Inflammation of Dry Eye Syndrome: A Cellular Study of the Epithelial and Macrophagic Involvement of NFAT5 and RAGE
Abstract
1. Introduction
2. Results
2.1. Effects of Hyperosmolarity on Ocular Surface Epithelial Cells
2.2. Characterization of NFAT5 in Ocular Surface Epithelial Cells in Hyperosmolar Stress Condition
2.3. Implication of NFAT5 in Surface Epithelial Cell Inflammation
2.4. RAGE–Ligands Axis on Ocular Surface Epithelial Cell Inflammation
2.5. Paracrine Effect of DAMPs and MCP1 on Macrophage Migration
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cell Culture
4.2.1. In Vitro Hyperosmolar Stress Experiment
4.2.2. Alarmin Treatments
4.3. Quantitative RT-PCR
4.4. Western Blot
4.5. Supernatant Protein Concentration
4.6. Cytokine Multiplex Assay
4.7. ELISA
4.8. Small Interfering RNA Transfection of Epithelial Cells (HCE and WKD)
4.9. NFAT5 Gene Reporter Luciferase Assay
4.10. Immunofluorescence
4.11. Chemotaxis Aassay
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bron, A.J.; de Paiva, C.S.; Chauhan, S.K.; Bonini, S.; Gabison, E.E.; Jain, S.; Knop, E.; Markoulli, M.; Ogawa, Y.; Perez, V.; et al. TFOS DEWS II pathophysiology report. Ocul. Surf. 2017, 15, 438–510. [Google Scholar] [CrossRef] [Scilit]
- The Epidemiology of Dry Eye Disease: Report of the Epidemiology Subcommittee of the International Dry Eye WorkShop (2007). Ocul. Surf. 2007, 5, 93–107. [CrossRef] [Scilit]
- Baudouin, C. Un nouveau schéma pour mieux comprendre les maladies de la surface oculaire. J. Français d’Ophtalmologie 2007, 30, 239–246. [Google Scholar] [CrossRef] [Scilit]
- Schaefer, L. Complexity of Danger: The Diverse Nature of Damage-Associated Molecular Patterns. J. Biol. Chem. 2014, 289, 35237–35245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, L.; Beuerman, R.W.; Chan, C.M.; Zhao, S.Z.; Li, X.R.; Yang, H.; Tong, L.; Liu, S.; Stern, M.E.; Tan, D. Identification of Tear Fluid Biomarkers in Dry Eye Syndrome Using ITRAQ Quantitative Proteomics. J. Proteome Res. 2009, 8, 4889–4905. [Google Scholar] [CrossRef] [Scilit]
- Benitez-Del-Castillo, J.M.; Soria, J.; Acera, A.; Muñoz, A.M.; Rodríguez, S.; Suárez, T. Quantification of a Panel for Dry-Eye Protein Biomarkers in Tears: A Comparative Pilot Study Using Standard ELISA and Customized Microarrays. Mol. Vis. 2021, 27, 243–261. [Google Scholar] [PubMed]
- Wang, B.; Zeng, H.; Zuo, X.; Yang, X.; Wang, X.; He, D.; Yuan, J. TLR4-Dependent DUOX2 Activation Triggered Oxidative Stress and Promoted HMGB1 Release in Dry Eye. Front. Med. 2022, 8, 781616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rhee, M.K.; Mah, F.S. Inflammation in Dry Eye Disease: How Do We Break the Cycle? Ophthalmology 2017, 124, S14–S19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Redfern, R.L.; Barabino, S.; Baxter, J.; Lema, C.; McDermott, A.M. Dry Eye Modulates the Expression of Toll-like Receptors on the Ocular Surface. Exp. Eye Res. 2015, 134, 80–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Redfern, R.L.; Patel, N.; Hanlon, S.; Farley, W.; Gondo, M.; Pflugfelder, S.C.; McDermott, A.M. Toll-Like Receptor Expression and Activation in Mice with Experimental Dry Eye. Investig. Ophthalmol. Vis. Sci. 2013, 54, 1554. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.S.; Hattori, T.; Park, E.Y.; Stevenson, W.; Chauhan, S.K.; Dana, R. Expression of Toll-Like Receptor 4 Contributes to Corneal Inflammation in Experimental Dry Eye Disease. Investig. Ophthalmol. Vis. Sci. 2012, 53, 5632. [Google Scholar] [CrossRef] [Scilit]
- Redfern, R.L.; McDermott, A.M. Toll-like Receptors in Ocular Surface Disease. Exp. Eye Res. 2010, 90, 679–687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Warcoin, E.; Baudouin, C.; Gard, C.; Brignole-Baudouin, F. In Vitro Inhibition of NFAT5-Mediated Induction of CCL2 in Hyperosmotic Conditions by Cyclosporine and Dexamethasone on Human HeLa-Modified Conjunctiva-Derived Cells. PLoS ONE 2016, 11, e0159983. [Google Scholar] [CrossRef] [Scilit]
- Panigrahi, T.; D’Souza, S.; Shetty, R.; Padmanabhan Nair, A.; Ghosh, A.; Jacob Remington Nelson, E.; Ghosh, A.; Sethu, S. Genistein-Calcitriol Mitigates Hyperosmotic Stress-Induced TonEBP, CFTR Dysfunction, VDR Degradation and Inflammation in Dry Eye Disease. Clin. Transl. Sci. 2021, 14, 288–298. [Google Scholar] [CrossRef] [Scilit]
- Hudson, B.I.; Lippman, M.E. Targeting RAGE Signaling in Inflammatory Disease. Annu. Rev. Med. 2018, 69, 349–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ray, R.; Juranek, J.K.; Rai, V. RAGE Axis in Neuroinflammation, Neurodegeneration and Its Emerging Role in the Pathogenesis of Amyotrophic Lateral Sclerosis. Neurosci. Biobehav. Rev. 2016, 62, 48–55. [Google Scholar] [CrossRef] [Scilit]
- Kierdorf, K.; Fritz, G. RAGE Regulation and Signaling in Inflammation and Beyond. J. Leukoc. Biol. 2013, 94, 55–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chavakis, T.; Bierhaus, A.; Al-Fakhri, N.; Schneider, D.; Witte, S.; Linn, T.; Nagashima, M.; Morser, J.; Arnold, B.; Preissner, K.T.; et al. The Pattern Recognition Receptor (RAGE) Is a Counterreceptor for Leukocyte Integrins. J. Exp. Med. 2003, 198, 1507–1515. [Google Scholar] [CrossRef] [Scilit]
- Frommhold, D.; Kamphues, A.; Hepper, I.; Pruenster, M.; Lukić, I.K.; Socher, I.; Zablotskaya, V.; Buschmann, K.; Lange-Sperandio, B.; Schymeinsky, J.; et al. RAGE and ICAM-1 Cooperate in Mediating Leukocyte Recruitment during Acute Inflammation in Vivo. Blood 2010, 116, 841–849. [Google Scholar] [CrossRef] [Scilit]
- Frommhold, D.; Kamphues, A.; Dannenberg, S.; Buschmann, K.; Zablotskaya, V.; Tschada, R.; Lange-Sperandio, B.; Nawroth, P.P.; Poeschl, J.; Bierhaus, A.; et al. RAGE and ICAM-1 Differentially Control Leukocyte Recruitment during Acute Inflammation in a Stimulus-Dependent Manner. BMC Immunol. 2011, 12, 56. [Google Scholar] [CrossRef] [Scilit]
- López-Rodríguez, C.; Antos, C.L.; Shelton, J.M.; Richardson, J.A.; Lin, F.; Novobrantseva, T.I.; Bronson, R.T.; Igarashi, P.; Rao, A.; Olson, E.N. Loss of NFAT5 Results in Renal Atrophy and Lack of Tonicity-Responsive Gene Expression. Proc. Natl. Acad. Sci. USA 2004, 101, 2392–2397. [Google Scholar] [CrossRef] [Scilit]
