Next Article in Journal
Investigation of the Role of a Zinc Uptake Regulator (Zur) in the Virulence of Pectobacterium odoriferum
Next Article in Special Issue
Quantitative Analysis of Isoform Switching in Cancer
Previous Article in Journal
DNA Damage Estimation after Chronic and Combined Exposure to Endocrine Disruptors: An In Vivo Real-Life Risk Simulation Approach
Previous Article in Special Issue
Impact of IDH Mutations, the 1p/19q Co-Deletion and the G-CIMP Status on Alternative Splicing in Diffuse Gliomas
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer

by
Spyridon Christodoulou
1,
Christina D. Sotiropoulou
2,
Panteleimon Vassiliu
1,
Nikolaos Danias
1,
Nikolaos Arkadopoulos
1,* and
Diamantis C. Sideris
2
1
Fourth Department of Surgery, University General Hospital “Attikon”, National and Kapodistrian University of Athens, 12462 Athens, Greece
2
Department of Biochemistry and Molecular Biology, Faculty of Biology, National and Kapodistrian University of Athens, 15701 Athens, Greece
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(12), 9990; https://doi.org/10.3390/ijms24129990
Submission received: 23 May 2023 / Revised: 7 June 2023 / Accepted: 9 June 2023 / Published: 10 June 2023

Abstract

Colorectal cancer (CRC) is the main cause of cancer-related deaths globally, highlighting the importance of accurate biomarkers for early detection and accurate prognosis. MicroRNAs (miRNAs) have emerged as effective cancer biomarkers. The aim of this study was to investigate the prognostic potential of miR-675-5p as a molecular prognostic biomarker in CRC. For this reason, a quantitative PCR assay was developed and applied to determine miR-675-5p expression in cDNAs from 218 primary CRC and 90 paired normal colorectal tissue samples. To assess the significance of miR-675-5p expression and its association with patient outcome, extensive biostatistical analysis was performed. miR-675-5p expression was found to be significantly downregulated in CRC tissue samples compared to that in adjacent normal colorectal tissues. Moreover, high miR-675-5p expression was associated with shorter disease-free (DFS) and overall survival (OS) in CRC patients, while it maintained its unfavorable prognostic value independently of other established prognostic factors. Furthermore, TNM stage stratification demonstrated that higher miR-675-5p levels were associated with shorter DFS and OS intervals, particularly in patients with CRC of TNM stage II or III. In conclusion, our findings suggest that miR-675-5p overexpression constitutes a promising molecular biomarker of unfavorable prognosis in CRC, independent of other established prognostic factors, including TNM staging.

1. Introduction

The majority of colorectal cancer (CRC) cases can be attributed to preventable risk factors, including smoking, being overweight or eating poorly, being inactive, and drinking excessively. The epidemiology of CRC differs between various geographical locations, as well as between various racial groups, genders, and ages. However, it is the leading cause of mortality in men under the age of 50 and ranks second overall in cancer-related deaths [1,2]. Progressive genetic mutations and related tissue damage characterize the multiyear, multistage, and multipath processes of CRC carcinogenesis. Adenocarcinoma is the histological subtype of colorectal cancer that is most frequently found. The effective treatment of patients with colorectal adenocarcinoma depends on early diagnosis, as well as the early detection of recurrence [3,4].
The spectrum of therapy options for early stages and advanced diseases has expanded as a result of our growing understanding of the pathophysiology of CRC. In addition to the use of palliative chemotherapy, immunotherapy, and targeted therapy, the treatment options for CRC encompass a range of approaches. These include endoscopic and surgical local excision, the administration of preoperative radiation and systemic therapy to reduce the tumor stage, extensive surgery for cases of locoregional and metastatic disease, and local ablative therapies for treating metastases [5]. The highest chance of survival remains for people with non-metastasized cancer, even if these new treatment choices have increased the overall survival for advanced disease. Additionally, the sensitivity and specificity of the tumor markers that are now available for the detection of CRC are very low [6]. Their usage is restricted to tracking patient responses to treatment and detecting relapses following surgery [7,8]. Therefore, it is essential to find new, trustworthy biomarkers for the early diagnosis, precise staging, and follow-up of CRC progression [9].
Non-coding RNAs (ncRNAs) have gathered much attention recently for their role in the control of gene expression, making them intriguing molecular markers for a number of human diseases [10,11]. It is well established that ncRNAs can control the pathogenesis of CRC in a variety of ways [12]. Specifically, ncRNAs have been classified into distinct types based on their length, structure, and location. The four main ncRNA types with various roles in malignancies are microRNA (miRNA), long ncRNA (lncRNA), circular RNA (circRNA), and PIWI-interacting RNA (piRNA) [13,14,15,16]. By opening a window into the influence of the non-coding regions of the genome, the discovery of ncRNAs has brought a new dimension to our understanding of how cancer arises and how it may be treated [17,18]. miRNAs are by far the species of ncRNAs that have been the subject of the greatest research in cancer. This ncRNA type offers a potent new path for the identification of novel genetic risk factors for cancer and plays a crucial role in influencing molecular and cellular processes of the cancer state [19].
The non-coding RNA molecules known as miRNAs are short (19–23 nucleotides) and operate as internal regulators of gene expression by binding to the 3′-UTR of target mRNAs to cause translational repression or mRNA cleavage. On rare occasions, miRNAs may attach to the 5′-UTR of target mRNAs or even the coding sequence of mRNAs, acting as activators of gene expression [13]. The Hippo, Notch, and WNT/β-catenin signaling pathways are only a few of the many pathways that miRNAs control, and their participation in CRC is crucial [20,21]. APC or CTNNB1 mutations typically result in the buildup of β-catenin, stimulating the WNT/β-catenin pathway and driving the evolution of CRC. For instance, it was reported that APC is a target of miR-135a, miR-135b, miR-942, and miR-494. APC is impacted adversely by miR-942, and miR-942 overexpression accelerates CRC development by inducing WNT/β-catenin signaling. Similar to this, miR-494 inhibits APC, causing-catenin to build up. Additionally, miRNAs control epithelial-to-mesenchymal transition (EMT) transcription factors, such as E-cadherin, N-cadherin, ZEB, SNAI1, and TWIST1, which can either promote or prevent the migration and invasion of different tumor cell types, including CRC [22].
Recent studies have highlighted the role of lncRNA H19 in the WNT/β-catenin pathway [23]. H19 can act as a miRNA sponge or epigenetic modulator, and it is a tank for miRNA-675 (miR-675-5p and miR-675-3p). By controlling numerous pathways involved in cell proliferation, EMT, and WNT/β-catenin signaling, miR-675-5p seems to have a crucial role in CRC. In particular, APC, GSK3, and TCF4 are among the WNT/β-catenin pathway targets of miR-675-5p, according to reports [24,25,26]. Furthermore, higher levels of miR-675-5p have been associated with increased sensitivity to chemotherapy drugs, such as 5-fluorouracil (5-FU) [27,28].
Prompted by these findings, we aimed to investigate the expression levels and potential molecular biomarker utility of miR-675-5p in CRC. Thus, we attempted to quantify this miRNA in 218 primary CRC tissue samples and 90 paired, adjacent normal colorectal tissue samples, which were tested using an in-house-developed quantitative PCR (qPCR) assay. Then, we conducted thorough biostatistics analyses of the potential relevance of miR-675-5p as a prognostic molecular tumor biomarker.

