Influences of Jujube Witches’ Broom (JWB) Phytoplasma Infection and Oxytetracycline Hydrochloride Treatment on the Gene Expression Profiling in Jujube
Abstract
1. Introduction
2. Results
2.1. Chemotherapy Effects of Oxytetracycline Hydrochloride (OTC-HCl) on Jujube Witches’ Broom Disease (JWB)-Diseased Jujube Trees
2.2. RNA-Seq Results and Identification of Differentially Expressed Genes (DEGs)
2.3. Gene Ontology (GO) Enrichment Analysis Results of DEGs
2.4. Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis Results of DEGs
2.5. MapMan Annotation Results of DEGs
2.6. PageMan Enrichment Analysis Results of DEGs
2.7. Quantitative Real-Time PCR (qRT-PCR) Analysis Results
3. Discussion
3.1. Phytoplasma Infection Influenced Greatly the DNA and RNA Metabolisms and Signaling in Jujube Leaves
3.2. OTC-HCl Treatment Alleviated the Influences of Phytoplasma Infection on the Expression of Both Primary and Secondary Metabolites Metabolisms and Their Transportation-Related Genes
3.3. Phytohormones Play Important Roles in the Jujube–Phytoplasmas Interactions
4. Materials and Methods
4.1. Plant Materials and Antibiotics Used in this Study
4.2. OTC-HCl Treatments
4.3. RNA Isolation and Transcriptome Assembly
4.4. Identification of Differentially Expressed Genes (DEGs)
4.5. Enrichment Analysis of DEGs
4.6. Quantitative Real-Time PCR (qRT-PCR) Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, M.; Wang, J.; Wang, L.; Liu, P.; Zhao, J.; Zhao, Z.; Yao, S.; Stanica, F.; Liu, Z.; Wang, L.; et al. The historical and current research progress on jujube—A superfruit for the future. Hortic. Res. 2020, 7, 119. [Google Scholar] [CrossRef]
- Liu, M.; Zhao, J.; Cai, Q.; Liu, G.; Wang, J.; Zhao, Z.; Liu, P.; Dai, L.; Yan, G.; Wang, W.; et al. The complex jujube genome provides insights into fruit tree biology. Nat. Commun. 2014, 5, 5315. [Google Scholar] [CrossRef]
- Choi, S.H.; Ahn, J.B.; Kozukue, N.; Levin, C.E.; Friedman, M. Distribution of free amino acids, flavonoids, total phenolics, and antioxidative activities of Jujube (Ziziphus jujuba) fruits and seeds harvested from plants grown in Korea. J. Agric. Food Chem. 2011, 59, 6594–6604. [Google Scholar] [CrossRef]
- Uddin, N.; Muhammad, N.; Nisar, M.; Ali, N.; Ullah, R.; Ali, E.A.; Khan, A.A.; Rahman, I.U.; Khan, A. Distribution of polyphenolic compounds, antioxidant potential, and free amino acids in Ziziphus fruits extract; a study for determining the influence of wider geography. Food Sci. Nutr. 2022, 10, 1414–1430. [Google Scholar] [CrossRef]
- Sobhani, Z.; Nikoofal-Sahlabadi, S.; Amiri, M.S.; Ramezani, M.; Emami, S.A.; Sahebkar, A. Therapeutic effects of Ziziphus jujuba Mill. fruit in traditional and modern medicine: A review. Med. Chem. 2020, 16, 1069–1088. [Google Scholar] [CrossRef]