- Miyakawa, H.; Woo, S.K.; Dahl, S.C.; Handler, J.S.; Kwon, H.M. Tonicity-Responsive Enhancer Binding Protein, a Rel-like Protein That Stimulates Transcription in Response to Hypertonicity. Proc. Natl. Acad. Sci. USA 1999, 96, 2538–2542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aramburu, J.; Drews-Elger, K.; Estrada-Gelonch, A.; Minguillón, J.; Morancho, B.; Santiago, V.; López-Rodríguez, C. Regulation of the Hypertonic Stress Response and Other Cellular Functions by the Rel-like Transcription Factor NFAT5. Biochem. Pharmacol. 2006, 72, 1597–1604. [Google Scholar] [CrossRef] [Scilit]
- López-Rodríguez, C.; Aramburu, J.; Jin, L.; Rakeman, A.S.; Michino, M.; Rao, A. Bridging the NFAT and NF-ΚB Families. Immunity 2001, 15, 47–58. [Google Scholar] [CrossRef] [Scilit]
- Donato, R. Intracellular and Extracellular Roles of S100 Proteins. Microsc. Res. Tech. 2003, 60, 540–551. [Google Scholar] [CrossRef] [Scilit]
- Zimmer, D.B.; Wright Sadosky, P.; Weber, D.J. Molecular Mechanisms of S100-Target Protein Interactions. Microsc. Res. Tech. 2003, 60, 552–559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heizmann, C.W.; Ackermann, G.E.; Galichet, A. Pathologies Involving the S100 Proteins and Rage. In Calcium Signalling and Disease; Carafoli, E., Brini, M., Eds.; Subcellular Biochemistry; Springer: Dordrecht, The Netherlands, 2007; Volume 45, pp. 93–138. ISBN 978-1-4020-6190-5. [Google Scholar]
- Travers, A.A. Priming the Nucleosome: A Role for HMGB Proteins? EMBO Rep. 2003, 4, 131–136. [Google Scholar] [CrossRef] [Scilit]
- Yuan, F.; Gu, L.; Guo, S.; Wang, C.; Li, G.-M. Evidence for Involvement of HMGB1 Protein in Human DNA Mismatch Repair. J. Biol. Chem. 2004, 279, 20935–20940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hock, R.; Furusawa, T.; Ueda, T.; Bustin, M. HMG Chromosomal Proteins in Development and Disease. Trends Cell Biol. 2007, 17, 72–79. [Google Scholar] [CrossRef] [Scilit]
- Alven, A.; Lema, C.; Redfern, R.L. Impact of Low Humidity on Damage-Associated Molecular Patterns at the Ocular Surface during Dry Eye Disease. Optom. Vis. Sci. 2021, 98, 1231–1238. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Bukulin, M.; Kojro, E.; Roth, A.; Metz, V.V.; Fahrenholz, F.; Nawroth, P.P.; Bierhaus, A.; Postina, R. Receptor for Advanced Glycation End Products Is Subjected to Protein Ectodomain Shedding by Metalloproteinases. J. Biol. Chem. 2008, 283, 35507–35516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bierhaus, A.; Humpert, P.M.; Morcos, M.; Wendt, T.; Chavakis, T.; Arnold, B.; Stern, D.M.; Nawroth, P.P. Understanding RAGE, the Receptor for Advanced Glycation End Products. J. Mol. Med. 2005, 83, 876–886. [Google Scholar] [CrossRef] [Scilit]
