2003, 10, 239–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Q.; Wang, Q.; Xiong, L.; Lou, Z. A structural view of the conserved domain of rice stress-responsive NAC1. Protein Cell 2011, 2, 55–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Souer, E.; van Houwelingen, A.; Kloos, D.; Mol, J.; Koes, R. The No Apical Meristem Gene of Petunia Is Required for Pattern Formation in Embryos and Flowers and Is Expressed at Meristem and Primordia Boundaries. Cell 1996, 85, 159–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, X.J.; Mu, R.L.; Cao, W.H.; Zhang, Z.G.; Zhang, J.S.; Chen, S.Y. AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development. Plant J. 2005, 44, 903–916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, H.S.; Xie, Q.; Fei, J.F.; Chua, N.H. MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for arabidopsis lateral root development. Plant Cell 2005, 17, 1376–1386. [Google Scholar] [CrossRef] [Scilit]
- Yoo, S.Y.; Kim, Y.; Kim, S.Y.; Lee, J.S.; Ahn, J.H. Control of flowering time and cold response by a NAC-domain protein in Arabidopsis. PLoS ONE 2007, 2, e642. [Google Scholar] [CrossRef] [Scilit]
- Balazadeh, S.; Siddiqui, H.; Allu, A.D.; Matallana-Ramirez, L.P.; Caldana, C.; Mehrnia, M.; Zanor, M.I.; Kohler, B.; Mueller-Roeber, B. A gene regulatory network controlled by the NAC transcription factor ANAC092/AtNAC2/ORE1 during salt-promoted senescence. Plant J. 2010, 62, 250–264. [Google Scholar] [CrossRef] [Scilit]
- Balazadeh, S.; Kwasniewski, M.; Caldana, C.; Mehrnia, M.; Zanor, M.I.; Xue, G.P.; Mueller-Roeber, B. ORS1, an H(2)O(2)-responsive NAC transcription factor, controls senescence in Arabidopsis thaliana. Mol. Plant 2011, 4, 346–360. [Google Scholar] [CrossRef] [Scilit]
- Tran, L.S.; Nakashima, K.; Sakuma, Y.; Simpson, S.D.; Fujita, Y.; Maruyama, K.; Fujita, M.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 2004, 16, 2481–2498. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Deng, Z.; Lai, J.; Zhang, Y.; Yang, C.; Yin, B.; Zhao, Q.; Zhang, L.; Li, Y.; Yang, C.; et al. Dual function of Arabidopsis ATAF1 in abiotic and biotic stress responses. Cell Res. 2009, 19, 1279–1290. [Google Scholar] [CrossRef] [Scilit]
- Takasaki, H.; Maruyama, K.; Kidokoro, S.; Ito, Y.; Fujita, Y.; Shinozaki, K.; Yamaguchi-Shinozaki, K.; Nakashima, K. The abiotic stress-responsive NAC-type transcription factor OsNAC5 regulates stress-inducible genes and stress tolerance in rice. Mol. Genet. Genom. 2010, 284, 173–183. [Google Scholar] [CrossRef] [Scilit]
- Fujita, M.; Fujita, Y.; Maruyama, K.; Seki, M.; Hiratsu, K.; Ohme-Takagi, M.; Tran, L.S.; Yamaguchi-Shinozaki, K.; Shinozaki, K. A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 2004, 39, 863–876. [Google Scholar] [CrossRef] [Scilit]
