In Vitro SARS-CoV-2 Infection of Microvascular Endothelial Cells: Effect on Pro-Inflammatory Cytokine and Chemokine Release
Abstract
1. Introduction
2. Results
2.1. HMEC-1 Cells Express Low Levels of ACE2
2.2. HMEC-1 and VERO E6 SARS-CoV-2 Infection
2.3. SARS-CoV-2 Localization in HMEC-1
2.4. Cytokines and Tissue Factor Transcription upon SARS-CoV-2 HMEC-1 Infection
2.5. IL-6, IL-8, TNF-α, and IFN-α Protein Expression
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. ACE2 Expression in HMEC-1 and in VERO E6 Cells
4.3. SARS-CoV-2 Infection
4.4. Transmission Electron Microscopy (TEM)
4.5. RNA Extraction
4.6. Quantitative-Real Time PCR (qRT-PCR) for SARS-CoV-2
4.7. Cytokine and Human Tissue Factor (hTF) Transcription
- ΔCt cytokines = Ct cytokines − Ct GAPDH
- ΔCt mean cytokines = ∑Ct cytokines number of samples
- ΔΔCt = ΔCt mean cytokines in infected cells − ΔCt mean cytokines in non-infected cells
- Fold Difference = 2−ΔΔCt
4.8. IL-6, IL-8, TNF-α, and IFN-α Titres
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hikmet, F.; Méar, L.; Edvinsson, Å.; Micke, P.; Uhlén, M.; Lindskog, C. The protein expression profile of ACE2 in human tissues. Mol. Syst. Biol. 2020, 16, e9610. [Google Scholar] [CrossRef] [PubMed]
- Ortiz-Prado, E.; Simbaña-Rivera, K.; Gómez-Barreno, L.; Rubio-Neira, M.; Guaman, L.P.; Kyriakidis, N.C.; Muslin, C.; Jaramillo, A.M.G.; Barba-Ostria, C.; Cevallos-Robalino, D.; et al. Clinical, molecular, and epidemiological characterization of the SARS-CoV-2 virus and the Coronavirus Disease 2019 (COVID-19), a comprehensive literature review. Diagn. Microbiol. Infect. Dis. 2020, 98, 115094. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Yang, X.L.; Wang, X.G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.R.; Zhu, Y.; Li, B.; Huang, C.L.; et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef] [PubMed]
- Cooke, J. The endothelium: A new target for therapy. Vasc. Med. 2000, 5, 49–53. [Google Scholar] [CrossRef]
- Varga, Z.; Flammer, A.; Steiger, P.; Haberecker, M.; Andermatt, R.; Zinkernagel, A.; Mehra, M.; Schuepbach, R.; Ruschitzka, F.; Moch, H. Endothelial cell infection and endotheliitis in COVID-19. Lancet 2020, 395, 1417–1418. [Google Scholar] [CrossRef]
- Schaefer, I.M.; Padera, R.F.; Solomon, I.H.; Kanjilal, S.; Hammer, M.M.; Hornick, J.L.; Sholl, L.M. In situ detection of SARS-CoV-2 in lungs and airways of patients with COVID-19. Mod. Pathol. 2020, 33, 2104–2114. [Google Scholar] [CrossRef]
- Sardu, C.; Gambardella, J.; Morelli, M.B.; Wang, X.; Marfella, R.; Santulli, G. Hypertension, thrombosis, kidney failure, and diabetes: Is covid-19 an endothelial disease? a comprehensive evaluation of clinical and basic evidence. J. Clin. Med. 2020, 9, 1417. [Google Scholar] [CrossRef]
- Hojyo, S.; Uchida, M.; Tanaka, K.; Hasebe, R.; Tanaka, Y.; Murakami, M.; Hirano, T. How COVID-19 induces cytokine storm with high mortality. Inflamm. Regen. 2020, 40, 37. [Google Scholar] [CrossRef]
- Jin, Y.; Ji, W.; Yang, H.; Chen, S.; Zhang, W.; Duan, G. Endothelial activation and dysfunction in COVID-19: From basic mechanisms to potential therapeutic approaches. Signal Transduct. Target. Ther. 2020, 5, 293. [Google Scholar] [CrossRef]
- Tang, Y.; Liu, J.; Zhang, D.; Xu, Z.; Ji, J.; Wen, C. Cytokine Storm in COVID-19: The Current Evidence and Treatment Strategies. Front. Immunol. 2020, 11, 1708. [Google Scholar] [CrossRef]
- Colmenero, I.; Santonja, C.; Alonso-Riaño, M.; Noguera-Morel, L.; Hernández-Martín, A.; Andina, D.; Wiesner, T.; Rodríguez-Peralto, J.L.; Requena, L.; Torrelo, A. SARS-CoV-2 endothelial infection causes COVID-19 chilblains: Histopathological, immunohistochemical and ultrastructural study of seven paediatric cases. Br. J. Dermatol. 2020, 183, 729–737. [Google Scholar] [CrossRef] [PubMed]
- Caccuri, F.; Bugatti, A.; Zani, A.; De Palma, A.; Di Silvestre, D.; Manocha, E.; Filippini, F.; Messali, S.; Chiodelli, P.; Campisi, G.; et al. Sars-cov-2 infection remodels the phenotype and promotes angiogenesis of primary human lung endothelial cells. Microorganisms 2021, 9, 1438. [Google Scholar] [CrossRef] [PubMed]
- Monteil, V.; Kwon, H.; Prado, P.; Hagelkrüys, A.; Wimmer, R.A.; Stahl, M.; Leopoldi, A.; Garreta, E.; Hurtado del Pozo, C.; Prosper, F.; et al. Inhibition of SARS-CoV-2 Infections in Engineered Human Tissues Using Clinical-Grade Soluble Human ACE2. Cell 2020, 181, 905–913.e7. [Google Scholar] [CrossRef] [PubMed]
- Schimmel, L.; Chew, K.Y.; Stocks, C.J.; Yordanov, T.E.; Essebier, P.; Kulasinghe, A.; Monkman, J.; Santos Miggiolaro, A.F.R.; Cooper, C.; Noronha, L.; et al. Endothelial cells are not productively infected by SARS-CoV-2. Clin. Transl. Immunol. 2021, 10, e1350. [Google Scholar] [CrossRef]
- Wurtz, N.; Penant, G.; Jardot, P.; Duclos, N.; La Scola, B. Culture of SARS-CoV-2 in a panel of laboratory cell lines, permissivity, and differences in growth profile. Eur. J. Clin. Microbiol. Infect. Dis. 2021, 40, 477–484. [Google Scholar] [CrossRef]
- Ferrario, C.M.; Jessup, J.; Chappell, M.C.; Averill, D.B.; Brosnihan, K.B.; Tallant, E.A.; Diz, D.I.; Gallagher, P.E. Effect of angiotensin-converting enzyme inhibition and angiotensin II receptor blockers on cardiac angiotensin-converting enzyme 2. Circulation 2005, 111, 2605–2610. [Google Scholar] [CrossRef]
- Ashraf, U.M.; Abokor, A.A.; Edwards, J.M.; Waigi, E.W.; Royfman, R.S.; Hasan, S.A.M.; Smedlund, K.B.; Hardy, A.M.G.; Chakravarti, R.; Koch, L.G. Sars-cov-2, ace2 expression, and systemic organ invasion. Physiol. Genom. 2021, 53, 51–60. [Google Scholar] [CrossRef]
- Cantuti-Castelvetri, L.; Ojha, R.; Pedro, L.D.; Djannatian, M.; Franz, J.; Kuivanen, S.; van der Meer, F.; Kallio, K.; Kaya, T.; Anastasina, M.; et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science 2020, 370, 856–860. [Google Scholar] [CrossRef]
- Daly, J.L.; Simonetti, B.; Klein, K.; Chen, K.E.; Williamson, M.K.; Antón-Plágaro, C.; Shoemark, D.K.; Simón-Gracia, L.; Bauer, M.; Hollandi, R.; et al. Neuropilin-1 is a host factor for SARS-CoV-2 infection. Science 2020, 370, 861–865. [Google Scholar] [CrossRef]
- Raimondi, C.; Brash, J.T.; Fantin, A.; Ruhrberg, C. NRP1 function and targeting in neurovascular development and eye disease. Prog. Retin. Eye Res. 2016, 52, 64–83. [Google Scholar] [CrossRef]
- Soker, S.; Takashima, S.; Miao, H.Q.; Neufeld, G.; Klagsbrun, M. Neuropilin-1 is expressed by endothelial and tumor cells as an isoform- specific receptor for vascular endothelial growth factor. Cell 1998, 92, 735–745. [Google Scholar] [CrossRef]
- Matheson, N.J.; Lehner, P.J. How does SARS-CoV-2 cause COVID-19? Science 2020, 369, 510–511. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Krüger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e8. [Google Scholar] [CrossRef] [PubMed]
- Shang, J.; Wan, Y.; Luo, C.; Ye, G.; Geng, Q.; Auerbach, A.; Li, F. Cell entry mechanisms of SARS-CoV-2. Proc. Natl. Acad. Sci. USA 2020, 117, 11727–11734. [Google Scholar] [CrossRef]
- Aimes, R.T.; Zijlstra, A.; Hooper, J.D.; Ogbourne, S.M.; Sit, M.L.; Fuchs, S.; Gotley, D.C.; Quigley, J.P.; Antalis, T.M. Endothelial cell serine proteases expressed during vascular morphogenesis and angiogenesis. Thromb Haemost. 2003, 89, 561–572. [Google Scholar] [CrossRef]
- Pantazi, I.; Al-Qahtani, A.A.; Alhamlan, F.S.; Alothaid, H.; Matou-Nasri, S.; Sourvinos, G.; Vergadi, E.; Tsatsanis, C. SARS-CoV-2/ACE2 Interaction Suppresses IRAK-M Expression and Promotes Pro-Inflammatory Cytokine Production in Macrophages. Front. Immunol. 2021, 12, 683800. [Google Scholar] [CrossRef]
- Patra, T.; Meyer, K.; Geerling, L.; Isbell, T.S.; Hoft, D.F.; Brien, J.; Pinto, A.K.; Ray, R.B.; Ray, R. SARS-CoV-2 spike protein promotes IL-6 transsignaling by activation of angiotensin II receptor signaling in epithelial cells. PLoS Pathog. 2020, 16, e1009128. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, C.; Huang, F.; Yang, Y.; Wang, F.; Yuan, J.; Zhang, Z.; Qin, Y.; Li, X.; Zhao, D.; et al. Elevated plasma levels of selective cytokines in COVID-19 patients reflect viral load and lung injury. Natl. Sci. Rev. 2020, 7, 1003–1011. [Google Scholar] [CrossRef]
- Pedersen, S.F.; Ho, Y.C. SARS-CoV-2: A storm is raging. J. Clin. Investig. 2020, 130, 2202–2205. [Google Scholar] [CrossRef]
- McElvaney, O.J.; McEvoy, N.L.; McElvaney, O.F.; Carroll, T.P.; Murphy, M.P.; Dunlea, D.M.; Choileáin, O.N.; Clarke, J.; O’Connor, E.; Hogan, G.; et al. Characterization of the inflammatory response to severe COVID-19 Illness. Am. J. Respir. Crit. Care Med. 2020, 202, 812–821. [Google Scholar] [CrossRef]
- Karwaciak, I.; Sałkowska, A.; Karaś, K.; Dastych, J.; Ratajewski, M. Nucleocapsid and spike proteins of the coronavirus SARS-CoV-2 induce il6 in monocytes and macrophages—Potential implications for cytokine storm syndrome. Vaccines 2021, 9, 54. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wu, K.; Wang, D.; Yue, X.; Song, D.; Zhu, Y.; Wu, J. Nucleocapsid protein of SARS-CoV activates interleukin-6 expression through cellular transcription factor NF-κB. Virology 2007, 365, 324–335. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.; Kishimoto, T. Interplay between interleukin-6 signaling and the vascular endothelium in cytokine storms. Exp. Mol. Med. 2021, 53, 1116–1123. [Google Scholar] [CrossRef] [PubMed]
- Imaizumi, T.; Itaya, H.; Fujita, K.; Kudoh, D.; Kudoh, S.; Mori, K.; Fujimoto, K.; Matsumiya, T.; Yoshida, H.; Satoh, K. Expression of tumor necrosis factor-alpha in cultured human endothelial cells stimulated with lipopolysaccharide or interleukin-1alpha. Arter. Thromb Vasc. Biol. 2000, 20, 410–415. [Google Scholar] [CrossRef] [PubMed]
- Ranta, V.; Orpana, A.; Carpén, O.; Turpeinen, U.; Ylikorkala, O.; Viinikka, L. Human vascular endothelial cells produce tumor necrosis factor-alpha in response to proinflammatory cytokine stimulation. Crit. Care Med. 1999, 27, 2184–2187. [Google Scholar] [CrossRef] [PubMed]
- Kraus, A.A.; Raftery, M.J.; Giese, T.; Ulrich, R.; Zawatzky, R.; Hippenstiel, S.; Suttorp, N.; Krüger, D.H.; Schönrich, G. Differential Antiviral Response of Endothelial Cells after Infection with Pathogenic and Nonpathogenic Hantaviruses. J. Virol. 2004, 78, 6143–6150. [Google Scholar] [CrossRef]
- Flammer, A.J.; Anderson, T.; Celermajer, D.S.; Creager, M.A.; Deanfield, J.; Ganz, P.; Hamburg, N.M.; Lüscher, T.F.; Shechter, M.; Taddei, S.; et al. The assessment of endothelial function: From research into clinical practice. Circulation 2012, 126, 753–767. [Google Scholar] [CrossRef]
- Subramaniam, S.; Scharrer, I. Procoagulant activity during viral infections. Front. Biosci 2018, 1, 1060–1081. [Google Scholar]
- Bautista-Vargas, M.; Bonilla-Abadía, F.; Cañas, C.A. Potential role for tissue factor in the pathogenesis of hypercoagulability associated with in COVID-19. J. Thromb. Thrombolysis 2020, 50, 479–483. [Google Scholar] [CrossRef]
- Ades, E.; Candal, F.; Swerlick, R.; George, V.; Summers, S.; Bosse, D.; Lawley, T. HMEC-1: Establishment of an immortalized human microvascular endothelial cell line. J. Investig. Dermatol. 1992, 99, 683–690. [Google Scholar] [CrossRef]
- Delbue, S.; D’Alessandro, S.; Signorini, L.; Dolci, M.; Pariani, E.; Bianchi, M.; Fattori, S.; Modenese, A.; Galli, C.; Eberini, I.; et al. Isolation of SARS-CoV-2 strains carrying a nucleotide mutation, leading to a stop codon in the ORF 6 protein. Emerg. Microbes Infect. 2021, 10, 252–255. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control and Prevention (CDC). Available online: https://www.cdc.gov/ (accessed on 31 March 2022).
- World Health Organization (WHO). Available online: https://www.who.int/ (accessed on 31 March 2022).
- Moreira, L.; de Souza Luna, L.; Barbosa, G.; Perosa, A.; Chaves, A.; Conte, D.; Carvalho, J.; Bellei, N. Test on stool samples improves the diagnosis of hospitalized patients: Detection of SARS-CoV-2 genomic and subgenomic RNA. J. Infect. 2021, 82, 186–230. [Google Scholar] [CrossRef] [PubMed]
- Strong, A.L.; Gimble, J.M.; Bunnell, B.A. Analysis of the Pro- and Anti-Inflammatory Cytokines Secreted by Adult Stem Cells during Differentiation. Stem Cells Int. 2015, 2015, 412467. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Shuai, H.; Chu, H.; Hou, Y.; Yang, D.; Wang, Y.; Hu, B. Differential immune activation profile of SARS-CoV-2 and SARS-CoV infection in human lung and intestinal cells: Implications for treatment with IFN- β and IFN inducer. Br. J. Dermatol. 2020, 183, 729–737. [Google Scholar] [CrossRef] [PubMed]
- Wilsmann-Theis, D.; Koch, S.; Mindnich, C.; Bonness, S.; Schnautz, S.; Von Bubnoff, D.; Bieber, T. Generation and functional analysis of human TNF-α/iNOS-producing dendritic cells (Tip-DC). Allergy Eur. J. Allergy Clin. Immunol. 2013, 68, 890–898. [Google Scholar] [CrossRef]
- Cañas, C.; Cañas, F.; Bautista-Vargas, M.; Bonilla-Abadía, F. Role of Tissue Factor in the Pathogenesis of COVID-19 and the Possible Ways to Inhibit It. Clin. Appl. Thromb. 2021, 27, 1–9. [Google Scholar] [CrossRef]
- Rhyu, D.-W.; Kang, Y.-J.; Ock, M.-S.; Eo, J.-W.; Choi, Y.-H.; Kim, W.-J.; Leem, S.-H.; Yi, J.-M.; Kim, H.-S.; Cha, H.-J. Expression of Human Endogenous Retrovirus env Genes in the Blood of Breast Cancer Patients. Int. J. Mol. Sci. 2014, 15, 9173–9183. [Google Scholar] [CrossRef]






| Target Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| IL-6 [45] | GTAGCCGCCCCACACAGACAGCC | GCCATCTTTGGAAGGTTC |
| IL-8 [46] | CCACCGGAAGGAACCATCTC | GGGGTGGAAAGGTTTGGAGT |
| TNF-α [47] | CTCCAGGCGGTGCCTATGT | GAAGAGCGTGGTGGCCC |
| IFN-α [46] | AGAATCACTCTCTATCTGAAAGAGAAG | TCATGATTTCTGCTCTGACAACCT |
| hTF [48] | TCCCCAGAGTTCACACCTTACC | TGACCACAAATACCACAGCTCC |
| GAPDH [49] | GCCCAGGATGCCCTTGA | GTGTCCCCACTGCCAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dolci, M.; Signorini, L.; D’Alessandro, S.; Perego, F.; Parapini, S.; Sommariva, M.; Taramelli, D.; Ferrante, P.; Basilico, N.; Delbue, S. In Vitro SARS-CoV-2 Infection of Microvascular Endothelial Cells: Effect on Pro-Inflammatory Cytokine and Chemokine Release. Int. J. Mol. Sci. 2022, 23, 4063. https://doi.org/10.3390/ijms23074063
Dolci M, Signorini L, D’Alessandro S, Perego F, Parapini S, Sommariva M, Taramelli D, Ferrante P, Basilico N, Delbue S. In Vitro SARS-CoV-2 Infection of Microvascular Endothelial Cells: Effect on Pro-Inflammatory Cytokine and Chemokine Release. International Journal of Molecular Sciences. 2022; 23(7):4063. https://doi.org/10.3390/ijms23074063
Chicago/Turabian StyleDolci, Maria, Lucia Signorini, Sarah D’Alessandro, Federica Perego, Silvia Parapini, Michele Sommariva, Donatella Taramelli, Pasquale Ferrante, Nicoletta Basilico, and Serena Delbue. 2022. "In Vitro SARS-CoV-2 Infection of Microvascular Endothelial Cells: Effect on Pro-Inflammatory Cytokine and Chemokine Release" International Journal of Molecular Sciences 23, no. 7: 4063. https://doi.org/10.3390/ijms23074063
APA StyleDolci, M., Signorini, L., D’Alessandro, S., Perego, F., Parapini, S., Sommariva, M., Taramelli, D., Ferrante, P., Basilico, N., & Delbue, S. (2022). In Vitro SARS-CoV-2 Infection of Microvascular Endothelial Cells: Effect on Pro-Inflammatory Cytokine and Chemokine Release. International Journal of Molecular Sciences, 23(7), 4063. https://doi.org/10.3390/ijms23074063