- Xie, J.; Méndez, J.D.; Méndez-Valenzuela, V.; Aguilar-Hernández, M.M. Cellular Signalling of the Receptor for Advanced Glycation End Products (RAGE). Cell Signal. 2013, 25, 2185–2197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deshmane, S.L.; Kremlev, S.; Amini, S.; Sawaya, B.E. Monocyte Chemoattractant Protein-1 (MCP-1): An Overview. J. Interferon Cytokine Res. 2009, 29, 313–326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujiwara, N.; Kobayashi, K. Macrophages in Inflammation. CDTIA 2005, 4, 281–286. [Google Scholar] [CrossRef] [Scilit]
- Tan, J.; Zhao, F.; Deng, S.; Zhu, H.; Gong, Y.; Wang, W. Glycyrrhizin Affects Monocyte Migration and Apoptosis by Blocking HMGB1 Signaling. Mol. Med. Rep. 2018, 17, 5970–5975. [Google Scholar] [CrossRef] [Scilit]
- Chen, B.; Miller, A.L.; Rebelatto, M.; Brewah, Y.; Rowe, D.C.; Clarke, L.; Czapiga, M.; Rosenthal, K.; Imamichi, T.; Chen, Y.; et al. S100A9 Induced Inflammatory Responses Are Mediated by Distinct Damage Associated Molecular Patterns (DAMP) Receptors In Vitro and In Vivo. PLoS ONE 2015, 10, e0115828. [Google Scholar] [CrossRef] [Scilit]
- Manfredi, A.A.; Capobianco, A.; Esposito, A.; De Cobelli, F.; Canu, T.; Monno, A.; Raucci, A.; Sanvito, F.; Doglioni, C.; Nawroth, P.P.; et al. Maturing Dendritic Cells Depend on RAGE for In Vivo Homing to Lymph Nodes. J. Immunol. 2008, 180, 2270–2275. [Google Scholar] [CrossRef] [Scilit]
- Taguchi, A.; Blood, D.C.; del Toro, G.; Canet, A.; Lee, D.C.; Qu, W.; Tanji, N.; Lu, Y.; Lalla, E.; Fu, C.; et al. Blockade of RAGE–Amphoterin Signalling Suppresses Tumour Growth and Metastases. Nature 2000, 405, 354–360. [Google Scholar] [CrossRef] [Scilit]
- Chou, D.K.H.; Zhang, J.; Smith, F.I.; McCaffery, P.; Jungalwala, F.B. Developmental Expression of Receptor for Advanced Glycation End Products (RAGE), Amphoterin and Sulfoglucuronyl (HNK-1) Carbohydrate in Mouse Cerebellum and Their Role in Neurite Outgrowth and Cell Migration. J. Neurochem. 2004, 90, 1389–1401. [Google Scholar] [CrossRef] [Scilit]
- Chen, R.-C.; Yi, P.-P.; Zhou, R.-R.; Xiao, M.-F.; Huang, Z.-B.; Tang, D.-L.; Huang, Y.; Fan, X.-G. The Role of HMGB1-RAGE Axis in Migration and Invasion of Hepatocellular Carcinoma Cell Lines. Mol. Cell. Biochem. 2014, 390, 271–280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Li, R.; Peng, Z.; Hu, B.; Rao, X.; Li, J. HMGB1 Participates in LPS-induced Acute Lung Injury By activating the AIM2 Inflammasome in Macrophages and Inducing Polarization of M1 Macrophages via TLR2, TLR4, and RAGE/NF-κB Signaling Pathways. Int. J. Mol. Med. 2019, 45, 61–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, J.; Yue, Y.; Xiong, S. Extracellular HMGB1 Augments Macrophage Inflammation by Facilitating the Endosomal Accumulation of ALD-DNA via TLR2/4-Mediated Endocytosis. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2021, 1867, 166184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sunahori, K.; Yamamura, M.; Yamana, J.; Takasugi, K.; Kawashima, M.; Yamamoto, H.; Chazin, W.J.; Nakatani, Y.; Yui, S.; Makino, H. The S100A8/A9 Heterodimer Amplifies Proinflammatory Cytokine Production by Macrophages via Activation of Nuclear Factor Kappa B and P38 Mitogen-Activated Protein Kinase in Rheumatoid Arthritis. Arthritis Res. Ther. 2006, 8, R69. [Google Scholar] [CrossRef] [Scilit]