- Meng, Y.T.; Zhang, X.L.; Wu, Q.; Shen, R.F.; Zhu, X.F. Transcription factor ANAC004 enhances Cd tolerance in Arabidopsis thaliana by regulating cell wall fixation, translocation and vacuolar detoxification of Cd, ABA accumulation and antioxidant capacity. J. Hazard. Mater. 2022, 436, 129121. [Google Scholar] [CrossRef] [Scilit]
- Tao, Y.; Wan, J.X.; Liu, Y.S.; Yang, X.Z.; Shen, R.F.; Zhu, X.F. The NAC transcription factor ANAC017 regulates aluminum tolerance by regulating the cell wall-modifying genes. Plant Physiol. 2022, 189, 2517–2534. [Google Scholar] [CrossRef] [Scilit]
- Hu, S.; Shinwari, K.I.; Song, Y.; Xia, J.; Xu, H.; Du, B.; Luo, L.; Zheng, L. OsNAC300 Positively Regulates Cadmium Stress Responses and Tolerance in Rice Roots. Agronomy 2021, 11, 95. [Google Scholar] [CrossRef] [Scilit]
- Du, X.; He, F.; Zhu, B.; Ren, M.; Tang, H. NAC transcription factors from Aegilops markgrafii reduce cadmium concentration in transgenic wheat. Plant Soil 2020, 449, 39–50. [Google Scholar] [CrossRef] [Scilit]
- Yang, W.; Wang, Y.; Liu, D.; Hussain, B.; Ding, Z.; Zhao, F.; Yang, X. Interactions between cadmium and zinc in uptake, accumulation and bioavailability for Salix integra with respect to phytoremediation. Int. J. Phytoremediat. 2020, 22, 628–637. [Google Scholar] [CrossRef] [Scilit]
- Cao, Y.; Ma, C.; Chen, H.; Chen, G.; White, J.C.; Xing, B. Copper stress in flooded soil: Impact on enzyme activities, microbial community composition and diversity in the rhizosphere of Salix integra. Sci. Total Environ. 2020, 704, 135350. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Shi, X.; Sun, H.; Chen, Y.; Pan, H.; Yang, X.; Rafiq, T. Variations in metal tolerance and accumulation in three hydroponically cultivated varieties of Salix integra treated with lead. PLoS ONE 2014, 9, e108568. [Google Scholar] [CrossRef] [Scilit]
- Xin, Y.; Rong, H.; Han, X.; Xu, M.; Xu, L.-A. Full-length transcriptome sequencing of the short-rotation woody crop Salix integra reveals a time series response to Pb stress. Ind. Crop. Prod. 2023, 200, 116771. [Google Scholar] [CrossRef] [Scilit]
- Fan, F.; Wang, Q.; Wen, X.; Ding, G. Transcriptome-wide identification and expression profiling of Pinus massoniana MYB transcription factors responding to phosphorus deficiency. J. For. Res. 2019, 31, 909–919. [Google Scholar] [CrossRef] [Scilit]
- Yao, S.; Wu, F.; Hao, Q.; Ji, K. Transcriptome-Wide Identification of WRKY Transcription Factors and Their Expression Profiles under Different Types of Biological and Abiotic Stress in Pinus massoniana Lamb. Genes 2020, 11, 1386. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Yao, S.; Agassin, R.H.; Zhang, M.; Lou, X.; Huang, Z.; Zhang, J.; Ji, K. Transcriptome-Wide Identification of CCCH-Type Zinc Finger Proteins Family in Pinus massoniana and RR-TZF Proteins in Stress Response. Genes 2022, 13, 1639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aguayo, P.; Lagos, C.; Conejera, D.; Medina, D.; Fernández, M.; Valenzuela, S. Transcriptome-wide identification of WRKY family genes and their expression under cold acclimation in Eucalyptus globulus. Trees 2019, 33, 1313–1327. [Google Scholar] [CrossRef] [Scilit]