- Muhammad, N.; Luo, Z.; Yang, M.; Liu, Z.; Liu, M. The nutritional, medicinal, and drought-resistance properties of Ziziphus Mill. make it an important candidate for alleviating food insecurity in arid regions—A case of Pakistan. Horticulturae 2022, 8, 867. [Google Scholar] [CrossRef]
- Ebrahimi, S.; Mollaei, H.; Hoshyar, R. Ziziphus Jujube: A review study of its anticancer effects in various tumor models in vitro and in vivo. Cell. Mol. Biol. 2017, 63, 122–127. [Google Scholar] [CrossRef] [PubMed]
- Crawford, R.; Shan, F.C.; Mccarthy, A. Chinese jujube: A developing industry in australia. Acta Hortic. 2013, 993, 29–36. [Google Scholar] [CrossRef]
- Wang, L.; Liu, S.; Gao, M.; Wang, L.; Wang, L.; Wang, Y.; Dai, L.; Zhao, J.; Liu, M.; Liu, Z. The crosstalk of the salicylic acid and jasmonic acid signaling pathways contributed to different resistance to phytoplasma infection between the two genotypes in Chinese jujube. Front. Microbiol. 2022, 13, 800762. [Google Scholar] [CrossRef]
- Jung, H.Y.; Sawayanagi, T.; Kakizawa, S.; Nishigawa, H.; Wei, W.; Oshima, K.; Miyata, S.I.; Ugaki, M.; Hibi, T.; Namba, S. ‘Candidatus phytoplasma ziziphi’, a novel phytoplasma taxon associated with jujube witches’-broom disease. Int. J. Syst. Evol. Microbiol. 2003, 53, 1037–1041. [Google Scholar] [CrossRef] [PubMed]
- Oren, A.; Garrity, G.M.; Parker, C.T.; Chuvochina, M.; Trujillo, M.E. Lists of names of prokaryotic Candidatus taxa. Int. J. Syst. Evol. Microbiol. 2020, 70, 3956–4042. [Google Scholar] [CrossRef]
- Park, J.; Kim, H.; Huh, Y.H.; Kim, K.W. Ultrastructure of phytoplasma-infected jujube leaves with witches’ broom disease. Micron 2021, 148, 103108. [Google Scholar] [CrossRef]
- Lee, S.; Han, S.; Cha, B. Mixed infection of 16S rDNA I and V groups of phytoplasma in a single jujube tree. Plant Pathol. J. 2009, 25, 21–25. [Google Scholar] [CrossRef]
- Xue, C.; Liu, Z.; Dai, L. Changing host photosynthetic, carbohydrate, and energy metabolisms play important roles in phytoplasma infection. Phytopathology 2018, 108, 1067–1077. [Google Scholar] [CrossRef] [PubMed]
- Ye, X.; Wang, H.; Chen, P.; Fu, B.; Zhang, M.; Li, J.; Zheng, X.; Tan, B.; Feng, J. Combination of iTRAQ proteomics and RNA-seq transcriptomics reveals multiple levels of regulation in phytoplasma-infected Ziziphus jujuba Mill. Hortic. Res. 2017, 4, 17080. [Google Scholar] [CrossRef]
- Liu, Z.; Zhao, J.; Liu, M. Photosynthetic responses to phytoplasma infection in Chinese jujube. Plant Physiol. Biochem. 2016, 105, 12–20. [Google Scholar] [CrossRef]
- Wang, H.; Ye, X.; Li, J.; Tan, B.; Chen, P.; Jiang, Y.; Cheng, J.; Wang, W.; Zheng, X.; Feng, J. Combination of iTRAQ proteomics and RNA-seq transcriptomics reveals jasmonate-related-metabolisms central regulation during the process of jujube witches’ broom recovery by tetracycline treatment. Sci. Hortic. 2019, 243, 197–206. [Google Scholar] [CrossRef]