2. Results

2.1. The Expression Levels of miR-675-5p Are Lower in CRC Tissue Specimens Than in Adjacent Non-Cancerous Colorectal Tissue Specimens

The median age of CRC patients included in the current study was 67.5-year-old (range: 35–93; interquartile range: 58–75). Table 1 lists the clinicοpathological features of the patients that were included in this study. Most of the CRC patients had a tumor located in the colon. Among the 218 CRC patients, over half of them had received chemotherapy, while most of the patients were classified in histological grade II and TNM stage III groups.
miR-675-5-p levels in CRC tissues samples ranged from 0.61 to 48,781 RQU with a mean ± SEM of 2542 ± 496.7, while in non-cancerous tissues, the levels ranged from 0.71 to 81,457 RQU with a mean ± SEM of 5721 ± 1728 (Table 2). When comparing the distribution in the two cohorts, it was evident that miR-675-5p levels were significantly downregulated (p < 0.001) in most of the malignant tumors, when compared to their paired non-cancerous samples (76 out of 90 paired tissues; 84.4%) (Figure 1).

2.2. High Levels of miR-675-5p Predict an Unfavorable Outcome for CRC Patient Survival

The next step included examining any correlation between miR-675-5p levels and the DFS and OS of CRC patients. Regarding the DFS analysis, 176 CRC patients that did not present with distant metastasis were included. Among these, 62 patients (64.8%) were diagnosed with tumor recurrence during the follow-up intervals. For the OS analysis, 203 CRC patients with complete available follow-up data were included, while 94 CRC-related deaths (53.7%) were recorded within this cohort.
When conducting survival analysis, we observed that CRC patients with high levels of miR-675-5p had significantly lower DFS probabilities (p < 0.001) compared to patients with lower miR-675-5p levels (Figure 2A). Moreover, the unfavorable prognostic value of miR-675-5p was observed in OS analysis as well, where CRC patients with higher miR-675-5p levels had significantly shorter OS (p < 0.001) intervals (Figure 2B). These results were also confirmed through univariate bootstrap Cox regression analysis, which showed an HR of 3.18 (p = 0.001) for disease recurrence in CRC patients with high miR-675-5p levels (Table 3) and an HR of 4.28 (p = 0.001) for death associated with CRC, in comparison to the patient group with lower levels of miR-675-5p (Table 4).

2.3. miR-675-5p Expression Retains Its Unfavorable Prognostic Significance Independently of Other Eshtablished Prognostic Factors

Multivariate Cox regression models were adjusted for the tumor location, histological grade, and TNM stage, as well as for the type of treatment received after tumor resection (radiotherapy or chemotherapy). Next, bootstrapping in Cox regression was performed with 1000 samples and BCa 95% CIs, ensuring accurate HRs in the regression analysis. From the multivariate Cox regression analysis, it was evident that the significance of the miR-675-5p expression status for the prognosis of the patients’ DFS remained unaffected (HR = 3.07; bootstrap p < 0.001) when combined with the status of the aforementioned clinicopathological factors (Table 3). Moreover, miR-675-5p retained the prognostic significance regarding OS as well (HR = 3.87; bootstrap p < 0.001) when combined with the tumor location, histological grade, TNM stage status, and whether the patients had received radiotherapy or chemotherapy (Table 4).

2.4. miR-675-5p Is an Unfavorable Prognostic Marker in Distinct Subgroups of CRC Patients

When stratifying CRC patients according to the tumor location, we noticed that patients with colon tumors (n = 125 out of 175 for DFS and n = 139 out of 203 for OS) and high levels of miR-675-5p showed significantly shorter DFS intervals (p = 0.020) and OS intervals (p < 0.001) (Figure 3A,B). Similarly, as shown in Figure 3C,D, CRC patients with rectum tumors (n = 50 out of 175 for DFS and n = 64 out of 203 for OS) and low levels of miR-675-5p had significantly higher probabilities for both DFS (p = 0.006) and OS (p = 0.002).
Furthermore, we stratified CRC patients according to the TNM stage. For the DFS and OS analysis, 85 CRC patients had TNM stage II disease and 66 had TNM stage III disease. According to the Kaplan–Meier curves, patients with TNM stage II and III and high levels of miR-675-5p had worse DFS (p = 0.005 and p = 0.030, respectively), in contrast to patients with the same TNM stages and low levels of miR-675-5p (Figure 4A,B). Regarding CRC patients with TNM stage II, their OS time intervals were also significantly shorter when they expressed miR-675-5p at high levels (p = 0.004) (Figure 4C). Similarly, we found that CRC patients with TNM stage III and high levels of miR-675-5p had worse OS, as well (p < 0.001) (Figure 4D). However, for patients with TNM stage I, there were no significant outcomes from this analysis.