- Tombuloglu, H.; Kekec, G.; Sakcali, M.S.; Unver, T. Transcriptome-wide identification of R2R3-MYB transcription factors in barley with their boron responsive expression analysis. Mol. Genet. Genom. 2013, 288, 141–155. [Google Scholar] [CrossRef] [Scilit]
- Roberts, R.J.; Carneiro, M.O.; Schatz, M.C. The advantages of SMRT sequencing. Genome Biol. 2013, 14, 405. [Google Scholar] [CrossRef] [Scilit]
- Bai, D.-F.; Li, Z.; Hu, C.-G.; Zhang, Y.-J.; Muhammad, A.; Zhong, Y.-P.; Fang, J.-B. Transcriptome-wide identification and expression analysis of ERF family genes in Actinidia valvata during waterlogging stress. Sci. Hortic. 2021, 281, 109994. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Zhang, Y.; Zhou, T.; Li, X.; Wen, X.; Zhang, D. Full-Length Transcriptome-Wide Characteristic and Functional Identification of WRKY Family in Malus sieversii during the Valsa Canker Disease Response. Forests 2021, 12, 790. [Google Scholar] [CrossRef] [Scilit]
- Jensen, M.K.; Kjaersgaard, T.; Nielsen, M.M.; Galberg, P.; Petersen, K.; O’Shea, C.; Skriver, K. The Arabidopsis thaliana NAC transcription factor family: Structure-function relationships and determinants of ANAC019 stress signalling. Biochem. J. 2010, 426, 183–196. [Google Scholar] [CrossRef] [Scilit]
- Hu, R.; Qi, G.; Kong, Y.; Kong, D.; Gao, Q.; Zhou, G. Comprehensive Analysis of NAC Domain Transcription Factor Gene Family in Populus trichocarpa. BMC Plant Biol. 2010, 10, 145. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Wang, C.; Wang, D.; Wang, Y. Molecular characterization and transcript profiling of NAC genes in response to abiotic stress in Tamarix hispida. Tree Genet. Genomes 2013, 10, 157–171. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.X.; Liu, Z.W.; Wu, Z.J.; Li, H.; Zhuang, J. Transcriptome-Wide Identification and Expression Analysis of the NAC Gene Family in Tea Plant [Camellia sinensis (L.) O. Kuntze]. PLoS ONE 2016, 11, e0166727. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; Xu, X.; Xiong, W.; Wu, P.; Chen, Y.; Li, M.; Wu, G.; Jiang, H. Genome-Wide Analysis of the NAC Gene Family in Physic Nut (Jatropha curcas L.). PLoS ONE 2015, 10, e0131890. [Google Scholar] [CrossRef] [Scilit]
- Wan, F.-X.; Gao, J.; Wang, G.-L.; Niu, Y.; Wang, L.-Z.; Zhang, X.-G.; Wang, Y.-Q.; Pan, Y. Genome-wide identification of NAC transcription factor family and expression analysis of ATAF subfamily members under abiotic stress in eggplant. Sci. Hortic. 2021, 289, 110424. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Zhang, L.; Cao, Y.; Qi, C.; Li, S.; Liu, L.; Wang, G.; Mao, A.; Ren, S.; Guo, Y.D. CsATAF1 Positively Regulates Drought Stress Tolerance by an ABA-Dependent Pathway and by Promoting ROS Scavenging in Cucumber. Plant Cell Physiol. 2018, 59, 930–945. [Google Scholar] [CrossRef] [Scilit]