- Xie, N.; Yuan, Z.; Zhang, L.; Zhao, J.; Liu, M. Molecular cloning and expression of a novel eukaryotes elongation factor1A gene (ZjeEF-1α) from Chinese jujube in response to phytoplasma infection. Physiol. Mol. Plant Pathol. 2016, 96, 101–108. [Google Scholar] [CrossRef]
- Fan, X.P.; Liu, W.; Qiao, Y.S.; Shang, Y.J.; Wang, G.P.; Tian, X.; Han, Y.H.; Bertaccini, A. Comparative transcriptome analysis of Ziziphus jujuba infected by jujube witches’ broom phytoplasmas. Sci. Hortic. 2017, 226, 50–58. [Google Scholar] [CrossRef]
- Lee, S.H.; Kim, C.E.; Cha, B.J. Migration and distribution of graft-inoculated jujube witches’-broom phytoplasma within a Cantharanthus roseus plant. Plant Pathol. J. 2012, 28, 191–196. [Google Scholar] [CrossRef]
- Wang, J.; Song, L.; Jiao, Q.; Yang, S.; Gao, R.; Lu, X.; Zhou, G. Comparative genome analysis of jujube witches’-broom phytoplasma, an obligate pathogen that causes jujube witches’-broom disease. BMC Genomics 2018, 19, 689. [Google Scholar] [CrossRef]
- Linck, H.; Lankes, C.; Krüger, E.; Reineke, A. Elimination of phytoplasmas in Rubus mother plants by tissue culture coupled with heat therapy. Plant Dis. 2018, 103, 1252–1255. [Google Scholar] [CrossRef]
- Shen, Z.; Yang, J.; Ma, G.; Xue, X.; Guo, J.; Sun, X.; Lian, Y. Effect of different drugs dripped on prevention and cure of jujube witches’ broom disease. J. Shanxi Agric. Sci. 2018, 46, 1910–1914. [Google Scholar]
- Soto, N.; Humphries, A.R.; Mou, D.F.; Helmick, E.E.; Glover, J.P.; Bahder, B.W. Effect of oxytetracycline-hydrochloride on phytoplasma titer and symptom progression of the 16SrIV-D phytoplasma in cabbage palms from Florida. Plant Dis. 2020, 104, 2330–2337. [Google Scholar] [CrossRef] [PubMed]
- Bahder, B.W.; Helmick, E.E. Oxytetracycline Hydrochloride (OTC-HCl) Application for Control of Palm Phytoplasmas; UF/IFAS EDIS PublicationENY998; University of Florida: Gainesville, FL, USA, 2019. [Google Scholar]
- Distabanjong, C.; Distabanjong, K.; Woo, J.G.; Jang, S.W. Production of phytoplasma-free plants in sugarcane (Saccharum spp.) using temporary immersion bioreactor. Acta Hortic. 2018, 1205, 727–734. [Google Scholar] [CrossRef]
- Blume, B.; Nurnberger, T.; Nass, N.; Scheel, D. Receptor-mediated increase in cytoplasmic free calcium required for activation of pathogen defense in parsley. Plant Cell 2000, 12, 1425–1440. [Google Scholar] [CrossRef] [PubMed]
- Musetti, R.; Buxa, S.V.; De Marco, F.; Loschi, A.; Polizzotto, R.; Kogel, K.H.; van Bel, A.J. Phytoplasma-triggered Ca2+ influx is involved in sieve-tube blockage. Mol. Plant-Microbe Interact. 2013, 26, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.C.; Panstruga, R.; Elliott, C.; Müller, J.; Devoto, A.; Yoon, H.W.; Park, H.C.; Cho, M.J.; Schulze-Lefert, P. Calmodulin interacts with MLO protein to regulate defence against mildew in barley. Nature 2002, 416, 447–451. [Google Scholar] [CrossRef]
