Transcriptome Revealed the Macrophages Inflammatory Response Mechanism and NOD-like Receptor Characterization in Siberian Sturgeon (Acipenser baerii)
Abstract
:1. Introduction
2. Results
2.1. The Expression of Cytokines after LPS Treatment
2.2. Raw Sequence and De Novo Assembly
2.3. Functional Annotation
2.4. Principal Component Analysis (PCA) and Identification of DEGs
2.5. GO and KEGG Enrichment Analysis
2.6. The Analysis of the NOD-like Receptor Signaling Pathway
2.7. The Analysis of Sturgeon NLR
3. Discussion
4. Materials and Methods
4.1. Fish
4.2. Head Kidney Macrophages Culture and LPS Treatment
4.3. Quantitative Real-Time PCR (qRT-PCR)
4.4. RNA Isolation, mRNA Library Construction, and Sequencing
4.5. Transcriptome Processing and Assembly
4.6. Gene Annotation and Classification
4.7. Identification of Differentially Expressed Genes (DEGs) and Enrichment Analysis
4.8. NLR Scan and Analysis
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Arulselvan, P.; Fard, M.T.; Tan, W.S.; Gothai, S.; Fakurazi, S.; Norhaizan, M.E.; Kumar, S.S. Role of Antioxidants and Natural Products in Inflammation. Oxid. Med. Cell. Longev. 2016, 2016, 5276130. [Google Scholar] [CrossRef] [PubMed]
- Verburg-van Kemenade, B.M.; Ribeiro, C.M.; Chadzinska, M. Neuroendocrine-immune interaction in fish: Differential regulation of phagocyte activity by neuroendocrine factors. Gen. Comp. Endocrinol. 2011, 172, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Cao, S.Q.; Lin, Z.M.; He, S.J.; Zuo, J.P. NOD-like receptors in autoimmune diseases. Acta Pharmacol. Sin. 2021, 42, 1742–1756. [Google Scholar] [CrossRef] [PubMed]
- Hayden, M.S.; Ghosh, S. NF-κB in immunobiology. Cell Res. 2011, 21, 223–244. [Google Scholar] [CrossRef]
- Kaparakis, M.; Philpott, D.J.; Ferrero, R.L. Mammalian NLR proteins; discriminating foe from friend. Immunol. Cell Biol. 2007, 85, 495–502. [Google Scholar] [CrossRef]
- Robertson, S.J.; Rubino, S.J.; Geddes, K.; Philpott, D.J. Examining host-microbial interactions through the lens of NOD: From plants to mammals. Semin. Immunol. 2012, 24, 9–16. [Google Scholar] [CrossRef]
- Sahoo, B.R. Structure of fish Toll-like receptors (TLR) and NOD-like receptors (NLR). Int. J. Biol. Macromol. 2020, 161, 1602–1617. [Google Scholar] [CrossRef]
- Ting, J.P.; Lovering, R.C.; Alnemri, E.S.; Bertin, J.; Boss, J.M.; Davis, B.K.; Flavell, R.A.; Girardin, S.E.; Godzik, A.; Harton, J.A.; et al. The NLR gene family: A standard nomenclature. Immunity 2008, 28, 285–287. [Google Scholar] [CrossRef]
- Kim, Y.K.; Shin, J.S.; Nahm, M.H. NOD-Like Receptors in Infection, Immunity, and Diseases. Yonsei Med. J. 2016, 57, 5–14. [Google Scholar] [CrossRef]
- Chang, M.X.; Xiong, F.; Wu, X.M.; Hu, Y.W. The expanding and function of NLRC3 or NLRC3-like in teleost fish: Recent advances and novel insights. Dev. Comp. Immunol. 2021, 114, 103859. [Google Scholar] [CrossRef]
- Howe, K.; Schiffer, P.H.; Zielinski, J.; Wiehe, T.; Laird, G.K.; Marioni, J.C.; Soylemez, O.; Kondrashov, F.; Leptin, M. Structure and evolutionary history of a large family of NLR proteins in the zebrafish. Open Biol. 2016, 6, 160009. [Google Scholar] [CrossRef] [PubMed]
