Oxytocin Modulates Osteogenic Commitment in Human Adipose-Derived Stem Cells
Abstract
1. Introduction
2. Results
2.1. Characterization of hASCs
2.2. Effects of Oxytocin on hASC Morphology and Oxytocin Receptor mRNA Expression
2.3. Effects of Oxytocin on hASC Viability
2.4. Effects of Oxytocin on hASC Proliferation
2.5. Effects of Oxytocin on hASC Migration Ability
2.6. Effects of Oxytocin on hASC Senescence-Associated-β-Galactosidase (SA-β-Gal) Activity and Autophagy
2.7. Effects of Oxytocin on the Adipogenic and Osteogenic Potential of hASCs
2.7.1. Effects of Oxytocin on the hASC Adipogenic Commitment
2.7.2. Effects of Oxytocin on the hASC Osteogenic Commitment
3. Discussion
4. Materials and Methods
4.1. hASCs: Harvesting, Culture, and Characterization
4.2. OXT Treatments
4.3. Morphological Assessment and OXTR Gene Expression
4.4. Cell Viability
4.5. BrdU Assay and Expression Analysis of Proliferation/Cell Cycle Markers
4.6. Scratch Wound Healing Assay
4.7. Senescence-Associated β-Galactosidase Staining and Gene Expression Analysis of Senescence/Autophagy Markers
4.8. Adipogenic Commitment: O.R.O Staining and PPARγ Expression Analysis
4.9. Osteogenic Commitment: Alizarin Red S Staining and Expression Analysis of Osteogenic/Autophagy Markers
4.10. RNA Extraction, RT-PCR, and qPCR
4.11. Immunofluorescence Analysis of Osteogenic Markers
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Du Vigneaud, V.; Ressler, C.; Trippett, S. The sequence of amino acids in oxytocin, with a proposal for the structure of oxytocin. J. Biol. Chem. 1953, 205, 949–957. [Google Scholar] [CrossRef] [PubMed]
- Carter, C.S. Oxytocin and love: Myths, metaphors and mysteries. Compr. Psychoneuroendocrinol. 2021, 9, 100107. [Google Scholar] [CrossRef]
- Jankowski, M.; Hajjar, F.; Kawas, S.A.; Mukaddam-Daher, S.; Hoffman, G.; McCann, S.M.; Gutkowska, J. Rat heart: A site of oxytocin production and action. Proc. Natl. Acad. Sci. USA 1998, 95, 14558–14563. [Google Scholar] [CrossRef] [PubMed]
- Friebe-Hoffmann, U.; Baston, D.M.; Chiao, J.P.; Winebrenner, L.D.; Krüssel, J.S.; Hoffmann, T.K.; Hirchenhain, J.; Rauk, P.N. The effect of relaxin on the oxytocin receptor in human uterine smooth muscle cells. Regul. Pept. 2007, 138, 74–81. [Google Scholar] [CrossRef] [PubMed]
- Geenen, V.; Legros, J.J.; Franchimont, P.; Defresne, M.P.; Boniver, J.; Ivell, R.; Richter, D. The thymus as a neuroendocrine organ. Synthesis of vasopressin and oxytocin in human thymic epithelium. Ann. N. Y. Acad. Sci. 1987, 496, 56–66. [Google Scholar] [CrossRef]
- Luo, D.; Jin, B.; Zhai, X.; Li, J.; Liu, C.; Guo, W.; Li, J. Oxytocin promotes hepatic regeneration in elderly mice. iScience 2021, 24, 102125. [Google Scholar] [CrossRef] [PubMed]
- Boland, D.; Goren, H.J. Binding and structural properties of oxytocin receptors in isolated rat epididymal adipocytes. Regul. Pept. 1987, 18, 7–18. [Google Scholar] [CrossRef]