- Bei, X.; Wang, S.; Huang, X.; Zhang, X.; Zhou, J.; Zhang, H.; Li, G.; Cheng, C. Characterization of three tandem-duplicated calcium binding protein (CaBP) genes and promoters reveals their roles in the phytohormone and wounding responses in citrus. Int. J. Biol. Macromol. 2023, 227, 1162–1173. [Google Scholar] [CrossRef]
- Aldon, D.; Mbengue, M.; Mazars, C.; Galaud, J.-P. Calcium signalling in plant biotic interactions. Int. J. Mol. Sci. 2018, 19, 665. [Google Scholar] [CrossRef]
- Marcec, M.J.; Gilroy, S.; Poovaiah, B.W.; Tanaka, K. Mutual interplay of Ca2+ and ROS signaling in plant immune response. Plant Sci. 2019, 283, 343–354. [Google Scholar] [CrossRef]
- Xue, C.; Liu, Z.; Wang, L.; Li, H.; Gao, W.; Liu, M.; Zhao, Z.; Zhao, J. The antioxidant defense system in Chinese jujube is triggered to cope with phytoplasma invasion. Tree Physiol. 2020, 40, 1437–1449. [Google Scholar] [CrossRef]
- Panstruga, R. Serpentine plant MLO proteins as entry portals for powdery mildew fungi. Biochem. Soc. Trans. 2005, 33, 389–392. [Google Scholar] [CrossRef]
- Jha, S.K.; Sharma, M.; Pandey, G.K. Role of cyclic nucleotide gated channels in stress management in plants. Curr. Genomics 2016, 17, 315–329. [Google Scholar] [CrossRef]
- Moormann, J.; Heinemann, B.; Hildebrandt, T.M. News about amino acid metabolism in plant-microbe interactions. Trends Biochem. Sci. 2022, 47, 839–850. [Google Scholar] [CrossRef] [PubMed]
- Karunanithi, P.S.; Berrios, D.I.; Wang, S.; Davis, J.; Shen, T.; Fiehn, O.; Maloof, J.N.; Zerbe, P. The foxtail millet (Setaria italica) terpene synthase gene family. Plant J. 2020, 103, 781–800. [Google Scholar] [CrossRef] [PubMed]
- Yadav, H.; Dreher, D.; Athmer, B.; Porzel, A.; Gavrin, A.; Baldermann, S.; Tissier, A.; Hause, B. Medicago TERPENE SYNTHASE 10 is involved in defense against an Oomycete root pathogen. Plant Physiol. 2019, 180, 1598–1613. [Google Scholar] [CrossRef] [PubMed]
- Dermastia, M. Plant hormones in phytoplasma infected plants. Front. Plant Sci. 2019, 10, 477. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
- Florea, L.; Song, L.; Salzberg, S.L. Thousands of exon skipping events differentiate among splicing patterns in sixteen human tissues. F1000 Res. 2013, 2, 188. [Google Scholar] [CrossRef]
- Robinson, M.D.; Mccarthy, D.J.; Smyth, G.K. edgeR: A bioconductor package for differential expression analysis of digital gene expression data. Biogeosciences 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Bolger, M.; Schwacke, R.; Usadel, B. MapMan visualization of RNA-Seq data using Mercator4 functional annotations. Methods Mol. Biol. 2021, 2354, 195–212. [Google Scholar] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Sample | Total Reads | Mapped Reads | Unique Mapped Reads | Multiple Mapped Reads | Clean Bases | GC (%) | Q20 (%) | Q30 (%) |
---|---|---|---|---|---|---|---|---|
C1 | 40,246,416 | 34,584,165 (85.93%) | 30,208,421 (75.06%) | 4,375,744 (10.87%) | 6,004,362,814 | 45.49 | 97.18 | 92.48 |
C2 | 41,676,608 | 36,205,312 (86.87%) | 31,635,868 (75.91%) | 4,569,444 (10.96%) | 6,232,310,268 | 45.09 | 97.24 | 92.52 |
C3 | 42,367,776 | 36,592,177 (86.37%) | 32,020,841 (75.58%) | 4,571,336 (10.79%) | 6,342,330,282 | 44.5 | 97.35 | 92.66 |
D1 | 43,118,146 | 37,795,114 (87.65%) | 33,077,612 (76.71%) | 4,717,502 (10.94%) | 6,452,953,630 | 44.56 | 97.44 | 92.85 |
D2 | 43,524,986 | 38,115,993 (87.57%) | 33,306,163 (76.52%) | 4,809,830 (11.05%) | 6,515,843,862 | 44.74 | 97.54 | 93.14 |
D3 | 43,240,166 | 37,899,736 (87.65%) | 33,175,601 (76.72%) | 4,724,135 (10.93%) | 6,473,987,776 | 44.97 | 97.36 | 92.76 |
T1 | 39,165,042 | 33,404,398 (85.29%) | 28,961,978 (73.95%) | 4,442,420 (11.34%) | 5,828,462,420 | 45.33 | 97.12 | 92.15 |
T2 | 41,538,142 | 35,253,269 (84.87%) | 30,817,826 (74.19%) | 4,435,443 (10.68%) | 6,192,986,034 | 45.46 | 96.93 | 92.01 |
T3 | 42,794,538 | 37,476,631 (87.57%) | 32,751,477 (76.53%) | 4,725,154 (11.04%) | 6,409,198,938 | 44.77 | 97.12 | 92.19 |
Bin | Bin Description | Elements | p-Value in C vs. D | p-Value in C vs. T | p-Value in D vs. T |
---|---|---|---|---|---|
35 | not assigned | 196 | 7.21 × 10−1 | 8.79 × 10−1 | 9.89 × 10−1 |
26 | misc | 88 | 7.21 × 10−1 | 9.72 × 10−1 | 7.70 × 10−1 |
27 | RNA | 72 | 9.93 × 10−1 | 8.52 × 10−1 | 7.25 × 10−1 |
30 | signaling | 65 | 2.34 × 10−3 | 8.43 × 10−1 | 6.83 × 10−3 |
29 | protein | 62 | 9.72 × 10−1 | 6.57 × 10−1 | 7.58 × 10−1 |
20 | stress | 49 | 8.47 × 10−1 | 8.52 × 10−1 | 9.46 × 10−1 |
34 | transport | 42 | 4.93 × 10−3 | 6.02 × 10−1 | 2.33 × 10−4 |
16 | secondary metabolism | 37 | 8.44 × 10−1 | 8.33 × 10−1 | 9.46 × 10−1 |
17 | hormone metabolism | 37 | 7.86 × 10−1 | 4.83 × 10−1 | 7.54 × 10−1 |
28 | DNA | 22 | 2.34 × 10−3 | 9.72 × 10−1 | 4.65 × 10−2 |
10 | cell wall | 20 | 3.07 × 10−1 | 8.10 × 10−1 | 6.45 × 10−1 |
11 | lipid metabolism | 20 | 8.43 × 10−1 | 9.26 × 10−1 | 8.63 × 10−1 |
31 | cell | 19 | 7.21 × 10−1 | 9.75 × 10−1 | 7.70 × 10−1 |
1 | PS | 17 | 3.51 × 10−1 | 1.94 × 10−1 | 1.01× 10−2 |
33 | development | 16 | 7.33 × 10−1 | 6.57 × 10−1 | 9.46 × 10−1 |
13 | amino acid metabolism | 9 | 8.46 × 10−1 | 7.04 × 10−1 | 8.63 × 10−1 |
21 | redox | 9 | 7.21 × 10−1 | 9.88 × 10−1 | 7.43 × 10−1 |
23 | nucleotide metabolism | 7 | 7.21 × 10−1 | 8.13 × 10−1 | 5.89 × 10−1 |
18 | Cofactor and vitamin metabolism | 5 | 7.21 × 10−1 | 7.14 × 10−1 | 5.64 × 10−1 |
2 | major CHO metabolism | 3 | 7.21 × 10−1 | 9.75 × 10−1 | 8.90 × 10−1 |
4 | glycolysis | 3 | 7.36 × 10−1 | 7.04 × 10−1 | 9.63 × 10−1 |
9 | mitochondrial electron transport/ATP synthesis | 3 | 1.00 | 9.34 × 10−1 | 9.34 × 10−1 |
7 | OPP | 2 | 6.68 × 10−1 | 9.72 × 10−1 | 6.45 × 10−1 |
15 | metal handling | 2 | 9.44 × 10−1 | 9.76 × 10−1 | 9.89 × 10−1 |
24 | Biodegradation of Xenobiotics | 2 | 7.36 × 10−1 | 8.52 × 10−1 | 8.90 × 10−1 |
3 | minor CHO metabolism | 1 | 7.21 × 10−1 | 8.36 × 10−1 | 6.45 × 10−1 |
14 | S-assimilation | 1 | 8.01 × 10−1 | 9.26 × 10−1 | 8.19 × 10−1 |
22 | polyamine metabolism | 1 | 9.82 × 10−1 | 8.58 × 10−1 | 9.18 × 10−1 |
25 | C1-metabolism | 1 | 7.21 × 10−1 | 6.93 × 10−1 | 9.89 × 10−1 |
Gene Name | Gene ID | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|---|
Actin | - | CTTGCATCCCTCAGCACCTT | TCCTGTGGACAATGGATGGA |
CNGC | gene7282 | GATGCTTTTCATCACCCA | TGTGGTTTTGGAACCATC |
ABC2 | gene9336 | TGTGCAAGAGTTGAGGAA | TTCGCTGGACTCTGTATG |
GAD | gene11898 | GGTAGAGCTGAAAGAGGTA | GGCTGCTACACATATAGTG |
CaBP | gene13237 | GAGGAGCTTAACTGGCTA | CATGGTTTTCCCACAGAG |
TC | gene14697 | ACTGCAATAGGATTGATGG | GCTCGATGTATAGGAGTTG |
TS | gene14606 | CAGTCGGTATATTACTATTGGA | GCTTCTTAAAATATTCACCATTG |
DRP | gene25582 | GAGGGTTTCCAAGTCTCA | GCCTTTCGAGATGAGGTA |
Unknown | gene19644 | CTTGGTTTGGATGACTTTG | CCTCTTTCAAAACACTCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, J.; Shen, Z.; Qu, P.; Yang, R.; Shao, A.; Li, H.; Zhao, A.; Cheng, C. Influences of Jujube Witches’ Broom (JWB) Phytoplasma Infection and Oxytetracycline Hydrochloride Treatment on the Gene Expression Profiling in Jujube. Int. J. Mol. Sci. 2023, 24, 10313. https://doi.org/10.3390/ijms241210313
Yang J, Shen Z, Qu P, Yang R, Shao A, Li H, Zhao A, Cheng C. Influences of Jujube Witches’ Broom (JWB) Phytoplasma Infection and Oxytetracycline Hydrochloride Treatment on the Gene Expression Profiling in Jujube. International Journal of Molecular Sciences. 2023; 24(12):10313. https://doi.org/10.3390/ijms241210313
Chicago/Turabian StyleYang, Junqiang, Zhongmei Shen, Pengyan Qu, Rui Yang, Anping Shao, Hao Li, Ailing Zhao, and Chunzhen Cheng. 2023. "Influences of Jujube Witches’ Broom (JWB) Phytoplasma Infection and Oxytetracycline Hydrochloride Treatment on the Gene Expression Profiling in Jujube" International Journal of Molecular Sciences 24, no. 12: 10313. https://doi.org/10.3390/ijms241210313
APA StyleYang, J., Shen, Z., Qu, P., Yang, R., Shao, A., Li, H., Zhao, A., & Cheng, C. (2023). Influences of Jujube Witches’ Broom (JWB) Phytoplasma Infection and Oxytetracycline Hydrochloride Treatment on the Gene Expression Profiling in Jujube. International Journal of Molecular Sciences, 24(12), 10313. https://doi.org/10.3390/ijms241210313