Intestinal ELF4 Deletion Exacerbates Alcoholic Liver Disease by Disrupting Gut Homeostasis
Abstract
:1. Introduction
2. Results
2.1. ELF4 Deficiency Leads to Increase in Colon Permeability
2.2. Elf4−/− Mice Exhibit GM Dysbiosis
2.3. An Increase in the Phylum Proteobacteria Is Positively Correlated with Higher LPS Levels
2.4. Elf4−/− Mice Showed Increased Alcohol-Induced Hepatic Inflammation Response
2.5. Elf4−/− Mice Showed Increased Alcohol-Induced Hepatic Steatosis
2.6. Alcohol Exposure Increases Hepatic Fibrosis in Elf4−/− Mice
2.7. ELF4 Deficiency Aggravates Alcohol-Induced Increased Permeability
2.8. ELF4 Knockout Worsens Alcohol-Induced GM Dysbiosis
3. Discussion
4. Materials and Methods
4.1. Mice and ALD (Alcohol-Related Liver Disease) Induction
4.2. Intestinal Permeability Test
4.3. CRISPR-Mediated ELF4 Knockout Cell Line
4.4. Whole Genome RNA Sequencing and GSEA Analysis
4.5. 16S rRNA NovaSeq Sequencing and Microbiota Analysis
4.6. Untargeted Metabolomics
4.7. Histopathological Analysis
4.8. Biochemical Analysis and Cytokine Measurements
4.9. Transepithelial Electrical Resistance (TEER) Assay
4.10. Quantitative PCR (qPCR)
4.11. Quantitative Proteomics
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bajaj, J.S. Alcohol, liver disease and the gut microbiota. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 235–246. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.J.; Gao, B.; Zakhari, S.; Nagy, L.E. Inflammation in alcoholic liver disease. Annu. Rev. Nutr. 2012, 32, 343–368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rehm, J.; Samokhvalov, A.V.; Shield, K.D. Global burden of alcoholic liver diseases. J. Hepatol. 2013, 59, 160–168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferrere, G.; Wrzosek, L.; Cailleux, F.; Turpin, W.; Puchois, V.; Spatz, M.; Ciocan, D.; Rainteau, D.; Humbert, L.; Hugot, C.; et al. Fecal microbiota manipulation prevents dysbiosis and alcohol-induced liver injury in mice. J. Hepatol. 2017, 66, 806–815. [Google Scholar] [CrossRef] [PubMed]
- Seitz, H.K.; Bataller, R.; Cortez-Pinto, H.; Gao, B.; Gual, A.; Lackner, C.; Mathurin, P.; Mueller, S.; Szabo, G.; Tsukamoto, H. Alcoholic liver disease. Nat. Rev. Dis. Primers 2018, 4, 16. [Google Scholar] [CrossRef] [PubMed]
- Parlesak, A.; Schäfer, C.; Schütz, T.; Bode, J.C.; Bode, C. Increased intestinal permeability to macromolecules and endotoxemia in patients with chronic alcohol abuse in different stages of alcohol-induced liver disease. J. Hepatol. 2000, 32, 742–747. [Google Scholar] [CrossRef]
- Kirpich, I.A.; McClain, C.J.; Vatsalya, V.; Schwandt, M.; Phillips, M.; Falkner, K.C.; Zhang, L.; Harwell, C.; George, D.T.; Umhau, J.C. Liver Injury and Endotoxemia in Male and Female Alcohol-Dependent Individuals Admitted to an Alcohol Treatment Program. Alcohol. Clin. Exp. Res. 2017, 41, 747–757. [Google Scholar] [CrossRef] [Green Version]
- Engen, P.A.; Green, S.J.; Voigt, R.M.; Forsyth, C.B.; Keshavarzian, A. The Gastrointestinal Microbiome: Alcohol Effects on the Composition of Intestinal Microbiota. Alcohol Res. Curr. Rev. 2015, 37, 223–236. [Google Scholar]
- Szabo, G.; Bala, S. Alcoholic liver disease and the gut-liver axis. World J. Gastroenterol. 2010, 16, 1321–1329. [Google Scholar] [CrossRef]
- Camara-Lemarroy, C.R.; Metz, L.; Meddings, J.B.; Sharkey, K.A.; Wee Yong, V. The intestinal barrier in multiple sclerosis: Implications for pathophysiology and therapeutics. Brain A J. Neurol. 2018, 141, 1900–1916. [Google Scholar] [CrossRef] [Green Version]