3. Discussion

Colorectal cancer (CRC) is considered a major public health concern globally, mainly due to its high incidence and fatality rates [1]. It is characterized by the unregulated proliferation of malignant cells in the colon or rectum, which results in tumor formation [8]. CRC ranks among the most prevalent and lethal malignancies worldwide [1,2]. For this reason, the early detection of CRC is crucial for successful treatment and improved patient survival rates. The development of effective biomarkers for the early detection and accurate prognosis of CRC is critical for improving patient outcomes [7]. Several biomarkers are currently used in clinical practice, including carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA 19-9), but their sensitivity and specificity remain inadequate [29,30]. As a result, there is an urgent need to discover novel and more effective biomarkers for CRC.
Non-coding RNAs, such as miRNAs, tRNA fragments, and long non-coding RNAs, including circular RNAs, comprise another large class of reliable molecular biomarkers in human malignancies [31], including CRC [32,33,34,35], yet none of all these putative cancer biomarkers have been prospectively validated in large studies regarding CRC patients and established in clinical routine, so far. Besides mRNAs that are known to constitute a rich source of potential biomarkers in CRC, with the prominent examples of kallikrein-related peptidases [36,37,38,39,40] and apoptosis-related [41,42,43] or stress-induced molecules [44,45], miRNAs have emerged as promising candidates for cancer biomarkers due to their involvement in various biological processes, including tumorigenesis, metastasis, and drug resistance [46,47]. These short non-coding RNA molecules influence gene expression at the post-transcriptional level and have been linked to the etiology of several malignancies, including colorectal cancer [22,48]. miRNAs exhibit unique expression profiles in different cancer types and stages, suggesting their potential as diagnostic and prognostic markers. In the context of CRC, identifying specific miRNAs that can accurately detect the disease at early stages and predict patient outcomes is of great interest [49,50,51,52,53,54,55]. A prevalent example is miR-675-5p, an miRNA with an established oncogenic role in CRC [56]. In particular, several studies have investigated the functional role of miR-675-5p in CRC, which is suggested to support hypoxia-induced EMT in colon cancer cells and promote CRC cell growth and drug resistance [24,26,27]. However, the clinical significance of miR-675-5p as a molecular marker has not been investigated yet. In this study, we examined the expression levels of miR-675-5p in CRC patient tumor samples and adjacent normal colorectal tissues, and we evaluated the prognostic potential of this miRNA as a biomarker for CRC.
Our research revealed that miR-675-5p levels in CRC tissues were much lower than those in corresponding non-cancerous tissues. The expression levels between the paired cancerous and non-cancerous specimens were significantly different. Increasing evidence and numerous studies have investigated the diagnostic value of miR-675-5p by evaluating its expression level. For example, in a study of miR-675-5p in paraffin-embedded breast cancer tissues, it was discovered that the expression of miR-675-5p was significantly higher in patients than in the control group, and there was no correlation between miR-675-5p expression levels and the age of patients or lymph node metastasis [57]. Additionally, miR-675-5p expression is significantly elevated in gastric cancer patients and could be a potential diagnostic marker [58]. It is important to note that in our study, according to the results of multivariate Cox regression analysis, the relevance of miR-675-5p expression status to patients’ DFS and OS prognosis remained unaffected when combined with the tumor location, histological grade, TNM stage status, and whether the patients had received radiotherapy or chemotherapy.
Based on our findings, poor prognosis for CRC patients is associated with high levels of miR-675-5p. The disease-free and overall survival intervals were significantly longer in patients with lower miR-675-5p levels. These data demonstrate that miR-675-5p could separate patients with a high risk of CRC recurrence and mortality. All of the above led to figuring out the potential of mir-675-5p as a prognostic biomarker in CRC. Furthermore, we investigated the prognostic value of miR-675-5p in CRC patients according to the TNM stage. We discovered that patients with TNM stage II had substantially shorter DFS and OS intervals when the miR-675-5p levels were elevated. In the same manner, the DFS and OS of patients with high levels of this miRNA and TNM stage III was worse, in comparison to patients to those in with low levels of miR-675-5p. Patients with CRC might have a wide range of prognoses, even within the same TNM stage. The DFS and OS of patients with TNM stage II-III CRC is affected by several factors besides tumor stage, such as tumor location, age, histological type, and sex [59]. As a result, miR-675-5p may be an inherent prognostic factor in different stages of CRC and could contribute to a better stratification system in CRC patients as an independent marker.
The distal colon, proximal colon, and rectum have historically been the three areas of the gut where CRCs have been described in the literature [60]. It should be emphasized that although the rectum belongs to the hindgut embryonically, it is occasionally characterized independently [61]. A variety of miRNAs have been characterized as tissue-specific biomarkers that improve the understanding of the molecular differences between these local tumors. For instance, hsa-miR-20a appears to have much higher expression levels in the rectum than in the colon. On the other hand, hsa-miR-145 has substantially higher expression levels in the colon than in the rectum [62]. In this study, higher expression levels of miR-675-5p in both the colon and rectum correlated with poor DFS and OS. Although this miRNA cannot be characterized as tissue-specific, the above evidence supports the idea that it is a promising prognostic biomarker independent of the tumor site. In CRC, it is also important to note that elevated serum miR-675-5p levels are linked to worse clinical outcomes [28], so the utility of miR-675-5p as a non-invasive biomarker is strengthened.
MiR-675-5p has an important role in the development and progression of several malignancies. By targeting tumor suppressors, the lncRNA H19-derived miR-675-5p is linked to the advancement of non-small cell lung cancer (NSCLC) [63]. In addition, miR-675-5p is associated with glycolysis reprogramming in oral cancer and is characterized as a hypoxia-regulated miRNA [64,65]. In this way, we were triggered to study its role in CRC survival outcomes. Costa et al. demonstrated that miR-675-5p is overexpressed in metastatic colon cancer cells, promoting EMT by controlling hypoxia-inducible factor 1 subunit alpha (HIF1a) [26]. In addition, the hypoxic tumor microenvironment in CRC induces the expression levels of miR-675-5p, thereby enhancing drug resistance [27]. It may seem counter-intuitive that miR-675-5p levels are downregulated in the majority of colorectal adenocarcinoma tissues compared to those in adjacent normal colorectal tissues, whereas miR-675-5p overexpression is being suggested as a predictor of adverse prognosis in this malignancy. Nonetheless, considering that miR-675-5p overexpression in CRC cells was shown to have an oncogenic role [56], it is tempting to speculate that an increase in miR-675-5p expression constitutes a late event in colorectal carcinogenesis. In fact, this miRNA could act as a double-edged sword in cancer cells. A similar contradiction constitutes miR-28-5p in CRC; in fact, although miR-28-5p is downregulated in colorectal tumors compared to their adjacent non-cancerous tissues, its high expression has been shown to predict the poor DFS and OS of colorectal adenocarcinoma patients, independently of clinicopathological prognosticators and standard patient treatment, including radiotherapy and chemotherapy [50]. Our findings highlight the significant role of miR-675-5p in the diagnosis and prognosis of CRC. The heterogeneity of this disease and the complicated molecular pathways associated with CRC progression render the discovery of novel biomarkers imperative. The unfavorable prognostic value of high miR-675-5p levels is important in clinical practice and may improve patient stratification.
Despite these encouraging results, it is important to note some limitations of this study. In order to highlight the molecular mechanism of miR-675-5p in CRC development and progression, in vivo experiments are required. Furthermore, validation based on a larger cohort with various clinical characteristics may provide a more comprehensive assessment of its biomarker utility. Last but not least, the heterogeneity of CRC urges the investigation of a panel of biomarkers, as a single biomarker might not adequately capture the complexities of CRC biology, which would restrict its therapeutic value.

4. Materials and Methods

4.1. Collection of Colorectal Tissue Samples

The colorectal tissue biobank used in this study included 218 primary colorectal adenocarcinoma specimens from patients who had surgery at the University General Hospital “Attikon” between 2000 and 2019. After the tumor was surgically removed, all cancer tissue samples were histologically evaluated by a pathologist and immediately frozen in liquid nitrogen. In 90 instances, a sample of normal colorectal tissue was also provided. This study was approved by the institutional ethics committee of the University General Hospital “Atikon” (approval number: 31; date 29 January 2009) and was conducted in accordance with the Helsinki Declaration. Each patient was informed about the study’s aims and consented to provide a sample.

4.2. Characteristics of Tumors and Survival Outcomes of the CRC Patient Cohort

The clinicopathological features documented and used in the current investigation included tumor size and location, histological grade, and TNM stage. The TNM classification includes tumor invasion (T), regional lymph node status (N), and the presence or absence of distant metastases (M). In addition to the events and cause of death, follow-up information included disease status (disease-free or recurrence), overall survival status (living or deceased), and disease status. Fifteen (15) of the 218 patients in our study were not included in the survival analysis because follow-up data were unavailable. Twenty-seven (27) patients out of the remaining 203 with complete follow-up data had distant metastasis (M1) at the time of tumor surgical excision and were thus excluded from the DFS analysis.

4.3. Cell Culture, Total RNA Isolation, In Vitro Polyadenylation, and cDNA Synthesis

The RPMI-1640 Medium was used to cultivate the human colorectal adenocarcinoma cell line DLD-1, which was modified to incorporate 10% fetal bovine serum, 100 kU/L penicillin, and 0.1 g/L streptomycin. According to the American Type Culture Collection (ATCC) recommendations, DLD-1 cells were cultured in an incubator at 37 °C with an adjusted CO2 concentration of 5%, before being trypsinized and collected for subsequent applications.
Next, a monophase solution of guanidine thiocyanate and phenol, which is distributed as TRI Reagent® (Molecular Research Center, Inc., Cincinnati, OH, USA), was used to homogenize and dissolve all tissue samples. According to the manufacturer’s recommendations, DLD-1 cells and homogenized colorectal tissues were used to isolate total RNA, which was then diluted in THE RNA Storage Solution (Life Technologies Ltd., Carlsbad, CA, USA) and stored in a deep freezer at −80 °C. A BioSpec-nano Micro-volume UV-Vis Spectrophotometer was used (Shimadju, Kyoto, Japan) for the spectrophotometrical measurement of the concentration and purity of the RNA, at 260 and 280 nm.
The next steps included total RNA polyadenylation and reverse transcription using an oligo-d(T) adapter primer (sequence: 5′-GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3′) to generate first-strand cDNA [66]. More specifically, a recombinant E. coli poly(A) polymerase (New England Biolabs Ltd., Whitby, ON, Canada) was used to polyadenylate the miRNAs, and as a primer for first-strand cDNA synthesis, an oligo-dT adapter was utilized. The oligo-dT adapter primer provides a universal priming site, allowing for the successful amplification of small non-coding RNAs.