- He, X.; Zhu, L.; Xu, L.; Guo, W.; Zhang, X. GhATAF1, a NAC transcription factor, confers abiotic and biotic stress responses by regulating phytohormonal signaling networks. Plant Cell Rep. 2016, 35, 2167–2179. [Google Scholar] [CrossRef] [Scilit]
- Qu, L.J.; Zhu, Y.X. Transcription factor families in Arabidopsis: Major progress and outstanding issues for future research. Curr. Opin. Plant Biol. 2006, 9, 544–549. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Xu, J.; Zhang, Y.; Cui, J.; Hu, H. Transcriptome-wide identification, characterization, and expression analysis of R2R3-MYB gene family during lignin biosynthesis in Chinese cedar (Cryptomeria fortunei Hooibrenk). Ind. Crop. Prod. 2022, 182, 114883. [Google Scholar] [CrossRef] [Scilit]
- Nakashima, K.; Tran, L.S.; Van Nguyen, D.; Fujita, M.; Maruyama, K.; Todaka, D.; Ito, Y.; Hayashi, N.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Functional analysis of a NAC-type transcription factor OsNAC6 involved in abiotic and biotic stress-responsive gene expression in rice. Plant J. 2007, 51, 617–630. [Google Scholar] [CrossRef] [Scilit]
- Fang, Y.; Liao, K.; Du, H.; Xu, Y.; Song, H.; Li, X.; Xiong, L. A stress-responsive NAC transcription factor SNAC3 confers heat and drought tolerance through modulation of reactive oxygen species in rice. J. Exp. Bot. 2015, 66, 6803–6817. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paoli, L.; Vannini, A.; Monaci, F.; Loppi, S. Competition between heavy metal ions for binding sites in lichens: Implications for biomonitoring studies. Chemosphere 2018, 199, 655–660. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Li, T.; Li, W.; Wang, W.; Zhao, H. Identification and analysis of Chrysanthemum nankingense NAC transcription factors and an expression analysis of OsNAC7 subfamily members. PeerJ 2021, 9, e11505. [Google Scholar] [CrossRef] [Scilit]
- Gao, J.; Zhang, Y.; Lu, C.; Peng, H.; Luo, M.; Li, G.; Shen, Y.; Ding, H.; Zhang, Z.; Pan, G.; et al. The development dynamics of the maize root transcriptome responsive to heavy metal Pb pollution. Biochem. Biophys. Res. Commun. 2015, 458, 287–293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Ge, F.; Hou, F.; Sun, W.; Zheng, Q.; Zhang, X.; Ma, L.; Fu, J.; He, X.; Peng, H.; et al. Transcription Factors Responding to Pb Stress in Maize. Genes 2017, 8, 231. [Google Scholar] [CrossRef] [Scilit]
- Hou, F.; Zhang, N.; Ma, L.; An, L.; Zhou, X.; Zou, C.; Yang, C.; Pan, G.; Lubberstedt, T.; Shen, Y. ZmbZIP54 and ZmFDX5 cooperatively regulate maize seedling tolerance to lead by mediating ZmPRP1 transcription. Int. J. Biol. Macromol. 2023, 224, 621–633. [Google Scholar] [CrossRef] [Scilit]
- Bu, D.; Luo, H.; Huo, P.; Wang, Z.; Zhang, S.; He, Z.; Wu, Y.; Zhao, L.; Liu, J.; Guo, J.; et al. KOBAS-i: Intelligent prioritization and exploratory visualization of biological functions for gene enrichment analysis. Nucleic Acids Res. 2021, 49, W317–W325. [Google Scholar] [CrossRef] [Scilit]
