The D165H Polymorphism of QiMYB-like-1 Is Linked to Interactions between Tannin Accumulation, Herbivory and Biogeographical Determinants of Quercus ilex
Abstract
1. Introduction
2. Results
2.1. Polymorphism of QiMYB-like-1, a Putative Component of the MBW Complex in Q. ilex

2.2. Geographical Distribution of the QiMYB-like-1 Genotypes
2.3. Non-Random Distribution of Quantitative Traits Related to Chemical Defenses Depends on Biogeographic, Ecologic, or Genetic Factors
2.4. Susceptibility to Defoliation and/or Chemical Defenses Depends on Biogeographic, Ecological, or Genetic Factors
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Experimental Design, Treatments, and Tissue Processing
4.3. Chemical Analyses of Phenolics
4.4. Purification of Nucleic Acids
4.5. PCR and RFLP Analyses
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Díaz, M.; Pulido, F.J. Dehesas perennifolias de Quercus spp. In Bases Ecológicas Preliminares para la Conservación de los Tipos de Hábitat de Interés Comunitario en España; Ministerio de Medio Ambiente, y Medio Rural y Marino: Madrid, Spain, 2009; p. 69. [Google Scholar]
- Roda, F.; Vayreda, J.; Ninyerola, M. Encinares de Quercus ilex y Quercus rotundifolia. In Bases Ecológicas Preliminares para la Conservación de los Tipos de Hábitat de Interés Comunitario en España; Ministerio de Medio Ambiente, y Medio Rural y Marino: Madrid, Spain, 2009; p. 94. [Google Scholar]
- Corcobado, T.; Solla, A.; Madeira, M.; Moreno, G. Combined effects of soil properties and Phytophthora cinnamomi infections on Quercus ilex decline. Plant Soil 2013, 373, 403–413. [Google Scholar] [CrossRef] [Scilit]
- Treutter, D. Significance of flavonoids in plant resistance: A review. Environ. Chem. Lett. 2006, 4, 147–157. [Google Scholar] [CrossRef] [Scilit]
- Moctezuma, C.; Hammerbacher, A.; Heil, M.; Gershenzon, J.; Méndez-Alonzo, R.; Oyama, K. Specific polyphenols and tannins are associated with defense against insect herbivores in the tropical oak Quercus oleoides. J. Chem. Ecol. 2014, 40, 458–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lepiniec, L.; Debeaujon, I.; Routaboul, J.M.; Baudry, A.; Pourcel, L.; Nesi, N.; Caboche, M. Genetics and biochemistry of seed flavonoids. Ann. Rev. Plant Biol. 2006, 57, 405–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dubos, C.; Stracke, R.; Grotewold, E.; Weisshaar, B.; Martin, C.; Lepiniec, L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soler, M.; Serra, O.; Molinas, M.; Huguet, G.; Fluch, S.; Figueras, M. A genomic approach to suberin biosynthesis and cork differentiation. Plant Physiol. 2007, 144, 419–431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Almeida, T.; Menéndez, E.; Capote, T.; Ribeiro, T.; Santos, C.; Gonçalves, S. Molecular characterization of Quercus suber MYB1, a transcription factor up-regulated in cork tissues. J. Plant Physiol. 2013, 170, 172–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Almeida, T.; Pinto, G.; Correia, B.; Santos, C.; Gonçalves, S. QsMYB1 expression is modulated in response to heat and drought stresses and during plant recovery in Quercus suber. Plant Physiol. Biochem. 