- Kawakami, R.; Katsuki, S.; Travers, R.; Romero, D.C.; Becker-Greene, D.; Passos, L.S.A.; Higashi, H.; Blaser, M.C.; Sukhova, G.K.; Buttigieg, J.; et al. S100A9-RAGE Axis Accelerates Formation of Macrophage-Mediated Extracellular Vesicle Microcalcification in Diabetes Mellitus. ATVB 2020, 40, 1838–1853. [Google Scholar] [CrossRef] [Scilit]
- Gross, C.; Belville, C.; Lavergne, M.; Choltus, H.; Jabaudon, M.; Blondonnet, R.; Constantin, J.-M.; Chiambaretta, F.; Blanchon, L.; Sapin, V. Advanced Glycation End Products and Receptor (RAGE) Promote Wound Healing of Human Corneal Epithelial Cells. Investig. Ophthalmol. Vis. Sci. 2020, 61, 14. [Google Scholar] [CrossRef] [Scilit]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit]










| Gene | Sequence 5′-3′ (F: Forward; R: Reverse) | Product Size (bp) | Hybridization Temperature (°C) |
|---|---|---|---|
| hsRPS17 | F: TGCGAGGAGATCGCCATTATC | 169 | 61 |
| R: AAGGCTGAGACCTCAGGAAC | |||
| hsRPL0 | F: AGGCTTTAGGTATCACCACT | 219 | 61 |
| R: GCAGAGTTTCCTCTGTGATA | |||
| hsNFAT5 | F: ACAGTAAAGCTGGAAGGCCA | 185 | 61 |
| R: TTGCTAGGATCAAGGCCGAC | |||
| hsS100A9 | F: ACACTCTGTGTGGCTCCTCG | 166 | 61 |
| R: CGCACCAGCTCTTTGAATTCC | |||
| hsS100A4 | F: GGACAGCAACAGGGACAACGA | 101 | 61 |
| R: TATCTGGGAAGCCTTCAAAG | |||
| hsS100A8 | F: TAAAGGGGAATTTCCATGCCGT | 137 | 61 |
| R: GTTAACTGCACCATCAGTGTTG | |||
| hsIL8 | F: TGATTTCTGCAGCTCTGTGTG | 154 | 61 |
| R: TCTGTGTTGGCGCAGTGTGG | |||
| hsIL6 | F: AATGAGGAGACTTGCCTGGTG | 143 | 61 |
| R: AGGAACTGGATCAGGACTTTTG | |||
| hsMCP1 | F: ATAGCAGCCACCTTCATTCCC | 185 | 61 |
| R: ATCTCCTTGGCCACAATGGTC | |||
| hsTNFα | F: AGGGACCTCTCTCTAATCAGC | 168 | 61 |
| R: TCTCAGCTCCACGCCATTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Henrioux, F.; Navel, V.; Belville, C.; Charnay, C.; Antoine, A.; Chiambaretta, F.; Sapin, V.; Blanchon, L. Inflammation of Dry Eye Syndrome: A Cellular Study of the Epithelial and Macrophagic Involvement of NFAT5 and RAGE. Int. J. Mol. Sci. 2023, 24, 11052. https://doi.org/10.3390/ijms241311052
Henrioux F, Navel V, Belville C, Charnay C, Antoine A, Chiambaretta F, Sapin V, Blanchon L. Inflammation of Dry Eye Syndrome: A Cellular Study of the Epithelial and Macrophagic Involvement of NFAT5 and RAGE. International Journal of Molecular Sciences. 2023; 24(13):11052. https://doi.org/10.3390/ijms241311052
Chicago/Turabian StyleHenrioux, Fanny, Valentin Navel, Corinne Belville, Coline Charnay, Audrey Antoine, Frédéric Chiambaretta, Vincent Sapin, and Loïc Blanchon. 2023. "Inflammation of Dry Eye Syndrome: A Cellular Study of the Epithelial and Macrophagic Involvement of NFAT5 and RAGE" International Journal of Molecular Sciences 24, no. 13: 11052. https://doi.org/10.3390/ijms241311052
APA StyleHenrioux, F., Navel, V., Belville, C., Charnay, C., Antoine, A., Chiambaretta, F., Sapin, V., & Blanchon, L. (2023). Inflammation of Dry Eye Syndrome: A Cellular Study of the Epithelial and Macrophagic Involvement of NFAT5 and RAGE. International Journal of Molecular Sciences, 24(13), 11052. https://doi.org/10.3390/ijms241311052

