Cathepsin L Contributes to Reproductive Diapause by Regulating Lipid Storage and Survival of Coccinella septempunctata (Linnaeus)
Abstract
1. Introduction
2. Results
2.1. Molecular Cloning and Sequence Analysis of the CsCatL Gene
2.2. Stage-Specific Transcript Abundance of the CsCatL Gene in the Diapause Induction Phase and Non-Diapausing Phase
2.3. Phenotypes of Females Abdomen and Ovary and Triglycerides Content in D9 and N9
2.4. Silencing the CsCatL Gene Reduced Lipid Accumulation in Diapause-Destined Adults of C. septempunctata
2.5. Silencing of the CsCatL Gene Did Not Affect JH Pathway Related Genes in C. septempunctata
2.6. Deletion of CsCatL Resulted in a Low Survival Rate of C. septempunctata
3. Discussion
4. Materials and Methods
4.1. Insect Rearing and Sample Preparation
4.2. The Investigation of C. septempunctata Female in N9 and D9
4.3. Gene Cloning and Sequence Analysis
4.4. Analysis of Gene Transcript Abundance by qRT-PCR
4.5. RNA Interference (RNAi)
4.6. Quantification of the Lipid Accumulation, Gene Real-Time Quantification and Bioassay of C. septempunctata Injected with dsRNA
4.7. Microscopic Investigation
4.8. The Determination of Triglyceride
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tougeron, K. Diapause research in insects: Historical review and recent work perspectives. Entomol. Exp. Appl. 2019, 167, 27–36. [Google Scholar] [CrossRef]
- Hand, S.C.; Denlinger, D.L.; Podrabsky, J.E.; Roy, R. Mechanisms of animal diapause: Recent developments from nematodes, crustaceans, insects, and fish. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2016, 310, 1193–1211. [Google Scholar] [CrossRef] [PubMed]
- Xiang, M.; Zhang, H.Z.; Jing, X.Y.; Wang, M.Q.; Mao, J.J.; Li, Y.Y.; Zang, L.S.; Zhang, L.S. Sequencing, expression, and functional analyses of four genes related to fatty acid biosynthesis during the diapause process in the female ladybird, Coccinella septempunctata L. Front. Physiol. 2021, 12, 706032. [Google Scholar] [CrossRef] [PubMed]
- Kostal, V. Eco-physiological phases of insect diapause. J. Insect Physiol. 2006, 52, 113–127. [Google Scholar] [CrossRef] [PubMed]
- Denlinger, D.L. Regulation of diapause. Annu. Rev. Entomol. 2002, 47, 93–122. [Google Scholar] [CrossRef]
- Li, Y.Y.; Chen, J.J.; Liu, M.Y.; He, W.W.; Reynolds, J.A.; Wang, Y.N.; Wang, M.Q.; Zhang, L.S. Enhanced degradation of juvenile hormone promotes reproductive diapause in the predatory ladybeetle Coccinella septempunctata. Front. Physiol. 2022, 13, e877153. [Google Scholar] [CrossRef]
- Sim, C.; Denlinger, D.L. Insulin signaling and FOXO regulate the overwintering diapause of the mosquito Culex pipiens. Proc. Natl. Acad. Sci. USA 2008, 105, 6777–6781. [Google Scholar] [CrossRef]
- Olademehin, O.P.; Liu, C.Y.; Rimal, B.; Adegboyega, N.F.; Chen, F.; Sim, C.; Kim, S.J. Dsi-RNA knockdown of genes regulated by Foxo reduces glycogen and lipid accumulations in diapausing Culex pipiens. Sci. Rep. 2020, 10, 17201. [Google Scholar] [CrossRef]
- Tan, Q.Q.; Liu, W.; Zhu, F.; Lei, C.L.; Wang, X.P. Fatty acid synthase 2 contributes to diapause preparation in a beetle by regulating lipid accumulation and stress tolerance genes expression. Sci. Rep. 2017, 7, 40509. [Google Scholar] [CrossRef]