- Chopyk, D.M.; Grakoui, A. Contribution of the Intestinal Microbiome and Gut Barrier to Hepatic Disorders. Gastroenterology 2020, 159, 849–863. [Google Scholar] [CrossRef] [PubMed]
- Otani, T.; Furuse, M. Tight Junction Structure and Function Revisited. Trends Cell Biol. 2020, 30, 805–817. [Google Scholar] [CrossRef] [PubMed]
- Cornick, S.; Tawiah, A.; Chadee, K. Roles and regulation of the mucus barrier in the gut. Tissue Barriers 2015, 3, e982426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shao, T.; Zhao, C.; Li, F.; Gu, Z.; Liu, L.; Zhang, L.; Wang, Y.; He, L.; Liu, Y.; Liu, Q.; et al. Intestinal HIF-1α deletion exacerbates alcoholic liver disease by inducing intestinal dysbiosis and barrier dysfunction. J. Hepatol. 2018, 69, 886–895. [Google Scholar] [CrossRef] [PubMed]
- Maccioni, L.; Gao, B.; Leclercq, S.; Pirlot, B.; Horsmans, Y.; De Timary, P.; Leclercq, I.; Fouts, D.; Schnabl, B.; Stärkel, P. Intestinal permeability, microbial translocation, changes in duodenal and fecal microbiota, and their associations with alcoholic liver disease progression in humans. Gut Microbes 2020, 12, 1782157. [Google Scholar] [CrossRef] [PubMed]
- Szabo, G. Gut-liver axis in alcoholic liver disease. Gastroenterology 2015, 148, 30–36. [Google Scholar] [CrossRef] [Green Version]
- Suico, M.A.; Shuto, T.; Kai, H. Roles and regulations of the ETS transcription factor ELF4/MEF. J. Mol. Cell Biol. 2017, 9, 168–177. [Google Scholar] [CrossRef] [Green Version]
- Du, H.; Xia, H.; Liu, T.; Li, Y.; Liu, J.; Xie, B.; Chen, J.; Liu, T.; Cao, L.; Liu, S.; et al. Suppression of ELF4 in ulcerative colitis predisposes host to colorectal cancer. iScience 2021, 24, 102169. [Google Scholar] [CrossRef]
- Tyler, P.M.; Bucklin, M.L.; Zhao, M.; Maher, T.J.; Rice, A.J.; Ji, W.; Warner, N.; Pan, J.; Morotti, R.; McCarthy, P.; et al. Human autoinflammatory disease reveals ELF4 as a transcriptional regulator of inflammation. Nat. Immunol. 2021, 22, 1118–1126. [Google Scholar] [CrossRef]
- Mukherjee, S.; Hooper, L.V. Antimicrobial defense of the intestine. Immunity 2015, 42, 28–39. [Google Scholar] [CrossRef] [Green Version]
- Schroeder, B.O. Fight them or feed them: How the intestinal mucus layer manages the gut microbiota. Gastroenterol. Rep. 2019, 7, 3–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, Y.; Pedersen, O. Gut microbiota in human metabolic health and disease. Nat. Rev. Microbiol. 2021, 19, 55–71. [Google Scholar] [CrossRef] [PubMed]
- Hartmann, P.; Chen, W.C.; Schnabl, B. The intestinal microbiome and the leaky gut as therapeutic targets in alcoholic liver disease. Front. Physiol. 2012, 3, 402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Camilleri, M. Leaky gut: Mechanisms, measurement and clinical implications in humans. Gut 2019, 68, 1516–1526. [Google Scholar] [CrossRef]
- You, F.; Wang, P.; Yang, L.; Yang, G.; Zhao, Y.O.; Qian, F.; Walker, W.; Sutton, R.; Montgomery, R.; Lin, R.; et al. ELF4 is critical for induction of type I interferon and the host antiviral response. Nat. Immunol. 2013, 14, 1237–1246. [Google Scholar] [CrossRef] [Green Version]
- Kayama, H.; Okumura, R.; Takeda, K. Interaction between the Microbiota, Epithelia, and Immune Cells in the Intestine. Annu. Rev. Immunol. 2020, 38, 23–48. [Google Scholar] [CrossRef]
- Shin, N.R.; Whon, T.W.; Bae, J.W. Proteobacteria: Microbial signature of dysbiosis in gut microbiota. Trends Biotechnol. 2015, 33, 496–503. [Google Scholar] [CrossRef]