4.4. Primer Design and Real-Time Quantitative Polymerase Chain Reaction (qPCR)

In order to detect miR-675-5p, specific forward primers were designed for the reference genes SNORD43 (RNU43) and SNORD48 (RNU48) (Table 5). Each forward primer was combined with a universal reverse primer that matches the oligo-dT-adapter used during cDNA synthesis to amplify the target sequences in quantitative PCR (qPCR). The qPCR reaction mixture contained 0.5 μL of 10-fold diluted cDNA from both the DLD-1 cell line and patient samples, 5 μL of KAPA™ SYBR® FAST qPCR master mix (2×) (Kapa Biosystems Inc., Woburn, MA, USA), 1 μL of each primer (final concentration: 200 nM), and 2.5 μL of RNase-free H2O. The qPCR experiment was performed on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems™, Thermo Fisher Scientific, Waltham, MA, USA), following the standard thermal cycling and melting procedure described previously [66].
The comparative threshold cycle (2−ΔΔCt) method was used to calculate the ratio of miR-675-5p molecules to the geometric mean of SNORD43 and SNORD48 molecules, to normalize the qPCR assays for the amount of RNA added to reverse transcription reactions, divided by the same ratio for the DLD-1 cDNA, which was used as a calibrator to allow results from different RT-qPCR runs to be compared. The normalized data were presented in relative quantification units (RQUs). As previously mentioned, all conditions needed for the 2−ΔΔCt method implementation were verified [67].

4.5. Biostatistics

The data analysis was conducted using IBM SPSS Statistics software (version 28) (IBM Corp., Armonk, NY, USA). The distribution of miR-675-5p levels in both non-cancerous and cancerous colorectal tissue samples deviated from a normal distribution. For this reason, non-parametric tests, such as the Mann–Whitney U test and Wilcoxon signed-rank test for paired samples, were employed to assess the significance of differences in miR-675-5p levels between these groups. Similarly, the Mann–Whitney U test or Kruskal–Wallis test was utilized to analyze variations in miR-675-5p levels among different patient subgroups based on clinicopathological features.
Next, Kaplan–Meier survival analysis was employed to investigate the association between patient outcomes, in terms of disease-free survival (DFS) and overall survival (OS), and miR-675-5p levels. Using the X-tile software (version 3.6.1), an appropriate prognostic cut-off value corresponding to the 31st percentile (4.00 RQU) was determined to categorize patients as high or low expressors of miR-675-5p. The Mantel–Cox (log-rank) test was utilized to assess differences in DFS and OS between the resulting Kaplan–Meier curves.
To validate the prognostic value of miR-675-5p levels and estimate the hazard ratio (HR) for disease recurrence and disease-related death, bootstrapped Cox regression analyses were performed with 1000 bootstrap samples for internal validation. The bootstrap bias-corrected and accelerated (BCa) method was used to calculate bootstrap p-values and 95% confidence intervals (CIs) for each estimated HR. Additionally, multivariate Cox regression models were constructed, adjusting for the most significant clinicopathological characteristics. The statistical significance level was set at p  <  0.050.

5. Conclusions

In conclusion, we demonstrate a statistically significant difference in the expression levels of miR-675-5p in CRC patients compared to those in non-cancerous adjacent tissues. We also demonstrated that miR-675-5p is an independent unfavorable prognostic biomarker for DFS and OS in CRC. Our results highlight the biological significance of miR-675-5p in CRC and raise the possibility of its utilization in clinical practice. Additional studies are necessary to thoroughly evaluate the potential of miR-675-5p as a prognostic biomarker in larger cohorts.

Author Contributions

Conceptualization, design, and supervision of the study, D.C.S.; methodology, S.C. and D.C.S.; investigation, C.D.S.; data curation, S.C.; formal analysis, C.D.S.; validation, S.C. and N.A.; visualization, C.D.S.; resources, S.C., P.V., N.D. and N.A.; writing–original draft preparation, S.C. and C.D.S.; writing–review and editing, N.A. and D.C.S.; funding acquisition, S.C.; project administration, D.C.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the institutional Ethics Committee of the University General Hospital “Attikon”, Athens, Greece (approval number: 31; date of approval: 29 January 2009).

Informed Consent Statement

Written informed consent was obtained from all patients.