- Copland, J.A.; Ives, K.L.; Simmons, D.J.; Soloff, M.S. Functional oxytocin receptors discovered in human osteoblasts. Endocrinology 1999, 140, 4371–4374. [Google Scholar] [CrossRef]
- Zingg, H.H.; Laporte, S.A. The oxytocin receptor. Trends Endocrinol. Metab. 2003, 14, 222–227. [Google Scholar] [CrossRef]
- Arrowsmith, S.; Wray, S. Oxytocin: Its mechanism of action and receptor signalling in the myometrium. J. Neuroendocrinol. 2014, 26, 356–369. [Google Scholar] [CrossRef]
- Amri, E.Z.; Pisani, D.F. Control of bone and fat mass by oxytocin. Horm. Mol. Biol. Clin. Investig. 2016, 28, 95–104. [Google Scholar] [CrossRef]
- Higashida, H.; Hashii, M.; Tanaka, Y.; Matsukawa, S.; Higuchi, Y.; Gabata, R.; Tsubomoto, M.; Seishima, N.; Teramachi, M.; Kamijima, T.; et al. CD38, CD157, and RAGE as Molecular Determinants for Social Behavior. Cells 2019, 9, 62. [Google Scholar] [CrossRef]
- Loth, M.K.; Donaldson, Z.R. Oxytocin, Dopamine, and Opioid Interactions Underlying Pair Bonding: Highlighting a Potential Role for Microglia. Endocrinology 2021, 162, bqaa223. [Google Scholar] [CrossRef]
- Camerino, C. The New Frontier in Oxytocin Physiology: The Oxytonic Contraction. Int. J. Mol. Sci. 2020, 21, 5144. [Google Scholar] [CrossRef]
- Camerino, C. Oxytocin Involvement in Body Composition Unveils the True Identity of Oxytocin. Int. J. Mol. Sci. 2021, 22, 6383. [Google Scholar] [CrossRef]
- Crisan, M.; Yap, S.; Casteilla, L.; Chen, C.W.; Corselli, M.; Park, T.S.; Andriolo, G.; Sun, B.; Zheng, B.; Zhang, L.; et al. A perivascular origin for mesenchymal stem cells in multiple human organs. Cell Stem Cell 2008, 3, 301–313. [Google Scholar] [CrossRef] [PubMed]
- Mahla, R.S. Stem Cells Applications in Regenerative Medicine and Disease Therapeutics. Int. J. Cell Biol. 2016, 2016, 6940283. [Google Scholar] [CrossRef] [PubMed]
- Laurent, L.C.; Ulitsky, I.; Slavin, I.; Tran, H.; Schork, A.; Morey, R.; Lynch, C.; Harness, J.V.; Lee, S.; Barrero, M.J.; et al. Dynamic changes in the copy number of pluripotency and cell proliferation genes in human ESCs and iPSCs during reprogramming and time in culture. Cell Stem Cell 2011, 8, 106–118. [Google Scholar] [CrossRef] [PubMed]
- Noiseux, N.; Borie, M.; Desnoyers, A.; Menaouar, A.; Stevens, L.M.; Mansour, S.; Danalache, B.A.; Roy, D.C.; Jankowski, M.; Gutkowska, J. Preconditioning of stem cells by oxytocin to improve their therapeutic potential. Endocrinology 2012, 153, 5361–5372. [Google Scholar] [CrossRef]
- Kim, Y.S.; Kwon, J.S.; Hong, M.H.; Kim, J.; Song, C.H.; Jeong, M.H.; Cho, J.G.; Park, J.C.; Kang, J.C.; Ahn, Y. Promigratory activity of oxytocin on umbilical cord blood-derived mesenchymal stem cells. Artif. Organs 2010, 34, 453–461. [Google Scholar] [CrossRef]
- Paquin, J.; Danalache, B.A.; Jankowski, M.; McCann, S.M.; Gutkowska, J. Oxytocin induces differentiation of P19 embryonic stem cells to cardiomyocytes. Proc. Natl. Acad. Sci. USA 2002, 99, 9550–9555. [Google Scholar] [CrossRef] [PubMed]