- Arrieta, M.C.; Stiemsma, L.T.; Dimitriu, P.A.; Thorson, L.; Russell, S.; Yurist-Doutsch, S.; Kuzeljevic, B.; Gold, M.J.; Britton, H.M.; Lefebvre, D.L.; et al. Early infancy microbial and metabolic alterations affect risk of childhood asthma. Sci. Transl. Med. 2015, 7, 307ra152. [Google Scholar] [CrossRef]
- Turroni, S.; Brigidi, P.; Cavalli, A.; Candela, M. Microbiota-Host Transgenomic Metabolism, Bioactive Molecules from the Inside. J. Med. Chem. 2018, 61, 47–61. [Google Scholar] [CrossRef]
- Jones, R.M.; Neish, A.S. Gut Microbiota in Intestinal and Liver Disease. Annu. Rev. Pathol. 2021, 16, 251–275. [Google Scholar] [CrossRef]
- Mandrekar, P.; Szabo, G. Signalling pathways in alcohol-induced liver inflammation. J. Hepatol. 2009, 50, 1258–1266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhat, A.A.; Uppada, S.; Achkar, I.W.; Hashem, S.; Yadav, S.K.; Shanmugakonar, M.; Al-Naemi, H.A.; Haris, M.; Uddin, S. Tight Junction Proteins and Signaling Pathways in Cancer and Inflammation: A Functional Crosstalk. Front. Physiol. 2018, 9, 1942. [Google Scholar] [CrossRef] [Green Version]
- Bruewer, M.; Luegering, A.; Kucharzik, T.; Parkos, C.A.; Madara, J.L.; Hopkins, A.M.; Nusrat, A. Proinflammatory cytokines disrupt epithelial barrier function by apoptosis-independent mechanisms. J. Immunol. (Baltim. Md.) 2003, 171, 6164–6172. [Google Scholar] [CrossRef] [Green Version]
- Schmitz, H.; Fromm, M.; Bentzel, C.J.; Scholz, P.; Detjen, K.; Mankertz, J.; Bode, H.; Epple, H.J.; Riecken, E.O.; Schulzke, J.D. Tumor necrosis factor-alpha (TNFalpha) regulates the epithelial barrier in the human intestinal cell line HT-29/B6. J. Cell Sci. 1999, 112 Pt 1, 137–146. [Google Scholar] [CrossRef]
- Paone, P.; Cani, P.D. Mucus barrier, mucins and gut microbiota: The expected slimy partners? Gut 2020, 69, 2232–2243. [Google Scholar] [CrossRef]
- Cray, P.; Sheahan, B.J.; Dekaney, C.M. Secretory Sorcery: Paneth Cell Control of Intestinal Repair and Homeostasis. Cell. Mol. Gastroenterol. Hepatol. 2021, 12, 1239–1250. [Google Scholar] [CrossRef]
- Fiorucci, S.; Distrutti, E. Bile Acid-Activated Receptors, Intestinal Microbiota, and the Treatment of Metabolic Disorders. Trends Mol. Med. 2015, 21, 702–714. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Wei, X.; Yin, X.; Wang, Y.; Zhang, M.; Zhao, C.; Zhao, H.; McClain, C.J.; Feng, W.; Zhang, X. Hepatic and fecal metabolomic analysis of the effects of Lactobacillus rhamnosus GG on alcoholic fatty liver disease in mice. J. Proteome Res. 2015, 14, 1174–1182. [Google Scholar] [CrossRef] [PubMed]
- Bull-Otterson, L.; Feng, W.; Kirpich, I.; Wang, Y.; Qin, X.; Liu, Y.; Gobejishvili, L.; Joshi-Barve, S.; Ayvaz, T.; Petrosino, J.; et al. Metagenomic analyses of alcohol induced pathogenic alterations in the intestinal microbiome and the effect of Lactobacillus rhamnosus GG treatment. PLoS ONE 2013, 8, e53028. [Google Scholar] [CrossRef] [PubMed]
- Zhai, Q.; Feng, S.; Arjan, N.; Chen, W. A next generation probiotic, Akkermansia muciniphila. Crit. Rev. Food Sci. Nutr. 2019, 59, 3227–3236. [Google Scholar] [CrossRef] [PubMed]
- Grander, C.; Adolph, T.E.; Wieser, V.; Lowe, P.; Wrzosek, L.; Gyongyosi, B.; Ward, D.V.; Grabherr, F.; Gerner, R.R.; Pfister, A.; et al. Recovery of ethanol-induced Akkermansia muciniphila depletion ameliorates alcoholic liver disease. Gut 2018, 67, 891–901. [Google Scholar] [CrossRef] [PubMed]