Data Availability Statement

The data presented in this study are available on reasonable request from the corresponding authors.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Siegel, R.L.; Wagle, N.S.; Cercek, A.; Smith, R.A.; Jemal, A. Colorectal cancer statistics, 2023. CA Cancer J. Clin. 2023, 73, 233–254. [Google Scholar] [CrossRef] [Scilit]
  2. Baidoun, F.; Elshiwy, K.; Elkeraie, Y.; Merjaneh, Z.; Khoudari, G.; Sarmini, M.T.; Gad, M.; Al-Husseini, M.; Saad, A. Colorectal Cancer Epidemiology: Recent Trends and Impact on Outcomes. Curr. Drug Targets 2021, 22, 998–1009. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Kerimis, D.; Kontos, C.K.; Christodoulou, S.; Papadopoulos, I.N.; Scorilas, A. Elevated expression of miR-24-3p is a potentially adverse prognostic factor in colorectal adenocarcinoma. Clin. Biochem. 2017, 50, 285–292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Muller, M.F.; Ibrahim, A.E.; Arends, M.J. Molecular pathological classification of colorectal cancer. Virchows Arch. 2016, 469, 125–134. [Google Scholar] [CrossRef] [Scilit]
  5. Dekker, E.; Tanis, P.J.; Vleugels, J.L.A.; Kasi, P.M.; Wallace, M.B. Colorectal cancer. Lancet 2019, 394, 1467–1480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Papatsirou, M.; Artemaki, P.I.; Scorilas, A.; Kontos, C.K. The role of circular RNAs in therapy resistance of patients with solid tumors. Pers. Med. 2020, 17, 469–490. [Google Scholar] [CrossRef] [Scilit]
  7. Lech, G.; Slotwinski, R.; Slodkowski, M.; Krasnodebski, I.W. Colorectal cancer tumour markers and biomarkers: Recent therapeutic advances. World J. Gastroenterol. 2016, 22, 1745–1755. [Google Scholar] [CrossRef] [Scilit]
  8. Biller, L.H.; Schrag, D. Diagnosis and Treatment of Metastatic Colorectal Cancer: A Review. JAMA 2021, 325, 669–685. [Google Scholar] [CrossRef] [Scilit]
  9. Artemaki, P.I.; Papatsirou, M.; Boti, M.A.; Adamopoulos, P.G.; Christodoulou, S.; Vassilacopoulou, D.; Scorilas, A.; Kontos, C.K. Revised Exon Structure of l-DOPA Decarboxylase (DDC) Reveals Novel Splice Variants Associated with Colorectal Cancer Progression. Int. J. Mol. Sci. 2020, 21, 8568. [Google Scholar] [CrossRef] [Scilit]
  10. Slack, F.J.; Chinnaiyan, A.M. The Role of Non-coding RNAs in Oncology. Cell 2019, 179, 1033–1055. [Google Scholar] [CrossRef] [Scilit]
  11. Karousi, P.; Papanota, A.M.; Artemaki, P.I.; Liacos, C.I.; Patseas, D.; Mavrianou-Koutsoukou, N.; Liosi, A.A.; Kalioraki, M.A.; Ntanasis-Stathopoulos, I.; Gavriatopoulou, M.; et al. tRNA Derivatives in Multiple Myeloma: Investigation of the Potential Value of a tRNA-Derived Molecular Signature. Biomedicines 2021, 9, 1811. [Google Scholar] [CrossRef] [Scilit]
  12. Chen, L.; He, M.; Zhang, M.; Sun, Q.; Zeng, S.; Zhao, H.; Yang, H.; Liu, M.; Ren, S.; Meng, X.; et al. The Role of non-coding RNAs in colorectal cancer, with a focus on its autophagy. Pharmacol. Ther. 2021, 226, 107868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Liu, Y.; Liu, R.; Yang, F.; Cheng, R.; Chen, X.; Cui, S.; Gu, Y.; Sun, W.; You, C.; Liu, Z.; et al. miR-19a promotes colorectal cancer proliferation and migration by targeting TIA1. Mol. Cancer 2017, 16, 53. [Google Scholar] [CrossRef] [Scilit]
  14. Karousi, P.; Artemaki, P.I.; Sotiropoulou, C.D.; Christodoulou, S.; Scorilas, A.; Kontos, C.K. Identification of Two Novel Circular RNAs Deriving from BCL2L12 and Investigation of Their Potential Value as a Molecular Signature in Colorectal Cancer. Int. J. Mol. Sci. 2020, 21, 8867. [Google Scholar] [CrossRef] [Scilit]
  15. Papatsirou, M.; Diamantopoulos, M.A.; Katsaraki, K.; Kletsas, D.; Kontos, C.K.; Scorilas, A. Identification of Novel Circular RNAs of the Human Protein Arginine Methyltransferase 1 (PRMT1) Gene, Expressed in Breast Cancer Cells. Genes 2022, 13, 1133. [Google Scholar] [CrossRef] [Scilit]
  16. Papanota, A.M.; Karousi, P.; Kontos, C.K.; Artemaki, P.I.; Liacos, C.I.; Papadimitriou, M.A.; Bagratuni, T.; Eleutherakis-Papaiakovou, E.; Malandrakis, P.; Ntanasis-Stathopoulos, I.; et al. A Cancer-Related microRNA Signature Shows Biomarker Utility in Multiple Myeloma. Int. J. Mol. Sci. 2021, 22, 13144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Papatsirou, M.; Artemaki, P.I.; Karousi, P.; Scorilas, A.; Kontos, C.K. Circular RNAs: Emerging Regulators of the Major Signaling Pathways Involved in Cancer Progression. Cancers 2021, 13, 2744. [Google Scholar] [CrossRef] [Scilit]
  18. Papatsirou, M.; Adamopoulos, P.G.; Artemaki, P.I.; Georganti, V.P.; Scorilas, A.; Vassilacopoulou, D.; Kontos, C.K. Next-generation sequencing reveals alternative L-DOPA decarboxylase (DDC) splice variants bearing novel exons, in human hepatocellular and lung cancer cells. Gene 2021, 768, 145262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Smolarz, B.; Durczynski, A.; Romanowicz, H.; Szyllo, K.; Hogendorf, P. miRNAs in Cancer (Review of Literature). Int. J. Mol. Sci. 2022, 23, 2805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Wang, S.; Cheng, L.; Wu, H.; Li, G. Mechanisms and prospects of circular RNAs and their interacting signaling pathways in colorectal cancer. Front. Oncol. 2022, 12, 949656. [Google Scholar] [CrossRef] [Scilit]
  21. Das, P.K.; Islam, F.; Lam, A.K. The Roles of Cancer Stem Cells and Therapy Resistance in Colorectal Carcinoma. Cells 2020, 9, 1392. [Google Scholar] [CrossRef] [Scilit]
  22. Zhang, N.; Hu, X.; Du, Y.; Du, J. The role of miRNAs in colorectal cancer progression and chemoradiotherapy. Biomed. Pharmacother. 2021, 134, 111099. [Google Scholar] [CrossRef] [Scilit]
  23. Wu, K.F.; Liang, W.C.; Feng, L.; Pang, J.X.; Waye, M.M.; Zhang, J.F.; Fu, W.M. H19 mediates methotrexate resistance in colorectal cancer through activating Wnt/beta-catenin pathway. Exp. Cell. Res. 2017, 350, 312–317. [Google Scholar] [CrossRef] [Scilit]
  24. Yang, X.; Lou, Y.; Wang, M.; Liu, C.; Liu, Y.; Huang, W. miR-675 promotes colorectal cancer cell growth dependent on tumor suppressor DMTF1. Mol. Med. Rep. 2019, 19, 1481–1490. [Google Scholar] [CrossRef] [Scilit]
  25. Tsang, W.P.; Ng, E.K.; Ng, S.S.; Jin, H.; Yu, J.; Sung, J.J.; Kwok, T.T. Oncofetal H19-derived miR-675 regulates tumor suppressor RB in human colorectal cancer. Carcinogenesis 2010, 31, 350–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Costa, V.; Lo Dico, A.; Rizzo, A.; Rajata, F.; Tripodi, M.; Alessandro, R.; Conigliaro, A. MiR-675-5p supports hypoxia induced epithelial to mesenchymal transition in colon cancer cells. Oncotarget 2017, 8, 24292–24302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Zichittella, C.; Barreca, M.M.; Cordaro, A.; Corrado, C.; Alessandro, R.; Conigliaro, A. Mir-675-5p supports hypoxia-induced drug resistance in colorectal cancer cells. BMC Cancer 2022, 22, 567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Zhang, R.; Xu, J.; Zhao, J.; Liu, F. Upregulated serum miR-675 predicts poor prognosis for colorectal cancer. Int. J. Clin. Exp. Pathol 2017, 10, 8043–8049. [Google Scholar] [PubMed]