- Rajendran, K.V.; Zhang, J.; Liu, S.; Kucuktas, H.; Wang, X.; Liu, H.; Sha, Z.; Terhune, J.; Peatman, E.; Liu, Z. Pathogen recognition receptors in channel catfish: I. Identification, phylogeny and expression of NOD-like receptors. Dev. Comp. Immunol. 2012, 37, 77–86. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Chu, Q.; Xu, T. A genome-wide survey of expansive NLR-C subfamily in miiuy croaker and characterization of the NLR-B30.2 genes. Dev. Comp. Immunol. 2016, 61, 116–125. [Google Scholar] [CrossRef]
- Xu, T.; Liao, Z.; Su, J. Pattern recognition receptors in grass carp Ctenopharyngodon idella: II. Organization and expression analysis of NOD-like receptors. Dev. Comp. Immunol. 2020, 110, 103734. [Google Scholar] [CrossRef]
- Cao, M.; Yan, X.; Li, Q.; Fu, Q.; Yang, N.; Song, L.; Li, C. Genome-wide identification and analysis of NOD-like receptors and their potential roles in response to Edwardsiella tarda infection in black rockfish (Sebastes schlegelii). Aquaculture 2021, 541, 736803. [Google Scholar] [CrossRef]
- Chen, Z.; Xu, X.; Wang, J.; Zhou, Q.; Chen, S. A genome-wide survey of NOD-like receptors in Chinese tongue sole (Cynoglossus semilaevis): Identification, characterization and expression analysis in response to bacterial infection. J. Fish Biol. 2021, 99, 1786–1797. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Cao, M.; Li, Q.; Yan, X.; Xue, T.; Song, L.; Su, B.; Li, C. Genome-wide identification of NOD-like receptors and their expression profiling in mucosal tissues of turbot (Scophthalmus maximus L.) upon bacteria challenge. Mol. Immunol. 2021, 134, 48–61. [Google Scholar] [CrossRef]
- Liu, J.; Lu, L.; Liu, L.; Chen, D.; Yang, F.; Geng, Y.; Li, Z.; Huang, X.; Ouyang, P.; Wang, J.; et al. Genomic structure and molecular characterization of NLRC3-like from Siberian sturgeon (Acipenser baerii) and expression response to Streptococcus iniae and pathogen-associated molecular patterns. Fish Shellfish Immunol. Rep. 2021, 2, 100042. [Google Scholar] [CrossRef]
- Li, Q.; Cui, K.; Wu, M.; Xu, D.; Mai, K.; Ai, Q. Polyunsaturated Fatty Acids Influence LPS-Induced Inflammation of Fish Macrophages through Differential Modulation of Pathogen Recognition and p38 MAPK/NF-κB Signaling. Front. Immunol. 2020, 11, 559332. [Google Scholar] [CrossRef]
- Hu, Y.; Wei, X.; Liao, Z.; Gao, Y.; Liu, X.; Su, J.; Yuan, G. Transcriptome Analysis Provides Insights into the Markers of Resting and LPS-Activated Macrophages in Grass Carp (Ctenopharyngodon idella). Int. J. Mol. Sci. 2018, 19, 3562. [Google Scholar] [CrossRef]
- Li, P.; Ye, J.; Zeng, S.; Yang, C. Florfenicol alleviated lipopolysaccharide (LPS)-induced inflammatory responses in Ctenopharyngodon idella through inhibiting toll/NF-κB signaling pathways. Fish Shellfish Immunol. 2019, 94, 479–484. [Google Scholar] [CrossRef] [PubMed]
- Zhao, E.Y.; Jones, M.; Jones, S.J.M. Whole-Genome Sequencing in Cancer. Cold Spring Harb. Perspect. Med. 2019, 9, a034579. [Google Scholar] [CrossRef] [PubMed]
- Saeidian, A.H.; Youssefian, L.; Vahidnezhad, H.; Uitto, J. Research Techniques Made Simple: Whole-Transcriptome Sequencing by RNA-Seq for Diagnosis of Monogenic Disorders. J. Investig. Dermatol. 2020, 140, 1117–1126.e1111. [Google Scholar] [CrossRef] [PubMed]
- Westermann, A.J.; Vogel, J. Cross-species RNA-seq for deciphering host-microbe interactions. Nat. Rev. Genet. 2021, 22, 361–378. [Google Scholar] [CrossRef]