- Xia, T.; Duan, W.; Zhang, Z.; Li, S.; Zhao, Y.; Geng, B.; Zheng, Y.; Yu, J.; Wang, M. Polyphenol-rich vinegar extract regulates intestinal microbiota and immunity and prevents alcohol-induced inflammation in mice. Food Res. Int. (Ott. Ont.) 2021, 140, 110064. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.C.; Chen, Y.C.; Chen, S.J.; Lee, C.H.; Cheng, C.M. Alcohol Addiction, Gut Microbiota, and Alcoholism Treatment: A Review. Int. J. Mol. Sci. 2020, 21, 6413. [Google Scholar] [CrossRef] [PubMed]
- Schoeler, M.; Caesar, R. Dietary lipids, gut microbiota and lipid metabolism. Rev. Endocr. Metab. Disord. 2019, 20, 461–472. [Google Scholar] [CrossRef] [Green Version]
- Brown, J.; Pirrung, M.; McCue, L.A. FQC Dashboard: Integrates FastQC results into a web-based, interactive, and extensible FASTQ quality control tool. Bioinform. (Oxf. Engl.) 2017, 33, 3137–3139. [Google Scholar] [CrossRef] [Green Version]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map format and SAMtools. Bioinform. (Oxf. Engl.) 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Green Version]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinform. (Oxf. Engl.) 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Green Version]
- Hall, M.; Beiko, R.G. 16S rRNA Gene Analysis with QIIME2. Methods Mol. Biol. (Clifton N. J.) 2018, 1849, 113–129. [Google Scholar]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Want, E.J.; Masson, P.; Michopoulos, F.; Wilson, I.D.; Theodoridis, G.; Plumb, R.S.; Shockcor, J.; Loftus, N.; Holmes, E.; Nicholson, J.K. Global metabolic profiling of animal and human tissues via UPLC-MS. Nat. Protoc. 2013, 8, 17–32. [Google Scholar] [CrossRef] [PubMed]
- Chong, J.; Xia, J. MetaboAnalystR: An R package for flexible and reproducible analysis of metabolomics data. Bioinform. (Oxf. Engl.) 2018, 34, 4313–4314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Murine Ocln | TGAAAGTCCACCTCCTTACAGA | CCGGATAAAAAGAGTACGCTGG |
Murine Tjp1 | GCCGCTAAGAGCACAGCAA | GCCCTCCTTTTAACACATCAGA |
Murine a-SMA | CCCAGACATCAGGGAGTAATGG | TCTATCGGATACTTCAGCGTCA |
Murine Tnfα | CCCCAAAGGGATGAGAAGTT | TGGGCTACAGGCTTGTCACT |
Murine Ccl2 | GGGCCTGCTGTTCACAGTT | GGGATCATCTTGCTGGTGAA |
Murine Il1b | TGCACGCTCCGGGACTCACA | CATGGAGAACACCACTTGTTGCTCC |
Murine Hprt | TCAGTCAACGGGGGACATAAA | GGGGCTGTACTGCTTAACCAG |
Murine Gapdh | ATTCAACGGCACAGTCAAGG | GCAGAAGGGGCGGAGATGA |
Human βACTIN | TCCCTGGAGAAGAGCTACG | GTAGTTTCGTGGATGCCACA |
Human OCLN | ACAAGCGGTTTTATCCAGAGTC | GTCATCCACAGGCGAAGTTAAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, T.; Yu, H.; Zhang, Z.; Xie, Y.; Yang, L.; You, F. Intestinal ELF4 Deletion Exacerbates Alcoholic Liver Disease by Disrupting Gut Homeostasis. Int. J. Mol. Sci. 2022, 23, 4825. https://doi.org/10.3390/ijms23094825
Liu T, Yu H, Zhang Z, Xie Y, Yang L, You F. Intestinal ELF4 Deletion Exacerbates Alcoholic Liver Disease by Disrupting Gut Homeostasis. International Journal of Molecular Sciences. 2022; 23(9):4825. https://doi.org/10.3390/ijms23094825
Chicago/Turabian StyleLiu, Tongtong, Haitao Yu, Zeming Zhang, Yunfei Xie, Long Yang, and Fuping You. 2022. "Intestinal ELF4 Deletion Exacerbates Alcoholic Liver Disease by Disrupting Gut Homeostasis" International Journal of Molecular Sciences 23, no. 9: 4825. https://doi.org/10.3390/ijms23094825
APA StyleLiu, T., Yu, H., Zhang, Z., Xie, Y., Yang, L., & You, F. (2022). Intestinal ELF4 Deletion Exacerbates Alcoholic Liver Disease by Disrupting Gut Homeostasis. International Journal of Molecular Sciences, 23(9), 4825. https://doi.org/10.3390/ijms23094825