- Hatami, L.; Valojerdi, M.R.; Mowla, S.J. Effects of oxytocin on cardiomyocyte differentiation from mouse embryonic stem cells. Int. J. Cardiol. 2007, 117, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Matsuura, K.; Nagai, T.; Nishigaki, N.; Oyama, T.; Nishi, J.; Wada, H.; Sano, M.; Toko, H.; Akazawa, H.; Sato, T.; et al. Adult cardiac Sca-1-positive cells differentiate into beating cardiomyocytes. J. Biol. Chem. 2004, 279, 11384–11391. [Google Scholar] [CrossRef]
- Ybarra, N.; del Castillo, J.R.; Troncy, E. Involvement of the nitric oxide-soluble guanylyl cyclase pathway in the oxytocin-mediated differentiation of porcine bone marrow stem cells into cardiomyocytes. Nitric Oxide 2011, 24, 25–33. [Google Scholar] [CrossRef]
- Taha, M.F.; Javeri, A.; Karimipour, M.; Yamaghani, M.S. Priming with oxytocin and relaxin improves cardiac differentiation of adipose tissue-derived stem cells. J. Cell. Biochem. 2019, 120, 5825–5834. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.S.; Ahn, Y.; Kwon, J.S.; Cho, Y.K.; Jeong, M.H.; Cho, J.G.; Park, J.C.; Kang, J.C. Priming of mesenchymal stem cells with oxytocin enhances the cardiac repair in ischemia/reperfusion injury. Cells Tissues Organs 2012, 195, 428–442. [Google Scholar] [CrossRef] [PubMed]
- Wasserman, A.H.; Huang, A.R.; Lewis-Israeli, Y.R.; Dooley, M.D.; Mitchell, A.L.; Venkatesan, M.; Aguirre, A. Oxytocin promotes epicardial cell activation and heart regeneration after cardiac injury. Front. Cell Dev. Biol. 2022, 10, 985298. [Google Scholar] [CrossRef] [PubMed]
- Roux, C.H.; Pisani, D.F.; Gillet, P.; Fontas, E.; Yahia, H.B.; Djedaini, M.; Ambrosetti, D.; Michiels, J.F.; Panaia-Ferrari, P.; Breuil, V.; et al. Oxytocin Controls Chondrogenesis and Correlates with Osteoarthritis. Int. J. Mol. Sci. 2020, 21, 3966. [Google Scholar] [CrossRef]
- Wu, Y.; Wu, T.; Xu, B.; Xu, X.; Chen, H.; Li, X. Oxytocin prevents cartilage matrix destruction via regulating matrix metalloproteinases. Biochem. Biophys. Res. Commun. 2017, 486, 601–606. [Google Scholar] [CrossRef]
- Elabd, C.; Cousin, W.; Upadhyayula, P.; Chen, R.Y.; Chooljian, M.S.; Li, J.; Kung, S.; Jiang, K.P.; Conboy, I.M. Oxytocin is an age-specific circulating hormone that is necessary for muscle maintenance and regeneration. Nat. Commun. 2014, 5, 4082. [Google Scholar] [CrossRef]
- Jafarzadeh, N.; Javeri, A.; Khaleghi, M.; Taha, M.F. Oxytocin improves proliferation and neural differentiation of adipose tissue-derived stem cells. Neurosci. Lett. 2014, 564, 105–110. [Google Scholar] [CrossRef] [PubMed]
- Elabd, C.; Basillais, A.; Beaupied, H.; Breuil, V.; Wagner, N.; Scheideler, M.; Zaragosi, L.E.; Massiéra, F.; Lemichez, E.; Trajanoski, Z.; et al. Oxytocin controls differentiation of human mesenchymal stem cells and reverses osteoporosis. Stem Cells 2008, 26, 2399–2407. [Google Scholar] [CrossRef] [PubMed]
- Rosen, C.J.; Bouxsein, M.L. Mechanisms of disease: Is osteoporosis the obesity of bone? Nat. Clin. Pract. Rheumatol. 2006, 2, 35–43. [Google Scholar] [CrossRef] [PubMed]
- Ge, B.; Liu, H.; Liang, Q.; Shang, L.; Wang, T.; Ge, S. Oxytocin facilitates the proliferation, migration and osteogenic differentiation of human periodontal stem cells in vitro. Arch. Oral Biol. 2019, 99, 126–133. [Google Scholar] [CrossRef] [PubMed]
- Seo, B.M.; Miura, M.; Gronthos, S.; Bartold, P.M.; Batouli, S.; Brahim, J.; Young, M.; Robey, P.G.; Wang, C.Y.; Shi, S. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet 2004, 364, 149–155. [Google Scholar] [CrossRef]
- Bianconi, E.; Tassinari, R.; Alessandrini, A.; Ragazzini, G.; Cavallini, C.; Abruzzo, P.M.; Petrocelli, G.; Pampanella, L.; Casadei, R.; Maioli, M.; et al. Cytochalasin B Modulates Nanomechanical Patterning and Fate in Human Adipose-Derived Stem Cells. Cells 2022, 11, 1629. [Google Scholar] [CrossRef]
- de Mera-Rodríguez, J.A.; Álvarez-Hernán, G.; Gañán, Y.; Martín-Partido, G.; Rodríguez-León, J.; Francisco-Morcillo, J. Is Senescence-Associated β-Galactosidase a Reliable in vivo Marker of Cellular Senescence During Embryonic Development? Front. Cell Dev. Biol. 2021, 9, 623175. [Google Scholar] [CrossRef]
- Young, A.R.; Narita, M.; Ferreira, M.; Kirschner, K.; Sadaie, M.; Darot, J.F.; Tavaré, S.; Arakawa, S.; Shimizu, S.; Watt, F.M.; et al. Autophagy mediates the mitotic senescence transition. Genes Dev. 2009, 23, 798–803. [Google Scholar] [CrossRef]
- Rubinsztein, D.C.; Shpilka, T.; Elazar, Z. Mechanisms of autophagosome biogenesis. Curr. Biol. 2012, 22, R29–R34. [Google Scholar] [CrossRef]
- Hu, Y.; Reggiori, F. Molecular regulation of autophagosome formation. Biochem. Soc. Trans. 2022, 50, 55–69. [Google Scholar] [CrossRef]
- Sotthibundhu, A.; Promjuntuek, W.; Liu, M.; Shen, S.; Noisa, P. Roles of autophagy in controlling stem cell identity: A perspective of self-renewal and differentiation. Cell Tissue Res. 2018, 374, 205–216. [Google Scholar] [CrossRef]
- Ma, Y.; Qi, M.; An, Y.; Zhang, L.; Yang, R.; Doro, D.H.; Liu, W.; Jin, Y. Autophagy controls mesenchymal stem cell properties and senescence during bone aging. Aging Cell 2018, 17, e12709. [Google Scholar] [CrossRef] [PubMed]
- Jakovljevic, J.; Harrell, C.R.; Fellabaum, C.; Arsenijevic, A.; Jovicic, N.; Volarevic, V. Modulation of autophagy as new approach in mesenchymal stem cell-based therapy. Biomed. Pharmacother. 2018, 104, 404–410. [Google Scholar] [CrossRef] [PubMed]
- Vidoni, C.; Ferraresi, A.; Secomandi, E.; Vallino, L.; Gardin, C.; Zavan, B.; Mortellaro, C.; Isidoro, C. Autophagy drives osteogenic differentiation of human gingival mesenchymal stem cells. Cell Commun. Signal. 2019, 17, 98. [Google Scholar] [CrossRef] [PubMed]
- Yoneshima, E.; Okamoto, K.; Sakai, E.; Nishishita, K.; Yoshida, N.; Tsukuba, T. The Transcription Factor EB (TFEB) regulates osteoblast differentiation through ATF4/CHOP-dependent pathway. J. Cell. Physiol. 2016, 231, 1321–1333. [Google Scholar] [CrossRef] [PubMed]
- Pavlin, D.; Gluhak-Heinrich, J. Effect of mechanical loading on periodontal cells. Crit. Rev. Oral Biol. Med. 2001, 12, 414–424. [Google Scholar] [CrossRef]
- Pavlin, D.; Zadro, R.; Gluhak-Heinrich, J. Temporal pattern of stimulation of osteoblast-associated genes during mechanically-induced osteogenesis in vivo: Early responses of osteocalcin and type I collagen. Connect. Tissue Res. 2001, 42, 135–148. [Google Scholar] [CrossRef]
- Ribeiro, N.; Sousa, S.R.; Monteiro, F.J. Influence of crystallite size of nanophased hydroxyapatite on fibronectin and osteonectin adsorption and on MC3T3-E1 osteoblast adhesion and morphology. J. Colloid Interface Sci. 2010, 351, 398–406. [Google Scholar] [CrossRef]
- Nyman, J.S.; Makowski, A.J. The contribution of the extracellular matrix to the fracture resistance of bone. Curr. Osteoporos. Rep. 2012, 10, 169–177. [Google Scholar] [CrossRef]
- Klavert, J.; van der Eerden, B.C.J. Fibronectin in Fracture Healing: Biological Mechanisms and Regenerative Avenues. Front. Bioeng. Biotechnol. 2021, 9, 663357. [Google Scholar] [CrossRef]
- von Friesendorff, M.; McGuigan, F.E.; Wizert, A.; Rogmark, C.; Holmberg, A.H.; Woolf, A.D.; Akesson, K. Hip fracture, mortality risk, and cause of death over two decades. Osteoporos. Int. 2016, 27, 2945–2953. [Google Scholar] [CrossRef] [PubMed]
- Tran, T.; Bliuc, D.; Hansen, L.; Abrahamsen, B.; van den Bergh, J.; Eisman, J.A.; van Geel, T.; Geusens, P.; Vestergaard, P.; Nguyen, T.V.; et al. Persistence of Excess Mortality Following Individual Nonhip Fractures: A Relative Survival Analysis. J. Clin. Endocrinol. Metab. 2018, 103, 3205–3214. [Google Scholar] [CrossRef] [PubMed]
- Venter, C.; Niesler, C.U. Rapid quantification of cellular proliferation and migration using ImageJ. Biotechniques 2019, 66, 99–102. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Facchin, F.; Vitale, L.; Bianconi, E.; Piva, F.; Frabetti, F.; Strippoli, P.; Casadei, R.; Pelleri, M.C.; Piovesan, A.; Canaider, S. Complexity of bidirectional transcription and alternative splicing at human RCAN3 locus. PLoS ONE 2011, 6, e24508. [Google Scholar] [CrossRef]
- Beraudi, A.; Bianconi, E.; Catalani, S.; Canaider, S.; De Pasquale, D.; Apostoli, P.; Bordini, B.; Stea, S.; Toni, A.; Facchin, F. In vivo response of heme-oxygenase-1 to metal ions released from metal-on-metal hip prostheses. Mol. Med. Rep. 2016, 14, 474–480. [Google Scholar] [CrossRef]
- Pampanella, L.; Abruzzo, P.M.; Tassinari, R.; Alessandrini, A.; Petrocelli, G.; Ragazzini, G.; Cavallini, C.; Pizzuti, V.; Collura, N.; Canaider, S.; et al. Cytochalasin B influences cytoskeletal organization and osteogenic potential of human Wharton’s jelly mesenchymal stem cells. Pharmaceuticals 2023, 16, 289. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
72 h | |
---|---|
CTR | 96.9 ± 2.2 |
OXT 100 nM | 95.5 ± 1.4 |
OXT 500 nM | 95.3 ± 1.6 |
OXT 1000 nM | 95.4 ± 1.8 |
Gene | Entrez Gene ID * | Left Primer | Right Primer | Bio-Rad Unique Assay ID | A.L. (bp) $ |
---|---|---|---|---|---|
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) | 2597 | - | - | qHsaCED0038674 | 117 |
TATA box binding protein (TBP) | 6908 | - | - | qHsaCID0007122 | 120 |
Hypoxanthine phosphoribosyl transferase 1 (HPRT1) | 3251 | - | - | qHsaCID0016375 | 90 |
Ribosomal Protein L13a (RPL13a) | 23521 | TGAAGGAGTACCGCTCCAAAC | GGAGACTAGCGAAGGCTTTGA | - | 233 |
Oxytocin Receptor (OXTR) | 5021 | TCTTCTTCGTGCAGATGTGG | GGACGAGTTGCTCTTTTTGC | - | 236 |
Proliferation marker protein Ki-67 (MKI67) | 4288 | TCAGACTCCATGTGCCTGAG | TTGTCCTCAGCCTTCTTTGG | - | 134 |
Cyclin-dependent kinase inhibitor 2A (CDKN2A or p16INK4a) | 1029 | - | - | qHsaCED0056722 | 86 |
Cyclin-dependent kinase inhibitor 1A (CDKN1A or p21) | 1026 | - | - | qHsaCID0014498 | 159 |
Tumor protein p53 (TP53) | 7157 | - | - | qHsaCID0013658 | 126 |
Cyclin D1 (CCND1) | 595 | CAGATCATCCGCAAACACGC | AAGTTGTTGGGGCTCCTCAG | - | 143 |
BMI1 proto-oncogene, polycomb ring finger (BMI-1) | 648 | - | - | qHsaCED0046537 | 78 |
Telomerase reverse transcriptase (TERT) | 7015 | - | - | qHsaCID0009247 | 150 |
Beclin1 (BECN1) | 8678 | AACCAGATGCGTTATGCCCA | TCCATTCCACGGGAACACTG | - | 148 |
Microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A) | 84557 | TTGGTCAAGATCATCCGGCG | CCTGGGAGGCGTAGACCATA | - | 163 |
RUNX family transcription factor 2 (RUNX2) | 860 | CTCCCTGAACTCTGCACCAA | TAGAGTGGATGGACGGGGAC | - | 149 |
Peroxisome proliferator-activated receptor gamma (PPARγ) | 5468 | TTGCAGTGGGGATGTCTCAT | TTTCCTGTCAAGATCGCCCT | - | 208 |
Bone gamma-carboxyglutamic acid-containing protein (BGALP) | 632 | CACCGAGACACCATGAGAGC | CTGCTTGGACACAAAGGCT | - | 132 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Petrocelli, G.; Abruzzo, P.M.; Pampanella, L.; Tassinari, R.; Marini, S.; Zamagni, E.; Ventura, C.; Facchin, F.; Canaider, S. Oxytocin Modulates Osteogenic Commitment in Human Adipose-Derived Stem Cells. Int. J. Mol. Sci. 2023, 24, 10813. https://doi.org/10.3390/ijms241310813
Petrocelli G, Abruzzo PM, Pampanella L, Tassinari R, Marini S, Zamagni E, Ventura C, Facchin F, Canaider S. Oxytocin Modulates Osteogenic Commitment in Human Adipose-Derived Stem Cells. International Journal of Molecular Sciences. 2023; 24(13):10813. https://doi.org/10.3390/ijms241310813
Chicago/Turabian StylePetrocelli, Giovannamaria, Provvidenza Maria Abruzzo, Luca Pampanella, Riccardo Tassinari, Serena Marini, Elena Zamagni, Carlo Ventura, Federica Facchin, and Silvia Canaider. 2023. "Oxytocin Modulates Osteogenic Commitment in Human Adipose-Derived Stem Cells" International Journal of Molecular Sciences 24, no. 13: 10813. https://doi.org/10.3390/ijms241310813
APA StylePetrocelli, G., Abruzzo, P. M., Pampanella, L., Tassinari, R., Marini, S., Zamagni, E., Ventura, C., Facchin, F., & Canaider, S. (2023). Oxytocin Modulates Osteogenic Commitment in Human Adipose-Derived Stem Cells. International Journal of Molecular Sciences, 24(13), 10813. https://doi.org/10.3390/ijms241310813