- Zhang, Z.; Fu, Y.; Shen, F.; Zhang, Z.; Guo, H.; Zhang, X. Barren environment damages cognitive abilities in fish: Behavioral and transcriptome mechanisms. Sci. Total Environ. 2021, 794, 148805. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Xia, P.; Wu, J.; Huang, A.; Bu, G.; Meng, F.; Kong, F.; Cao, X.; Han, X.; Yu, G.; et al. The potential sensing molecules and signal cascades for protecting teleost fishes against lipopolysaccharide. Fish Shellfish Immunol. 2020, 97, 235–247. [Google Scholar] [CrossRef]
- Lu, Y.; Su, F.; Li, Q.; Zhang, J.; Li, Y.; Tang, T.; Hu, Q.; Yu, X.Q. Pattern recognition receptors in Drosophila immune responses. Dev. Comp. Immunol. 2020, 102, 103468. [Google Scholar] [CrossRef]
- Palti, Y. Toll-like receptors in bony fish: From genomics to function. Dev. Comp. Immunol. 2011, 35, 1263–1272. [Google Scholar] [CrossRef]
- Zhang, L.; Gao, Z.; Yu, L.; Zhang, B.; Wang, J.; Zhou, J. Nucleotide-binding and oligomerization domain (NOD)-like receptors in teleost fish: Current knowledge and future perspectives. J. Fish Dis. 2018, 41, 1317–1330. [Google Scholar] [CrossRef]
- Chang, M.X. The negative regulation of retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) signaling pathway in fish. Dev. Comp. Immunol. 2021, 119, 104038. [Google Scholar] [CrossRef]
- Mojzesz, M.; Rakus, K.; Chadzinska, M.; Nakagami, K.; Biswas, G.; Sakai, M.; Hikima, J.I. Cytosolic Sensors for Pathogenic Viral and Bacterial Nucleic Acids in Fish. Int. J. Mol. Sci. 2020, 21, 7289. [Google Scholar] [CrossRef] [PubMed]
- Petit, J.; Bailey, E.C.; Wheeler, R.T.; de Oliveira, C.A.F.; Forlenza, M.; Wiegertjes, G.F. Studies Into β-Glucan Recognition in Fish Suggests a Key Role for the C-Type Lectin Pathway. Front. Immunol. 2019, 10, 280. [Google Scholar] [CrossRef] [PubMed]
- Hui, F.; Guo, S.; Liu, J.; Li, M.; Geng, M.; Xia, Y.; Liu, X.; Li, Q.; Li, J.; Zhu, T. Genome-wide identification and characterization of NLR genes in lamprey (Lethenteron reissneri) and their responses to lipopolysaccharide/poly(I:C) challenge. Mol. Immunol. 2022, 143, 122–134. [Google Scholar] [CrossRef] [PubMed]
- Hibino, T.; Loza-Coll, M.; Messier, C.; Majeske, A.J.; Cohen, A.H.; Terwilliger, D.P.; Buckley, K.M.; Brockton, V.; Nair, S.V.; Berney, K.; et al. The immune gene repertoire encoded in the purple sea urchin genome. Dev. Biol. 2006, 300, 349–365. [Google Scholar] [CrossRef] [PubMed]
- Schneider, M.; Zimmermann, A.G.; Roberts, R.A.; Zhang, L.; Swanson, K.V.; Wen, H.; Davis, B.K.; Allen, I.C.; Holl, E.K.; Ye, Z.; et al. The innate immune sensor NLRC3 attenuates Toll-like receptor signaling via modification of the signaling adaptor TRAF6 and transcription factor NF-κB. Nat. Immunol. 2012, 13, 823–831. [Google Scholar] [CrossRef]
- Li, Z.-T.; Liu, H.; Zhang, W.-Q. NLRC3 alleviates hypoxia/reoxygenation induced inflammation in RAW264.7 cells by inhibiting K63-linked ubiquitination of TRAF6. Hepatobiliary Pancreat. Dis. Int. 2020, 19, 455–460. [Google Scholar] [CrossRef] [PubMed]