2013, 73, 274–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Capote, T.; Barbosa, P.; Usié, A.; Ramos, A.M.; Inácio, V.; Ordás, R.; Gonçalves, S.; Morais-Cecílio, L. ChIP-Seq reveals that QsMYB1 directly targets genes involved in lignin and suberin biosynthesis pathways in cork oak (Quercus suber). BMC Plant Biol. 2018, 18, 198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peters, D.J.; Constabel, C.P. Molecular analysis of herbivore-induced condensed tannin synthesis: Cloning and expression of dihydroflavonol reductase from trembling aspen (Populus tremuloides). Plant J. 2002, 32, 701–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Damestoy, T.; Brachi, B.; Moreira, X.; Jactel, H.; Plomion, C.; Castagneyrol, B. Oak genotype and phenolic compounds differently affect the performance of two insect herbivores with contrasting diet breadth. Tree Physiol. 2019, 39, 615–627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gallardo, A.; Morcuende, D.; Solla, A.; Moreno, G.; Pulido, F.; Quesada, A. Regulation by biotic stress of tannins biosynthesis in Quercus ilex: Crosstalk between defoliation and Phytophthora cinnamomi infection. Physiol. Plant 2019, 165, 319–329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bontpart, T.; Marlin, T.; Vialet, S.; Guiraud, J.L.; Pinasseau, L.; Meudec, E.; Sommerer, N.; Cheynier, V.; Terrier, N. Two shikimate dehydrogenases, VvSDH3 and VvSDH4, are involved in gallic acid biosynthesis in grapevine. J. Exp. Bot. 2016, 67, 3537–3550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plomion, C.; Aury, J.M.; Amselem, J.; Alaeitabar, T.; Barbe, V.; Belser, C.; Bergès, H.; Bodénès, C.; Boudet, N.; Boury, C.; et al. Decoding the oak genome: Public release of sequence data, assembly, annotation and publication strategies. Mol. Ecol. Resour. 2016, 16, 254–265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodríguez-Romero, M.; Gallardo, A.; Pulido, F. Geographical and within-population variation of constitutive chemical defences in a Mediterranean oak (Quercus ilex). For. Syst. 2020, 29, e011. [Google Scholar] [CrossRef] [Scilit]
- Makkar, H.P.S. Measurement of total phenolics and tannins using Folin-Ciocalteu Method. In Quantification of Tannins in Tree and Shrub Foliage; Springer: Dordrecht, The Netherlands, 2003; pp. 49–51. [Google Scholar]
- Hagerman, A.E. Radial diffusion method for determining tannin in plant extracts. J. Chem. Ecol. 1987, 13, 437–449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Porter, L.J.; Hirstich, L.N.; Chan, B.G. The conversion of procyanidins and prodelphinidins to cyanidin and delphinidin. Phytochemistry 1986, 25, 223–230. [Google Scholar] [CrossRef] [Scilit]



| Coding Sequence | Name | Sequence 5’–3’ | Amplicon a |
|---|---|---|---|
| QIMYB-like-1 | p1-F | ATGGGCAGAAGTCCTTGC | 1229 |
| p1-R | TGCTTCATGGGGTGTCAAT | ||
| QIMYB-like-2 | p2-F | TCAAAATGGGTAGGCGTCCT | 1059 |
| p2-R | ATTCATCGCTTCACTGCATC | ||
| QIMYB-like-3 | p3-F | AATCAAACACCCAATTTAAGATCAG | 1145 |
| p3-R | TGTCAGCTTGGTTAGTTGGC | ||
| QIMYB-like-4 | p4-F | GAGAGAGAGAAATGGGGAGGA | 1209 |
| p4-R | GGTGTGTAGTGCGTACGTGGA |
| Observed (Expected) Genotypes 3 | ||||||
|---|---|---|---|---|---|---|
| NP 1 | N 2 | DD | DH | HH | JI-Square 4 | p-Value 5 |
| OR | 52 | 22 (20.9) | 22 (24.1) | 8 (6.9) | 0.4 | 0.53 |