- Becker, R.A.; Chambers, J.M.; Wilks, A.R. The New S Language; Wadsworth & Brooks/Cole: Monterey, CA, USA, 1988. [Google Scholar]
- Ernst, J.; Bar-Joseph, Z. STEM: A tool for the analysis of short time series gene expression data. BMC Bioinf. 2006, 7, 191. [Google Scholar] [CrossRef] [Scilit]
- Tan, B.; Xu, M.; Chen, Y.; Huang, M. Transient expression for functional gene analysis using Populus protoplasts. Plant Cell Tissue Organ Cult. (PCTOC) 2013, 114, 11–18. [Google Scholar] [CrossRef] [Scilit]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C-T method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit]







| Gene | Amino Acids Length (aa) | MW | PI | GRAVY | Subcellular Localization | Gene | Amino Acids Length (aa) | MW | PI | GRAVY | Subcellular Localization |
|---|---|---|---|---|---|---|---|---|---|---|---|
| SiNAC052b | 388 | 42,952.59 | 4.95 | −0.616 | E (2.55) | SiNAC055b | 294 | 33,002.79 | 7.07 | −0.593 | E (2.45) |
| SiNAC018c | 690 | 75,707.17 | 4.65 | −0.603 | E (2.42) | SiNAC052a | 388 | 42,952.59 | 4.95 | −0.616 | E (2.55) |
| SiNAC021b | 611 | 68,713.77 | 5.09 | −0.629 | E (2.45) | SiNAC094b | 453 | 50,832.32 | 5.71 | −0.647 | N (6.12) |
| SiNAC021a | 668 | 75,133.32 | 5.13 | −0.599 | E (2.47) | SiNAC131 | 408 | 44,754.26 | 4.73 | −0.391 | N (6.18) |
| SiNAC034 | 512 | 56,842.01 | 4.76 | −0.654 | E (2.55) | SiNAC094a | 453 | 50,832.32 | 5.71 | −0.647 | N (6.12) |
| SiNAC018a | 545 | 60,263.18 | 4.75 | −0.689 | E (2.48) | SiNAC038 | 459 | 51,557.96 | 5.84 | −0.557 | E (2.26) |
| SiNAC110 | 594 | 66,132.69 | 5.25 | −0.506 | E (2.51) | SiNAC114 | 336 | 37,789.69 | 5.33 | −0.734 | N (8.82) |
| SiNAC018b | 690 | 75,707.17 | 4.65 | −0.603 | E (2.42) | SiNAC086 | 415 | 46,912.09 | 6.06 | −0.768 | N (8.66) |
| SiNAC029 | 595 | 66,522.90 | 4.59 | −0.475 | E (2.38) | SiNAC088a | 289 | 32,636.37 | 5.23 | −0.780 | E (2.66) |
| SiNAC130b | 558 | 62,335.41 | 4.62 | −0.585 | N (7.27) | SiNAC155 | 357 | 40,265.41 | 7.61 | −0.597 | N (8.66) |
| SiNAC019 | 638 | 70,509.50 | 4.94 | −0.495 | E (2.42) | SiNAC007 | 306 | 34,952.25 | 5.50 | −0.732 | N (8.98) |
| SiNAC127 | 455 | 50,822.62 | 6.45 | −0.828 | E (2.72) | SiNAC006a | 291 | 33,328.84 | 6.72 | −0.660 | N (9.04) |
| SiNAC111b | 605 | 67,688.41 | 4.98 | −0.564 | E (2.39) | SiNAC136 | 256 | 28,925.80 | 9.15 | −0.637 | N (8.95) |
| SiNAC025b | 474 | 54,195.17 | 4.71 | −0.683 | E (2.88) | SiNAC134 | 246 | 28,096.11 | 9.64 | −0.647 | N (8.57) |
| SiNAC025a | 473 | 54,190.15 | 4.74 | −0.692 | E (2.93) | SiNAC012 | 429 | 47,885.04 | 4.87 | −0.778 | N (7.83) |
| SiNAC129 | 556 | 61,856.85 | 4.70 | −0.547 | N (7.32) | SiNAC005b | 246 | 28,425.01 | 6.97 | −0.852 | N (8.74) |
| SiNAC023 | 458 | 51,635.31 | 5.36 | −0.816 | E (2.68) | SiNAC124 | 312 | 35,324.37 | 6.70 | −0.863 | N (7.16) |
| SiNAC111a | 605 | 67,596.22 | 4.98 | −0.585 | E (2.35) | SiNAC154 | 348 | 39,172.56 | 8.72 | −0.526 | N (8.54) |