- Shiau, C.E.; Monk, K.R.; Joo, W.; Talbot, W.S. An anti-inflammatory NOD-like receptor is required for microglia development. Cell Rep. 2013, 5, 1342–1352. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Wang, H.; Wang, J.; Wang, X.; Peng, S.; Geng, Y.; Wang, K.; Ouyang, P.; Li, Z.; Huang, X.; et al. Identification and characterization of a β-defensin gene involved in the immune defense response of channel catfish, Ictalurus punctatus. Mol. Immunol. 2017, 85, 256–264. [Google Scholar] [CrossRef]
Sample | Raw Reads | Clean Reads | Clean Bases | Error Rate (%) | Q30 (%) | GC Content (%) |
---|---|---|---|---|---|---|
PBS_1 | 46,677,332 | 45,822,444 | 6.35 G | 0.0255 | 93.80 | 46.64 |
PBS_2 | 44,472,856 | 43,771,700 | 6.06 G | 0.0253 | 93.93 | 48.97 |
PBS_3 | 42,289,914 | 41,679,648 | 5.75 G | 0.0253 | 93.97 | 47.31 |
PBS_4 | 43,448,798 | 42,727,782 | 6.32 G | 0.0255 | 93.82 | 26.9 |
LPS_1 | 41,257,692 | 40,638,064 | 5.61 G | 0.0251 | 94.22 | 47.36 |
LPS_2 | 43,363,986 | 42,547,796 | 6.30 G | 0.0254 | 93.87 | 49.02 |
LPS_3 | 41,645,024 | 41,011,368 | 5.67 G | 0.025 | 94.28 | 48.53 |
LPS_4 | 52,862,782 | 52,064,962 | 7.16 G | 0.0251 | 94.20 | 47.94 |
Database | Unigenes | Percentage (%) |
---|---|---|
GO | 28,060 | 78.67 |
KEGG | 24,675 | 69.18 |
COG | 32,495 | 91.10 |
NR | 34,336 | 96.27 |
Swiss-Prot | 32,148 | 90.13 |
Pfam | 30,373 | 85.15 |
Total annotation | 34,484 | 96.68 |
Total unigenes | 35,668 | 100 |
Gene Name | Primer Sequence (5′-3′) | Actual Tm (°C) | Product (bp) |
---|---|---|---|
IL-1β-F | TGATGAACGAGCTGGATGGG | 57.1 | 114 |
IL-1β-R | GCTGGGTCTGCGGTATGTAG | ||
TNF-α-F | TCGCCGGACTTCACAATAGG | 58.9 | 114 |
TNF-α-R | GCTTGCTCGCCAGTTGTTTT | ||
IL-8-F | GGTGCAAATTCTCCCAGCAAA | 61.4 | 107 |
IL-8-R | AACTCCACTCCCAAAGGAGC | ||
TGF-β-F | ATTCAGAACTATAAGACCCCCC | 63.3 | 161 |
TGF-β-R | CGGAAGTCAATGTAAAGAGGC | ||
β-actin-F | GTTGGTATGGGACAGAAGGACA | 61.4 | 105 |
β-actin-R | CCAGTTGGTAACAATGCCGT | ||
GADPH-F | TGTGGGCATCAATGGATTTGG | 60.5 | 119 |
GADPH-R | ACACCATGTATTCCGGGTCAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, D.; Chen, Y.; Lu, L.; Zhu, H.; Zhang, X.; Huang, X.; Li, Z.; Ouyang, P.; Zhang, X.; Li, L.; et al. Transcriptome Revealed the Macrophages Inflammatory Response Mechanism and NOD-like Receptor Characterization in Siberian Sturgeon (Acipenser baerii). Int. J. Mol. Sci. 2023, 24, 9518. https://doi.org/10.3390/ijms24119518
Chen D, Chen Y, Lu L, Zhu H, Zhang X, Huang X, Li Z, Ouyang P, Zhang X, Li L, et al. Transcriptome Revealed the Macrophages Inflammatory Response Mechanism and NOD-like Receptor Characterization in Siberian Sturgeon (Acipenser baerii). International Journal of Molecular Sciences. 2023; 24(11):9518. https://doi.org/10.3390/ijms24119518
Chicago/Turabian StyleChen, Defang, Yinqiu Chen, Lu Lu, Hao Zhu, Xin Zhang, Xiaoli Huang, Zhiqiong Li, Ping Ouyang, Xiaoli Zhang, Liangyu Li, and et al. 2023. "Transcriptome Revealed the Macrophages Inflammatory Response Mechanism and NOD-like Receptor Characterization in Siberian Sturgeon (Acipenser baerii)" International Journal of Molecular Sciences 24, no. 11: 9518. https://doi.org/10.3390/ijms24119518
APA StyleChen, D., Chen, Y., Lu, L., Zhu, H., Zhang, X., Huang, X., Li, Z., Ouyang, P., Zhang, X., Li, L., & Geng, Y. (2023). Transcriptome Revealed the Macrophages Inflammatory Response Mechanism and NOD-like Receptor Characterization in Siberian Sturgeon (Acipenser baerii). International Journal of Molecular Sciences, 24(11), 9518. https://doi.org/10.3390/ijms24119518