  29. Campos-da-Paz, M.; Dorea, J.G.; Galdino, A.S.; Lacava, Z.G.M.; de Fatima Menezes Almeida Santos, M. Carcinoembryonic Antigen (CEA) and Hepatic Metastasis in Colorectal Cancer: Update on Biomarker for Clinical and Biotechnological Approaches. Recent Pat. Biotechnol. 2018, 12, 269–279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Rao, H.; Wu, H.; Huang, Q.; Yu, Z.; Zhong, Z. Clinical Value of Serum CEA, CA24-2 and CA19-9 in Patients with Colorectal Cancer. Clin. Lab. 2021, 67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Kontos, C.K.; Adamopoulos, P.G.; Scorilas, A. Prognostic and predictive biomarkers in prostate cancer. Expert Rev. Mol. Diagn 2015, 15, 1567–1576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Tsiakanikas, P.; Adamopoulos, P.G.; Tsirba, D.; Artemaki, P.I.; Papadopoulos, I.N.; Kontos, C.K.; Scorilas, A. High Expression of a tRNA(Pro) Derivative Associates with Poor Survival and Independently Predicts Colorectal Cancer Recurrence. Biomedicines 2022, 10, 1120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Artemaki, P.I.; Kontos, C.K. Editorial for the Special Issue “Molecular Biomarkers in Colorectal Adenocarcinoma”. Int. J. Mol. Sci. 2021, 22, 2052. [Google Scholar] [CrossRef] [Scilit]
  34. Kontos, C.K.; Avgeris, M.; Vassilacopoulou, D.; Ardavanis, A.; Scorilas, A. Molecular Effects of Treatment of Human Colorectal Cancer Cells with Natural and Classical Chemotherapeutic Drugs: Alterations in the Expression of Apoptosis-related BCL2 Family Members, Including BCL2L12. Curr. Pharm. Biotechnol. 2018, 19, 1064–1075. [Google Scholar] [CrossRef] [Scilit]
  35. Artemaki, P.I.; Scorilas, A.; Kontos, C.K. Circular RNAs: A New Piece in the Colorectal Cancer Puzzle. Cancers 2020, 12, 2464. [Google Scholar] [CrossRef] [Scilit]
  36. Alexopoulou, D.K.; Kontos, C.K.; Christodoulou, S.; Papadopoulos, I.N.; Scorilas, A. KLK11 mRNA expression predicts poor disease-free and overall survival in colorectal adenocarcinoma patients. Biomark. Med. 2014, 8, 671–685. [Google Scholar] [CrossRef] [Scilit]
  37. Christodoulou, S.; Alexopoulou, D.K.; Kontos, C.K.; Scorilas, A.; Papadopoulos, I.N. Kallikrein-related peptidase-6 (KLK6) mRNA expression is an independent prognostic tissue biomarker of poor disease-free and overall survival in colorectal adenocarcinoma. Tumour Biol. 2014, 35, 4673–4685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Kontos, C.K.; Chantzis, D.; Papadopoulos, I.N.; Scorilas, A. Kallikrein-related peptidase 4 (KLK4) mRNA predicts short-term relapse in colorectal adenocarcinoma patients. Cancer Lett. 2013, 330, 106–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Kontos, C.K.; Mavridis, K.; Talieri, M.; Scorilas, A. Kallikrein-related peptidases (KLKs) in gastrointestinal cancer: Mechanistic and clinical aspects. Thromb. Haemost. 2013, 110, 450–457. [Google Scholar] [CrossRef] [Scilit]
  40. Kontos, C.K.; Scorilas, A. Kallikrein-related peptidases (KLKs): A gene family of novel cancer biomarkers. Clin. Chem. Lab. Med. 2012, 50, 1877–1891. [Google Scholar] [CrossRef] [Scilit]
  41. Kontos, C.K.; Papadopoulos, I.N.; Fragoulis, E.G.; Scorilas, A. Quantitative expression analysis and prognostic significance of L-DOPA decarboxylase in colorectal adenocarcinoma. Br. J. Cancer 2010, 102, 1384–1390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Kontos, C.K.; Papadopoulos, I.N.; Scorilas, A. Quantitative expression analysis and prognostic significance of the novel apoptosis-related gene BCL2L12 in colon cancer. Biol. Chem. 2008, 389, 1467–1475. [Google Scholar] [CrossRef] [Scilit]
  43. Kontos, C.K.; Christodoulou, M.I.; Scorilas, A. Apoptosis-related BCL2-family members: Key players in chemotherapy. Anticancer Agents Med. Chem. 2014, 14, 353–374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Artemaki, P.I.; Sklirou, A.D.; Kontos, C.K.; Liosi, A.A.; Gianniou, D.D.; Papadopoulos, I.N.; Trougakos, I.P.; Scorilas, A. High clusterin (CLU) mRNA expression levels in tumors of colorectal cancer patients predict a poor prognostic outcome. Clin. Biochem. 2020, 75, 62–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Kalioraki, M.A.; Artemaki, P.I.; Sklirou, A.D.; Kontos, C.K.; Adamopoulos, P.G.; Papadopoulos, I.N.; Trougakos, I.P.; Scorilas, A. Heat shock protein beta 3 (HSPB3) is an unfavorable molecular biomarker in colorectal adenocarcinoma. Mol. Carcinog. 2020, 59, 116–125. [Google Scholar] [CrossRef] [Scilit]
  46. Condrat, C.E.; Thompson, D.C.; Barbu, M.G.; Bugnar, O.L.; Boboc, A.; Cretoiu, D.; Suciu, N.; Cretoiu, S.M.; Voinea, S.C. miRNAs as Biomarkers in Disease: Latest Findings Regarding Their Role in Diagnosis and Prognosis. Cells 2020, 9, 276. [Google Scholar] [CrossRef] [Scilit]
  47. Skourti, E.; Logotheti, S.; Kontos, C.K.; Pavlopoulou, A.; Dimoragka, P.T.; Trougakos, I.P.; Gorgoulis, V.; Scorilas, A.; Michalopoulos, I.; Zoumpourlis, V. Progression of mouse skin carcinogenesis is associated with the orchestrated deregulation of mir-200 family members, mir-205 and their common targets. Mol. Carcinog. 2016, 55, 1229–1242. [Google Scholar] [CrossRef] [Scilit]
  48. Ferraro, A.; Kontos, C.K.; Boni, T.; Bantounas, I.; Siakouli, D.; Kosmidou, V.; Vlassi, M.; Spyridakis, Y.; Tsipras, I.; Zografos, G.; et al. Epigenetic regulation of miR-21 in colorectal cancer: ITGB4 as a novel miR-21 target and a three-gene network (miR-21-ITGBeta4-PDCD4) as predictor of metastatic tumor potential. Epigenetics 2014, 9, 129–141. [Google Scholar] [CrossRef] [Scilit]
  49. Diamantopoulos, M.A.; Kontos, C.K.; Kerimis, D.; Papadopoulos, I.N.; Scorilas, A. Upregulated miR-16 expression is an independent indicator of relapse and poor overall survival of colorectal adenocarcinoma patients. Clin. Chem. Lab. Med. 2017, 55, 737–747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Tsiakanikas, P.; Kontos, C.K.; Kerimis, D.; Papadopoulos, I.N.; Scorilas, A. High microRNA-28-5p expression in colorectal adenocarcinoma predicts short-term relapse of node-negative patients and poor overall survival of patients with non-metastatic disease. Clin. Chem. Lab. Med. 2018, 56, 990–1000. [Google Scholar] [CrossRef] [Scilit]
  51. Adamopoulos, P.G.; Kontos, C.K.; Rapti, S.M.; Papadopoulos, I.N.; Scorilas, A. miR-224 overexpression is a strong and independent prognosticator of short-term relapse and poor overall survival in colorectal adenocarcinoma. Int. J. Oncol. 2015, 46, 849–859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Kontos, C.K.; Tsiakanikas, P.; Avgeris, M.; Papadopoulos, I.N.; Scorilas, A. miR-15a-5p, A Novel Prognostic Biomarker, Predicting Recurrent Colorectal Adenocarcinoma. Mol. Diagn. Ther. 2017, 21, 453–464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Rapti, S.M.; Kontos, C.K.; Christodoulou, S.; Papadopoulos, I.N.; Scorilas, A. miR-34a overexpression predicts poor prognostic outcome in colorectal adenocarcinoma, independently of clinicopathological factors with established prognostic value. Clin. Biochem. 2017, 50, 918–924. [Google Scholar] [CrossRef] [Scilit]