- Zhu, L.; Tian, Z.; Guo, S.; Liu, W.; Zhu, F.; Wang, X.P. Circadian clock genes link photoperiodic signals to lipid accumulation during diapause preparation in the diapause-destined female cabbage beetles Colaphellus bowringi. Insect Biochem. Mol. Biol. 2019, 104, 1–10. [Google Scholar] [CrossRef]
- Hahn, D.A.; Denlinger, D.L. Energetics of insect diapause. Annu. Rev. Entomol. 2011, 56, 103–121. [Google Scholar] [CrossRef] [PubMed]
- Toprak, U.; Guz, N.; Gurkan, M.O.; Hegedus, D.D. Identification and coordinated expression of perilipin genes in the biological cycle of sunn pest, Eurygaster maura (Hemiptera: Scutelleridae): Implications for lipolysis and lipogenesis. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2014, 171, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Juen, A.; Hogendoorn, K.; Ma, G.; Schmidt, O.; Keller, M.A. Analysing the diets of invertebrate predators using terminal restriction fragments. J. Pest. Sci. 2012, 85, 89–100. [Google Scholar] [CrossRef]
- Yang, N.W.; Zang, L.S.; Wang, S.; Guo, J.Y.; Xu, H.X.; Zhang, F.; Wan, F.H. Biological pest management by predators and parasitoids in the greenhouse vegetables in China. Biol. Control 2014, 68, 92–102. [Google Scholar] [CrossRef]
- Ren, X.Y.; Zhang, L.S.; Han, Y.H.; An, T.; Liu, Y.; Li, Y.Y.; Chen, H.Y. Proteomic research on diapause-related proteins in the female ladybird, Coccinella septempunctata L. Bull. Entomol. Res. 2016, 106, 168–174. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Zhang, L.S.; Chen, H.Y.; Wang, J.; Zhang, J.; Liu, Y. Effects of temperature and light on diapause induction in lady beetle Coccinella septempunctata in Beijing, China. Chin. J. Biol. Control 2013, 29, 24–30. [Google Scholar] [CrossRef]
- Wang, W. Effects of Temperature and Photoperiod on Regulation of Diapause and Post-Diapause Biology in Coccinella septempuractata. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2012. [Google Scholar]
- Qi, X.Y.; Zhang, L.S.; Han, Y.H.; Ren, X.Y.; Huang, J.; Chen, H.Y. De novo transcriptome sequencing and analysis of Coccinella septempunctata L. in non-diapause, diapause and diapause-terminated states to identify diapause-associated genes. BMC Genom. 2015, 16, 1086. [Google Scholar] [CrossRef]
- Yang, H.; Zhang, R.; Zhang, Y.; Liu, Q.; Li, Y.; Gong, J.; Hou, Y. Cathepsin-L is involved in degradation of fat body and programmed cell death in Bombyx mori. Gene 2020, 760, 144998. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.X.; Tang, L.; Wang, P.; Abbas, M.N.; Tian, J.W.; Zhu, B.J.; Liu, C.L. Cathepsin L-like protease can regulate the process of metamorphosis and fat body dissociation in Antheraea pernyi. Dev. Comp. Immunol. 2018, 78, 114–123. [Google Scholar] [CrossRef]
- Ma, L.; Liu, S.; Shi, M.; Chen, X.X.; Li, S. Ras1CA-upregulated BCPI inhibits cathepsin activity to prevent tissue destruction of the Bombyx posterior silk gland. J. Proteome Res. 2013, 12, 1924–1934. [Google Scholar] [CrossRef]
- Yang, C.; Lin, X.W.; Xu, W.H. Cathepsin L participates in the remodeling of the midgut through dissociation of midgut cells and activation of apoptosis via caspase-1. Insect Biochem. Mol. Biol. 2017, 82, 21–30. [Google Scholar] [CrossRef] [PubMed]
- Zhai, X.; Zhao, X.F. Participation of haemocytes in fat body degradation via cathepsin L expression. Insect Mol. Biol. 2012, 21, 521–534. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, Y.; Yamahama, Y.; Katou, K.; Watabe, S.; Takahashi, S.Y. Bombyx acid cysteine protease (BCP): Hormonal regulation of biosynthesis and accumulation in the ovary. J. Insect Physiol. 2000, 46, 783–791. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.Y.; Wu, W.M.; Li, S.Y.; Liu, Y.; Ruan, Z.F.; Ye, M.Q.; Xiao, Y.; Zhong, Y.J.; Cao, Y.; Li, K.; et al. 20-Hydroxyecdysone-upregulated proteases involved in Bombyx larval fat body destruction. Insect Mol. Biol. 2018, 27, 724–738. [Google Scholar] [CrossRef]
- Zhang, Y.; Lu, Y.X.; Liu, J.; Yang, C.; Feng, Q.L.; Xu, W.H. A regulatory pathway, ecdysone-transcription factor relish-cathepsin L, is involved in insect fat body dissociation. PLoS Genet. 2013, 9, e1003273. [Google Scholar] [CrossRef]
- Wang, Y.; Zhao, B.; Ding, F.; Jiang, X. Gut-specific expression of cathepsin L and B in amphioxus Branchiostoma belcheri tsingtauense larvae. Eur. J. Cell Biol. 2008, 87, 185–193. [Google Scholar] [CrossRef]
- Hahn, D.A.; Denlinger, D.L. Meeting the energetic demands of insect diapause: Nutrient storage and utilization. J. Insect Physiol. 2007, 53, 760–773. [Google Scholar] [CrossRef]
- Liu, Z.; Xin, Y.; Zhang, Y.; Fan, J.; Sun, J. Summer diapause induced by high temperatures in the oriental tobacco budworm: Ecological adaptation to hot summers. Sci. Rep. 2016, 6, 27443. [Google Scholar] [CrossRef]
- Sassa, T.; Kihara, A. Metabolism of very long-chain fatty acids: Genes and pathophysiology. Biomol. Ther. 2014, 22, 83–92. [Google Scholar] [CrossRef]
- Alabaster, A.; Isoe, J.; Zhou, G.L.; Lee, A.; Murphy, A.; Day, W.A.; Miesfeld, R.L. Deficiencies in acetyl-CoA carboxylase and fatty acid synthase 1 differentially affect eggshell formation and blood meal digestion in Aedes aegypti. Insect Biochem. Mol. Biol. 2011, 41, 946–955. [Google Scholar] [CrossRef]
- Urbanski, J.M.; Benoit, J.B.; Michaud, M.R.; Denlinger, D.L.; Armbruster, P. The molecular physiology of increased egg desiccation resistance during diapause in the invasive mosquito, Aedes albopictus. Proc. R. Soc. B Biol. Sci. 2010, 277, 2683–2692. [Google Scholar] [CrossRef] [PubMed]
- Parvy, J.P.; Napal, L.L.; Rubin, T.; Poidevin, M.; Perrin, L.; Wicker-Thomas, M.; Montagne, J. Drosophila melanogaster acetyl-CoA-Carboxylase sustains a fatty acid-dependent remote signal to waterproof the respiratory system. PLoS Genet. 2012, 8, e1002925. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, A.A.; Harshman, L.G. Desiccation and starvation resistance in Drosophila: Patterns of variation at the species, population and intrapopulation levels. Heredity 1999, 83, 637–643. [Google Scholar] [CrossRef] [PubMed]
- Szafer-Glusman, E.; Giansanti, M.G.; Nishihama, R.; Bolival, B.; Pringle, J.; Gatti, M.; Fuller, M.T. A role for very-long-chain fatty acids in furrow ingression during cytokinesis in Drosophila spermatocytes. Curr. Biol. 2008, 18, 1426–1431. [Google Scholar] [CrossRef] [PubMed]
- Ng, W.C.; Chin, J.S.; Tan, K.J.; Yew, J.Y. The fatty acid elongase bond is essential for Drosophila sex pheromone synthesis and male fertility. Nat. Commun. 2015, 6, 8263. [Google Scholar] [CrossRef]
- Jung, A.; Hollmann, M.; Schäfer, M.A. The fatty acid elongase NOA is necessary for viability and has a somatic role in Drosophila sperm. J. Cell Sci. 2007, 120, 2924–2934. [Google Scholar] [CrossRef]
- Houot, B.; Bousquet, F.; Ferveur, J.F. The consequences of regulation of desat1 affects both pheromone emission and detection in Drosophila melanogaster. Genetics 2010, 185, 1297–1309. [Google Scholar] [CrossRef]
- Lassance, J.M.; Groot, A.T.; Liénard, M.A.; Antony, B.; Borgwardt, C.; Andersson, F.; Hedenström, E.; Heckel, D.G.; Löfstedt, C. Allelic variation in a fatty-acyl reductase gene causes divergence in moth sex pheromones. Nature 2010, 466, 486–489. [Google Scholar] [CrossRef]
- Antony, B.; Fujii, T.; Moto, K.; Matsumoto, S.; Fukuzaw, M.; Nakano, R.; Tatsuki, S.; Ishikawa, Y. Pheromone-gland-specific fatty-acyl reductase in the adzuki bean borer, Ostrinia scapulalis (Lepidoptera: Crambidae). Insect Biochem. Mol. Biol. 2009, 39, 90–95. [Google Scholar] [CrossRef]
- Liénard, M.A.; Hagström, K.A.; Lassance, J.; Löfstedt, C. Evolution of multicomponent pheromone signals in small ermine moths involves a single fatty-acyl reductase gene. Proc. Natl. Acad. Sci. USA 2010, 107, 10955–10960. [Google Scholar] [CrossRef]
- Carot-Sans, G.; Muñoz, L.; Piulachs, M.D.; Guerrero, A.; Rosell, G. Identification and characterization of a fatty acyl reductase from a Spodoptera littoralis female gland involved in pheromone biosynthesis. Insect Mol. Biol. 2015, 24, 82–92. [Google Scholar] [CrossRef] [PubMed]
- Li, X.L.; Zheng, T.X.; Zheng, X.W.; Han, N.; Chen, X.X.; Zhang, D.Y. Molecular characterization of two fatty acyl-CoA reductase genes from Phenacoccus solenopsis (Hemiptera: Pseudococcidae). J. Insect Sci. 2016, 16, 49. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Menendez, J.A.; Lupu, R. Fatty acid synthase and the lipogenic phenotype in cancer pathogenesis. Nat. Rev. Cancer 2007, 7, 763–777. [Google Scholar] [CrossRef] [PubMed]
- Robich, R.M.; Denlinger, D.L. Diapause in the mosquito Culex pipiens evokes a metabolic switch from blood feeding to sugar gluttony. Proc. Natl. Acad. Sci. USA 2005, 102, 15912–15917. [Google Scholar] [CrossRef] [PubMed]
- Zhou, G.L.; Miesfeld, R.L. Energy metabolism during diapause in Culex pipiens mosquitoes. J. Insect Physiol. 2009, 55, 40–46. [Google Scholar] [CrossRef] [PubMed]
- Sim, C.; Denlinger, D.L. Transcription profiling and regulation of fat metabolism genes in diapausing adults of the mosquito Culex pipiens. Physiol. Genom. 2009, 39, 202–209. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.H. Functional Studies of Fatty acid Synthase and Acyl-Coa Δ11 Desaturase During Diapause of the Ladybird. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2012. [Google Scholar]
- Denlinger, D.L.; Yocum, G.D.; Rinehart, J.P. Hormonal control of diapause. In Insect Endocrinology; Gilbert, L.I., Ed.; Academic Press: San Diego, CA, USA, 2012; pp. 430–463. [Google Scholar] [CrossRef]
- Gao, Q.; Li, B.; Tian, Z.; de Loof, A.; Wang, J.L.; Wang, X.P. Key role of juvenile hormone in controlling reproductive diapause in females of the Asian lady beetle Harmonia axyridis. Pest. Manag. Sci. 2021, 78, 193–204. [Google Scholar] [CrossRef] [PubMed]
- Sim, C.; Kang, D.S.; Kim, S.; Bai, X.; Denlinger, D.L. Identification of FOXO targets that generate diverse features of the diapause phenotype in the mosquito Sulex pipiens. Proc. Natl. Acad. Sci. USA 2015, 112, 3811–3816. [Google Scholar] [CrossRef] [PubMed]
- Tian, Z.; Guo, S.; Li, J.X.; Zhu, F.; Liu, W.; Wang, X.P. Juvenile hormone biosynthetic genes are critical for regulating reproductive diapause in the Cabbage beetle. Insect Biochem. Mol. Biol. 2021, 139, 103654. [Google Scholar] [CrossRef]
- Zhang, Q.R.; Xu, W.H.; Chen, F.S.; Li, S. Molecular and biochemical characterization of juvenile hormone epoxide hydrolase from the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 2005, 35, 153–164. [Google Scholar] [CrossRef]
- Gijbels, M.; Schellens, S.; Schellekens, T.; Bruyninckx, E.; Marchal, E.; Vanden Broeck, J. Precocious downregulation of krüppel-homolog 1 in the Migratory locust, Locusta migratoria, gives rise to an adultoid phenotype with accelerated ovarian development but disturbed mating and oviposition. Int. J. Mol. Sci. 2020, 21, 6058. [Google Scholar] [CrossRef] [PubMed]
- Cooper, A.M.W.; Silver, K.; Zhang, J.Z.; Park, Y.S.; Zhu, K.Y. Molecular mechanisms influencing efficiency of RNA interference in insects. Pest. Manag. Sci. 2019, 75, 18–28. [Google Scholar] [CrossRef] [PubMed]
- Zhu, K.Y.; Palli, S.R. Mechanisms, applications, and challenges of insect RNA interference. Annu. Rev. Entomol. 2020, 65, 293–311. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real time quantitative PCR and the 2-ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]







| Primer Name | Sequence (5′-3′) | |
|---|---|---|
| Gene cloning | ||
| CsCatL F | GAAGACAACCCATTCCGAGG | |
| CsCatL R | CTGCAAGAAAGGTCCCTGAA | |
| CsCatL 3RACE F1 | GATTACGCCAAGCTTCCTACTCGGCATCTAACGGATAC | |
| CsCatL 3RACE F2 | GATTACGCCAAGCTTCAGCTATTGCTAGTGTGGGTCC | |
| CsCatL 5RACE F1 | GATTACGCCAAGCTTGGTCTGTCTATCAAACCCTTGTTAAC | |
| CsCatL 5RACE F2 | GATTACGCCAAGCTTGTATCCGTTAGATGCCGAGTAGG | |
| qRT-PCR | ||
| CsCatL F | CACGGAGTCCTAGCTGTTGG | |
| CsCatL R | GGAAGCCATGGTGGCAATTC | |
| CsFas1 F | CCGTAGTCTGCCAAACATCC | |
| CsFas1 R | AAATCCTCAACAGCAACGACTC | |
| CsFas2 F | TTTGGCGATAGAACATAGAGCA | |
| CsFas2 R | AGCCCACGGACAGGAAC | |
| CsFadΔ11 F | CTGCTAACTGAGGAACTTGTGG | |
| CsFadΔ11 R | GCACCAACATAACCATAGGGA | |
| CsVg F | AAACACTCCAATGCGGTC | |
| CsVg R | GAGAATGATGTAGGCAGCG | |
| CsActin F | GATTCGCCATCCAGGACATCTC | |
| CsActin R | TCCTTGCTCAGCTTGTTGTAGTC | |
| CsJHE F | GACCAAAACCTTGCCCTACG | |
| CsJHE R | CCACAAACATAGAGCACTTCCG | |
| CsJHEH F | CTTTCAAAATCGCCGTTCC | |
| CsJHEH R | AAGTCCAGCACTGATTTCGTG | |
| CsKr-h1 F | CAAGTGTGAGGTCTGTTCTAGGG | |
| CsKr-h1 R | GGCATACTTGACAGACGTAAGG | |
| RNAi experiment | ||
| dsCatL F1 | TAATACGACTCACTATAGGGTGGCTGGGGCTATTTACAAC | |
| dsCatL R1 | TAATACGACTCACTATAGGGAGGGGTAGTCCTGTTCACTC | |
| dsCatL F2 | TAATACGACTCACTATAGGGGAAGACAACCCATTCCGAGG | |
| dsCatL R2 | TAATACGACTCACTATAGGGCTGCAAGAAAGGTCCCTGAA | |
| dsGFP F | TAATACGACTCACTATAGGGCACAAGTTCAGCGTGTCCG | |
| dsGFP R | TAATACGACTCACTATAGGGAGTTCACCTTGATGCCGTTC | |
| Order | Species | GenBank/Uniprot No. |
|---|---|---|
| Cathepsin L | Coccinella septempunctata | This study |
| - | Aethina tumida | XP_019868286.1 |
| - | Tenebrio molitor | AAR05023.1 |
| - | Diabrotica virgifera virgifera | XP_028133575.1 |
| - | Homalodisca vitripennis | KAG8293399.1 |
| - | Diachasma alloeum | XP_015123049.1 |
| - | Apis mellifera | XP_625135.3 |
| - | Helicoverpa zea | XP_047024875.1 |
| - | Drosophila melanogaster | Q95029.2 |
| - | Sarcophaga peregrine | Q26636.1 |
| Cathepsin B | Rhyzopertha dominica | KAI7815596.1 |
| - | Bactrocera oleae | XP_014086025.1 |
| - | Onthophagus taurus | XP_022913411.1 |
| - | Halyomorpha halys | XP_014290885.1 |
| - | Helicoverpa zea | XP_047024476.1 |
| - | Coccinella septempunctata | XP_044754716.1 |
| - | Tribolium castaneum | XP_974298.1 |
| - | Dendroctonus ponderosae | XP_019755614.1 |
| Cathepsin D | Halyomorpha halys | XP_014291624.1 |
| - | Polyrhachis vicina | AEC03508.1 |
| - | Callosobruchus maculatus | ACO56332.1 |
| - | Bombyx mori | NP_001037351.1 |
| - | Spodoptera exigua | ARE67826.1 |
| - | Helicoverpa armigera armigera | AYP72766.1 |
| Cathepsin O | Diachasma alloeum | XP_015115164.1 |
| - | Ooceraea biroi | EZA49885.1 |
| - | Thrips palmi | XP_034250554.1 |
| Cathepsin F | Rhyzopertha dominica | KAI7815244.1 |
| Cathepsin K | Ooceraea biroi | EZA49955.1 |
| - | Rhyzopertha dominica | KAI7815176.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Guo, P.; Li, Y.; He, W.; Chen, W.; Shen, Z.; Zhang, M.; Mao, J.; Zhang, L. Cathepsin L Contributes to Reproductive Diapause by Regulating Lipid Storage and Survival of Coccinella septempunctata (Linnaeus). Int. J. Mol. Sci. 2023, 24, 611. https://doi.org/10.3390/ijms24010611
Chen J, Guo P, Li Y, He W, Chen W, Shen Z, Zhang M, Mao J, Zhang L. Cathepsin L Contributes to Reproductive Diapause by Regulating Lipid Storage and Survival of Coccinella septempunctata (Linnaeus). International Journal of Molecular Sciences. 2023; 24(1):611. https://doi.org/10.3390/ijms24010611
Chicago/Turabian StyleChen, Junjie, Penghui Guo, Yuyan Li, Weiwei He, Wanbin Chen, Zhongjian Shen, Maosen Zhang, Jianjun Mao, and Lisheng Zhang. 2023. "Cathepsin L Contributes to Reproductive Diapause by Regulating Lipid Storage and Survival of Coccinella septempunctata (Linnaeus)" International Journal of Molecular Sciences 24, no. 1: 611. https://doi.org/10.3390/ijms24010611
APA StyleChen, J., Guo, P., Li, Y., He, W., Chen, W., Shen, Z., Zhang, M., Mao, J., & Zhang, L. (2023). Cathepsin L Contributes to Reproductive Diapause by Regulating Lipid Storage and Survival of Coccinella septempunctata (Linnaeus). International Journal of Molecular Sciences, 24(1), 611. https://doi.org/10.3390/ijms24010611