| SiNAC115a | 336 | 37,996.11 | 5.42 | −0.695 | N (8.82) | SiNAC053 | 282 | 32,336.68 | 8.58 | −0.683 | N (9.00) |
| SiNAC130a | 558 | 62,335.41 | 4.62 | −0.585 | N (7.27) | SiNAC120 | 343 | 38,290.14 | 8.56 | −0.580 | N (8.82) |
| SiNAC153 | 164 | 19,106.97 | 9.28 | −0.794 | N (8.95) | SiNAC005a | 304 | 34,995.47 | 6.02 | −0.776 | N (8.68) |
| SiNAC055a | 294 | 33,002.79 | 7.07 | −0.593 | E (2.45) | SiNAC017 | 396 | 44,977.08 | 6.07 | −0.758 | N (8.71) |
| SiNAC013 | 429 | 47,558.87 | 5.16 | −0.740 | N (7.33) | SiNAC118 | 344 | 38,270.96 | 8.46 | −0.567 | N (8.90) |
| SiNAC145 | 397 | 44,760.94 | 6.09 | −0.666 | N (8.69) | SiNAC137 | 256 | 28,963.74 | 9.04 | −0.728 | N (8.95) |
| SiNAC088b | 333 | 37,767.38 | 5.94 | −0.813 | E (2.87) | SiNAC004 | 278 | 31,695.11 | 8.15 | −0.583 | N (8.97) |
| SiNAC115b | 371 | 41,655.12 | 5.20 | −0.668 | N (8.80) | SiNAC142 | 340 | 38,530.56 | 5.52 | −0.680 | E (2.37) |
| SiNAC006b | 154 | 17,813.56 | 9.71 | −0.672 | N (9.09) | ||||||
| Primer ID | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| SiNAC120_166 | tggagaggacagcccaagcttATGGGACTGCAAGAAACAGATCC | gctcaccatggatcctctagaCTGCTTAAACCCGAACCCACT |
| SiNAC004_166 | tggagaggacagcccaagcttATGAAGGCGGCGGCATTA | gctcaccatggatcctctagaAAACGGCTTCTGCAAATACATGA |
| qSiNAC005a | GCTTCCAGAAATGGCACTGTATGGT | GGTTTATCCGCTCCGGTTGCT |
| qSiNAC006a | CGGCATGGCCTTGTATGGAGAAA | GCAGCACGATTCGGTCTCGAT |
| qSiNAC007 | GGAGCGAAAGCCCGACATCA | TGGCATCACTCATCACCATCGC |
| qSiNAC004 | TGTCGCATACACAACAAGAAAGGCA | GCACAGAATCTGACGTGTCGAAATACA |
| qSiNAC120 | GATCCATGGCTCTTACCAAGCAAGG | GTTGGGTCGGGATCCATTCGG |
| qSiNAC118 | GGTTGCCGGTCACCATTTCTCTT | GTTGGGTCGGGATCCATTGGG |
| qSiNAC053 | AGAGCAACTGTGTCAGGGTATTGGA | TCGGTCTTGGTGCCCTTAGGT |
| SiActin1 | AGGACCACGCCTTTGACAGC | CGAAAGGGAGTGGCGTGGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xin, Y.; Huang, R.; Xu, M.; Xu, L. Transcriptome-Wide Identification and Response Pattern Analysis of the Salix integra NAC Transcription Factor in Response to Pb Stress. Int. J. Mol. Sci. 2023, 24, 11334. https://doi.org/10.3390/ijms241411334
Xin Y, Huang R, Xu M, Xu L. Transcriptome-Wide Identification and Response Pattern Analysis of the Salix integra NAC Transcription Factor in Response to Pb Stress. International Journal of Molecular Sciences. 2023; 24(14):11334. https://doi.org/10.3390/ijms241411334
Chicago/Turabian StyleXin, Yue, Ruifang Huang, Meng Xu, and Li’an Xu. 2023. "Transcriptome-Wide Identification and Response Pattern Analysis of the Salix integra NAC Transcription Factor in Response to Pb Stress" International Journal of Molecular Sciences 24, no. 14: 11334. https://doi.org/10.3390/ijms241411334
APA StyleXin, Y., Huang, R., Xu, M., & Xu, L. (2023). Transcriptome-Wide Identification and Response Pattern Analysis of the Salix integra NAC Transcription Factor in Response to Pb Stress. International Journal of Molecular Sciences, 24(14), 11334. https://doi.org/10.3390/ijms241411334