  54. Rapti, S.M.; Kontos, C.K.; Papadopoulos, I.N.; Scorilas, A. Enhanced miR-182 transcription is a predictor of poor overall survival in colorectal adenocarcinoma patients. Clin. Chem. Lab. Med. 2014, 52, 1217–1227. [Google Scholar] [CrossRef] [Scilit]
  55. Rapti, S.M.; Kontos, C.K.; Papadopoulos, I.N.; Scorilas, A. High miR-96 levels in colorectal adenocarcinoma predict poor prognosis, particularly in patients without distant metastasis at the time of initial diagnosis. Tumour Biol. 2016, 37, 11815–11824. [Google Scholar] [CrossRef] [Scilit]
  56. Abo-Elela, D.A.; Salem, A.M.; Swellam, M.; Hegazy, M.G. Potential diagnostic role of circulating MiRNAs in colorectal cancer. Int. J. Immunopathol. Pharmacol. 2023, 37, 3946320221144565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Muller, V.; Oliveira-Ferrer, L.; Steinbach, B.; Pantel, K.; Schwarzenbach, H. Interplay of lncRNA H19/miR-675 and lncRNA NEAT1/miR-204 in breast cancer. Mol. Oncol. 2019, 13, 1137–1149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Ghaedi, H.; Mozaffari, M.A.N.; Salehi, Z.; Ghasemi, H.; Zadian, S.S.; Alipoor, S.; Hadianpour, S.; Alipoor, B. Co-expression profiling of plasma miRNAs and long noncoding RNAs in gastric cancer patients. Gene 2019, 687, 135–142. [Google Scholar] [CrossRef] [Scilit]
  59. Hu, Y.; Qi, Q.; Zheng, Y.; Wang, H.; Zhou, J.; Hao, Z.; Meng, J.; Liang, C. Nomogram for predicting the overall survival of patients with early-onset prostate cancer: A population-based retrospective study. Cancer Med. 2022, 11, 3260–3271. [Google Scholar] [CrossRef] [Scilit]
  60. Gervaz, P.; Bucher, P.; Morel, P. Two colons-two cancers: Paradigm shift and clinical implications. J. Surg. Oncol. 2004, 88, 261–266. [Google Scholar] [CrossRef] [Scilit]
  61. Stintzing, S.; Tejpar, S.; Gibbs, P.; Thiebach, L.; Lenz, H.J. Understanding the role of primary tumour localisation in colorectal cancer treatment and outcomes. Eur. J. Cancer 2017, 84, 69–80. [Google Scholar] [CrossRef] [Scilit]
  62. Eslamizadeh, S.; Zare, A.A.; Talebi, A.; Tabaeian, S.P.; Eshkiki, Z.S.; Heydari-Zarnagh, H.; Akbari, A. Differential Expression of miR-20a and miR-145 in Colorectal Tumors as Potential Location-specific miRNAs. microRNA 2021, 10, 66–73. [Google Scholar] [CrossRef] [Scilit]
  63. Zheng, Z.H.; Wu, D.M.; Fan, S.H.; Zhang, Z.F.; Chen, G.Q.; Lu, J. Upregulation of miR-675-5p induced by lncRNA H19 was associated with tumor progression and development by targeting tumor suppressor p53 in non-small cell lung cancer. J. Cell. Biochem. 2019, 120, 18724–18735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Yang, J.; Shi, X.; Yang, M.; Luo, J.; Gao, Q.; Wang, X.; Wu, Y.; Tian, Y.; Wu, F.; Zhou, H. Glycolysis reprogramming in cancer-associated fibroblasts promotes the growth of oral cancer through the lncRNA H19/miR-675-5p/PFKFB3 signaling pathway. Int. J. Oral Sci. 2021, 13, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Sawai, S.; Wong, P.F.; Ramasamy, T.S. Hypoxia-regulated microRNAs: The molecular drivers of tumor progression. Crit. Rev. Biochem. Mol. Biol. 2022, 57, 351–376. [Google Scholar] [CrossRef] [Scilit]
  66. Katsaraki, K.; Artemaki, P.I.; Papageorgiou, S.G.; Pappa, V.; Scorilas, A.; Kontos, C.K. Identification of a novel, internal tRNA-derived RNA fragment as a new prognostic and screening biomarker in chronic lymphocytic leukemia, using an innovative quantitative real-time PCR assay. Leuk. Res. 2019, 87, 106234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Karousi, P.; Katsaraki, K.; Papageorgiou, S.G.; Pappa, V.; Scorilas, A.; Kontos, C.K. Identification of a novel tRNA-derived RNA fragment exhibiting high prognostic potential in chronic lymphocytic leukemia. Hematol. Oncol. 2019, 37, 498–504. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Split violins illustrating the miR-675-5p expression levels in cancerous vs. normal adjacent colorectal tissues, after comparing 90 pairs of tissue specimens. The miR-675-5p expression levels were lower in most colorectal tumors. The p-value was calculated using the Wilcoxon signed-rank test.
Figure 1. Split violins illustrating the miR-675-5p expression levels in cancerous vs. normal adjacent colorectal tissues, after comparing 90 pairs of tissue specimens. The miR-675-5p expression levels were lower in most colorectal tumors. The p-value was calculated using the Wilcoxon signed-rank test.
Ijms 24 09990 g001
Figure 2. Kaplan–Meier survival curves for the disease-free survival (DFS) and overall survival (OS) of colorectal cancer (CRC) patients. Patients with tumors highly expressing miR-675-5p had significantly shorter DFS (A) and OS (B) time intervals than patients bearing tumors with low miR-675-5p levels. The p-values were calculated using the Mantel-Cox (log-rank) test.
Figure 2. Kaplan–Meier survival curves for the disease-free survival (DFS) and overall survival (OS) of colorectal cancer (CRC) patients. Patients with tumors highly expressing miR-675-5p had significantly shorter DFS (A) and OS (B) time intervals than patients bearing tumors with low miR-675-5p levels. The p-values were calculated using the Mantel-Cox (log-rank) test.
Ijms 24 09990 g002
Figure 3. Stratified Kaplan–Meier survival curves for the disease-free survival (DFS) and overall survival (OS) of colorectal cancer (CRC) patients, according to tumor location. Patients with colon tumors that highly expressed miR-675-5p had shorter DFS (A) and OS (B) time intervals than patients bearing colon tumors with low miR-675-5p levels. Moreover, CRC patients with a rectum tumor location overexpressing miR-675-5p had poorer DFS (C) and OS (D) time intervals than patients with lower levels of miR-675-5p. The p-values were calculated using the Mantel-Cox (log-rank) test.
Figure 3. Stratified Kaplan–Meier survival curves for the disease-free survival (DFS) and overall survival (OS) of colorectal cancer (CRC) patients, according to tumor location. Patients with colon tumors that highly expressed miR-675-5p had shorter DFS (A) and OS (B) time intervals than patients bearing colon tumors with low miR-675-5p levels. Moreover, CRC patients with a rectum tumor location overexpressing miR-675-5p had poorer DFS (C) and OS (D) time intervals than patients with lower levels of miR-675-5p. The p-values were calculated using the Mantel-Cox (log-rank) test.
Ijms 24 09990 g003
Figure 4. Stratified Kaplan–Meier survival curves for the disease-free survival (DFS) and overall survival (OS) of colorectal cancer (CRC) patients, according to TNM stage. Patients with tumors expressing a high level of miR-675-5p at TNM stages II (A) and III (B) had shorter DFS times than patients with tumors expressing a low level of miR-675-5p. Additionally, OS was worse for CRC patients with TNM stage II (C) or stage III (D) colorectal cancers overexpressing miR-675-5p compared to those with lower expression of this miRNA at the same TNM stage. The p-values were calculated using the Mantel–Cox (log-rank) test.