| AT | 52 | 23 (24.2) | 25 (22.5) | 4 (5.2) | 0.63 | 0.43 |
| GU | 52 | 22 (20.3) | 21 (24.4) | 9 (7.3) | 0.99 | 0.318 |
| MO | 59 | 16 (11) | 19 (29) | 24 (19) | 6.97 | 0.0082 ** |
| CA | 60 | 25 (21.6) | 22 (28.8) | 13 (9.6) | 3.34 | 0.067 |
| SN | 51 | 24 (24.7) | 23 (21.6) | 4 (4.7) | 0.22 | 0.64 |
| Py | 104 | 45 (45.1) | 47 (46.8) | 12 (12.1) | 0.0026 | 0.96 |
| cM | 119 | 41 (31.8) | 41 (59.4) | 37 (27.8) | 11.45 | 0.0007 *** |
| Cases 1 | SS 2 | df | MS 3 | F | p | |
|---|---|---|---|---|---|---|
| TT | G | 229.155 | 2 | 114.577 | 0.519 | 0.596 |
| R | 3012.700 | 1 | 3012.700 | 13.640 | <0.001 *** | |
| D | 25.687 | 1 | 25.687 | 0.116 | 0.733 | |
| G × R | 365.170 | 2 | 182.585 | 0.827 | 0.439 | |
| G × D | 373.856 | 2 | 186.928 | 0.846 | 0.430 | |
| R × D | 47.668 | 1 | 47.668 | 0.216 | 0.643 | |
| G × R × D | 54.166 | 2 | 27.083 | 0.123 | 0.885 | |
| Residual | 46,604.937 | 211 | 220.876 | |||
| CT | G | 1031.73 | 2 | 515.87 | 3.462 | 0.033 * |
| R | 7321.21 | 1 | 7321.21 | 49.129 | <0.001 *** | |
| D | 1346.37 | 1 | 1346.37 | 9.035 | 0.003 ** | |
| G × R | 125.65 | 2 | 62.82 | 0.422 | 0.657 | |
| G × D | 1079.67 | 2 | 539.84 | 3.623 | 0.028 * | |
| R × D | 84.63 | 1 | 84.63 | 0.568 | 0.452 | |
| G × R × D | 466.89 | 2 | 233.44 | 1.567 | 0.211 | |
| Residual | 31,443.03 | 211 | 149.02 | |||
| Herbivory | G | 449.4 | 2 | 224.7 | 0.453 | 0.636 |
| R | 12,129.6 | 1 | 12,129.6 | 24.475 | <0.001 *** | |
| D | 298.5 | 1 | 298.5 | 0.602 | 0.439 | |
| G × R | 3634.3 | 2 | 1817.2 | 3.667 | 0.027 * | |
| G × D | 1210.1 | 2 | 605.0 | 1.221 | 0.297 | |
| R × D | 5750.7 | 1 | 5750.7 | 11.604 | <0.001 *** | |
| G × R × D | 3013.5 | 2 | 1506.8 | 3.040 | 0.050 | |
| Residual | 104,570.7 | 211 | 495.6 |
| C 2 | N 3 | TP | TT | ||||
|---|---|---|---|---|---|---|---|
| r | p | r | p | ||||
| National Parks | OR | 60 | TT | 0.778 | <0.001 *** | ||
| CT | 0.717 | <0.001 *** | 0.457 | <0.001 *** | |||
| AT | 60 | TT | 0.855 | <0.001 *** | |||
| CT | 0.664 | <0.001 *** | 0.430 | <0.001 *** | |||
| GU | 60 | TT | 0.857 | <0.001 *** | |||
| CT | 0.676 | <0.001 *** | 0.428 | <0.001 *** | |||
| MO | 60 | TT | 0.861 | <0.001 *** | |||
| CT | 0.497 | <0.001 *** | 0.334 | 0.009 ** | |||
| CA | 60 | TT | 0.858 | <0.001 *** | |||
| CT | 0.470 | <0.001 *** | 0.334 | 0.009 ** | |||
| SN | 60 | TT | 0.919 | <0.001 *** | |||
| CT | 0.462 | <0.001 *** | 0.375 | 0.004 ** | |||
| Total of plants | NP | 360 | TT | 0.741 | <0.001 *** | ||
| CT | 0.475 | <0.001 *** | 0.287 | <0.001 *** | |||
| LDF | 180 | TT | 0.727 | <0.001 *** | |||
| CT | 0.488 | <0.001 *** | 0.254 | <0.001 *** | |||
| HDF | 180 | TT | 0.753 | <0.001 *** | |||
| CT | 0.464 | <0.001 *** | 0.319 | <0.001 *** | |||
| DD | 142 | TT | 0.684 | <0.001 *** | |||
| CT | 0.475 | <0.001 *** | 0.220 | 0.012 * | |||
| DH | 132 | TT | 0.792 | <0.001 *** | |||
| CT | 0.478 | <0.001 *** | 0.322 | <0.001 *** | |||
| HH | 62 | TT | 0.708 | <0.001 *** | |||
| CT | 0.384 | 0.002 ** | 0.258 | 0.043 * | |||
| Py/cM singularity | Py | 120 | TT | 0.796 | <0.001 *** | ||
| CT | 0.652 | <0.001 *** | 0.438 | <0.001 *** | |||
| cM | 120 | TT | 0.864 | <0.001 *** | |||
| CT | 0.153 | 0.095 | 0.105 | 0.253 | |||
| LDF | 120 | TT | 0.800 | <0.001 *** | |||
| CT | 0.404 | <0.001 *** | 0.149 | 0.105 | |||
| HDF | 120 | TT | 0.832 | <0.001 *** | |||
| CT | 0.359 | <0.001 *** | 0.164 | 0.075 | |||
| DD | 86 | TT | 0.745 | <0.001 *** | |||
| CT | 0.302 | 0.005 ** | 0.022 | 0.841 | |||
| DH | 88 | TT | 0.863 | <0.001 *** | |||
| CT | 0.460 | <0.001 *** | 0.284 | 0.007 ** | |||
| HH | 49 | TT | 0.784 | <0.001 *** | |||
| CT | 0.278 | 0.053 | 0.108 | 0.462 | |||
| C 2 | TP | TT | CT | |||||
|---|---|---|---|---|---|---|---|---|
| N 3 | r | p | r | p | r | p | ||
| Total of plants | NP | 360 | 0.266 | <0.001 *** | 0.134 | 0.011 * | −0.067 | 0.209 |
| LDF | 180 | 0.366 | <0.001 *** | 0.234 | 0.002 ** | −0.058 | 0.439 | |
| HDF | 180 | 0.154 | 0.039 * | 0.032 * | 0.674 | −0.092 | 0.222 | |
| DD | 142 | 0.276 | 0.001 ** | 0.127 | 0.148 | −0.069 | 0.435 | |
| DH | 132 | 0.268 | 0.002 ** | 0.134 | 0.125 | −0.037 | 0.671 | |
| HH | 62 | 0.262 | 0.039 * | 0.224 | 0.080 | −0.188 | 0.143 | |
| Py/cM singularity | Py | 120 | 0.363 | <0.001 *** | 0.207 | 0.024 * | 0.232 | 0.011 * |
| cM | 120 | 0.184 | 0.044 * | 0.112 | 0.223 | −0.333 | <0.001 *** | |
| LDF | 120 | 0.378 | <0.001 *** | 0.328 | <0.001 *** | −0.217 | 0.017 * | |
| HDF | 120 | 0.134 | 0.144 | 0.126 | 0.171 | −0.177 | 0.054 | |
| Py + LDF | 60 | 0.479 | <0.001 *** | 0.256 | 0.050 | 0.426 | <0.001 *** | |
| Py + HDF | 60 | 0.268 | 0.038 * | 0.191 | 0.144 | 0.093 | 0.486 | |
| cM + LDF | 60 | 0.355 | 0.005 ** | 0.190 | 0.146 | −0.433 | <0.001 *** | |
| cM + HDF | 60 | 0.003 | 0.979 | 0.007 | 0.959 | −0.378 | 0.003 ** | |
| DD | 86 | 0.231 | 0.032 * | 0.190 | 0.079 | −0.277 | 0.01 * | |
| DH | 88 | 0.267 | 0.012 * | 0.244 | 0.022 * | −0.123 | 0.254 | |
| HH | 49 | 0.112 | 0.445 | 0.170 | 0.242 | −0.297 | 0.038 * | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gallardo, A.; Morcuende, D.; Rodríguez-Romero, M.; Igeño, M.I.; Pulido, F.; Quesada, A. The D165H Polymorphism of QiMYB-like-1 Is Linked to Interactions between Tannin Accumulation, Herbivory and Biogeographical Determinants of Quercus ilex. Int. J. Mol. Sci. 2023, 24, 151. https://doi.org/10.3390/ijms24010151
Gallardo A, Morcuende D, Rodríguez-Romero M, Igeño MI, Pulido F, Quesada A. The D165H Polymorphism of QiMYB-like-1 Is Linked to Interactions between Tannin Accumulation, Herbivory and Biogeographical Determinants of Quercus ilex. International Journal of Molecular Sciences. 2023; 24(1):151. https://doi.org/10.3390/ijms24010151
Chicago/Turabian StyleGallardo, Alejandro, David Morcuende, Manuela Rodríguez-Romero, María Isabel Igeño, Fernando Pulido, and Alberto Quesada. 2023. "The D165H Polymorphism of QiMYB-like-1 Is Linked to Interactions between Tannin Accumulation, Herbivory and Biogeographical Determinants of Quercus ilex" International Journal of Molecular Sciences 24, no. 1: 151. https://doi.org/10.3390/ijms24010151
APA StyleGallardo, A., Morcuende, D., Rodríguez-Romero, M., Igeño, M. I., Pulido, F., & Quesada, A. (2023). The D165H Polymorphism of QiMYB-like-1 Is Linked to Interactions between Tannin Accumulation, Herbivory and Biogeographical Determinants of Quercus ilex. International Journal of Molecular Sciences, 24(1), 151. https://doi.org/10.3390/ijms24010151