Figure 4. Stratified Kaplan–Meier survival curves for the disease-free survival (DFS) and overall survival (OS) of colorectal cancer (CRC) patients, according to TNM stage. Patients with tumors expressing a high level of miR-675-5p at TNM stages II (A) and III (B) had shorter DFS times than patients with tumors expressing a low level of miR-675-5p. Additionally, OS was worse for CRC patients with TNM stage II (C) or stage III (D) colorectal cancers overexpressing miR-675-5p compared to those with lower expression of this miRNA at the same TNM stage. The p-values were calculated using the Mantel–Cox (log-rank) test.
Ijms 24 09990 g004
Table 1. Clinicopathological characteristics of the tumors of colorectal cancer (CRC) patients included in the current study.
Table 1. Clinicopathological characteristics of the tumors of colorectal cancer (CRC) patients included in the current study.
Number of Patients (%)
Gender
Male114 (52.3%)
Female104 (47.7%)
Tumor location
Colon148 (67.9%)
Rectum70 (32.1%)
Histological grade
I19 (8.7%)
II167 (76.6%)
III32 (14.7%)
T (tumor invasion)
T16 (2.8%)
T226 (11.9%)
T3135 (61.9%)
T451 (23.4%)
N (nodal status)
N0122 (56.0%)
N157 (26.1%)
N239 (17.9%)
M (distant metastasis)
M0191 (87.6%)
M127 (12.4%)
TNM stage
I28 (12.8%)
II89 (40.8%)
III74 (34.0%)
IV27 (12.4%)
Radiotherapy
No169 (83.3%)
Yes34 (16.7%)
Chemotherapy
No86 (42.4%)
Yes117 (57.6%)
Abbreviation: TNM—tumor, node, and metastasis.
Table 2. miR-675-5p expression levels in tumors and normal colorectal tissue samples of colorectal cancer (CRC) patients.
Table 2. miR-675-5p expression levels in tumors and normal colorectal tissue samples of colorectal cancer (CRC) patients.
VariableMean ± SEMRangeQuartiles
1st2nd (Median)3rd
Normalized miR-675-5p expression (RQU)
    in cancerous tissues (n = 218)2542 ± 496.70.61–48,7813.2720.74692.4
    in normal tissues (n = 90)5721 ± 17280.71–81,4577.0319.65170.7
Abbreviations: RQU, relative quantification units; SEM, standard error of the mean.
Table 3. miR-675-5p expression and disease-free survival (DFS) of colorectal cancer (CRC) patients.
Table 3. miR-675-5p expression and disease-free survival (DFS) of colorectal cancer (CRC) patients.
CovariateHR 195% CI 2p-Value 395% Bootstrap BCa 4 CI 2Bootstrap p-Value 3
Univariate analysismiR-675-5p expression
    Low1.00
    High3.181.66–6.11<0.0011.86–6.86<0.001
    Tumor location
    Colon1.00
    Rectum1.751.06–2.910.0301.02–2.980.031
Histological grade
    I1.00
    II1.730.62–4.790.300.78–7.720.25
    III2.830.90–8.900.0751.01–18.430.049
TNM stage
    I1.00
    II4.281.01–18.110.0491.29–26.2600.048
    III9.612.31–40.000.0022.97–67.6690.004
Radiotherapy
    No1.00
    Yes1.811.02–3.190.0420.95–3.260.041
Chemotherapy
    No1.00
    Yes2.331.33–4.070.0031.39–4.420.004
Multivariate (n = 176)miR-675-5p expression
    Low1.00
    High3.071.59–5.92<0.0011.66–8.02<0.001
Tumor location
    Colon1.00
    Rectum2.691.34–5.400.0051.35–7.400.011
Histological grade
    I1.00
    II1.060.37–3.080.910.36–5.770.92
    III1.600.48–5.320.440.47–11.400.44
TNM stage
    I1.00
    II4.891.10–21.720.0371.46–39.6760.025
    III9.702.08–45.220.0043.04–105.60.004
Radiotherapy
    No1.00
    Yes0.490.22–1.090.0810.16–1.120.10
Chemotherapy
    No1.00
    Yes1.360.71–2.610.350.56–2.990.41
1 Hazard ratio, estimated from proportional hazard Cox regression. 2 Confidence interval of the estimated HR. 3 Statistically significant p-values are shown in italics. 4 Bias-corrected and accelerated.
Table 4. miR-675-5p expression and overall survival (OS) of colorectal cancer (CRC) patients.
Table 4. miR-675-5p expression and overall survival (OS) of colorectal cancer (CRC) patients.
CovariateHR 195% CI 2p-Value 395% Bootstrap BCa 4 CI 2Bootstrap p-Value 3
Univariate analysismiR-675-5p expression
    Low1.00
    High4.282.33–7.85<0.0012.53–9.26<0.001
Tumor location
    Colon1.00
    Rectum1.621.07–2.450.0221.03–2.450.020
Histological grade
    I1.00
    II1.350.62–2.940.450.66–3.870.46
    III2.531.06–6.020.0361.06–9.050.047
TNM stage
    I
    II2.550.89–7.320.0820.95–13.880.074
    III5.732.03–16.16<0.0012.31–30.43<0.001
    IV35.2411.88–104.5<0.00113.23–200.4<0.001
Radiotherapy
    No1.00
    Yes1.621.00–2.640.0510.94–2.630.058
Chemotherapy
    No1.00
    Yes1.841.19–2.850.0061.21–2.950.007
Multivariate (n = 203)miR-675-5p expression
    Low1.00
    High3.872.10–7.13<0.0012.42–7.95<0.001
Tumor location
    Colon1.00
    Rectum1.430.85–2.410.180.83–2.600.20
Histological grade
    I1.00
    II0.760.33–1.750.520.26–2.490.58
    III1.160.46–2.900.760.33–3.900.82
TNM stage
    I1.00
    II2.880.97–8.530.0561.05–19.540.045
    III6.792.20–20.99<0.0012.33–73.65<0.001
    IV39.1712.06–127.2<0.00114.27–417.8<0.001
Radiotherapy
    No1.00
    Yes1.080.57–2.020.820.53–2.010.83
Chemotherapy
    No1.00
    Yes0.780.46–1.330.360.41–1.400.39
1 Hazard ratio, estimated from proportional hazard Cox regression. 2 Confidence interval of the estimated HR. 3 Statistically significant p-values are shown in italics. 4 Bias-corrected and accelerated.
Table 5. Primer pairs used in real-time quantitative PCR (qPCR).
Table 5. Primer pairs used in real-time quantitative PCR (qPCR).
TargetPrimer Sequence (5′ to 3′)DirectionLength (nt)Tm (°C)
miR-675-5pGAGGCCCGGGTTCGATTCForward1862
SNORD43ACTTATTGACGGGCGGACA1959
SNORD48TGATGATGACCCCAGGTAACTCT2359
None (Universal primer)GCGAGCACAGAATTAATACGACReverse2256
Abbreviations: nt, nucleotides; Tm, melting temperature.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Christodoulou, S.; Sotiropoulou, C.D.; Vassiliu, P.; Danias, N.; Arkadopoulos, N.; Sideris, D.C. MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer. Int. J. Mol. Sci. 2023, 24, 9990. https://doi.org/10.3390/ijms24129990

AMA Style

Christodoulou S, Sotiropoulou CD, Vassiliu P, Danias N, Arkadopoulos N, Sideris DC. MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer. International Journal of Molecular Sciences. 2023; 24(12):9990. https://doi.org/10.3390/ijms24129990

Chicago/Turabian Style

Christodoulou, Spyridon, Christina D. Sotiropoulou, Panteleimon Vassiliu, Nikolaos Danias, Nikolaos Arkadopoulos, and Diamantis C. Sideris. 2023. "MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer" International Journal of Molecular Sciences 24, no. 12: 9990. https://doi.org/10.3390/ijms24129990

APA Style

Christodoulou, S., Sotiropoulou, C. D., Vassiliu, P., Danias, N., Arkadopoulos, N., & Sideris, D. C. (2023). MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer. International Journal of Molecular Sciences, 24(12), 9990. https://doi.org/10.3390/ijms24129990

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop