Exogenous SA Affects Rice Seed Germination under Salt Stress by Regulating Na+/K+ Balance and Endogenous GAs and ABA Homeostasis
Abstract
:1. Introduction
2. Results
2.1. Exogenous SA Promoted the Germination of Rice Seeds under Salt Stress
2.2. Exogenous SA Maintained Ion Homeostasis in Rice Seeds under Salt Stress
2.3. Exogenous SA Promoted the Expression of OsHKTs under Salt Stress
2.4. Exogenous SA Increased the Activity of Antioxidant Enzymes and Promoted the Scavenging of ROS under Salt Stress
2.5. Exogenous SA Positively Regulated GAs and ABA Homeostasis under Salt Stress
2.6. Exogenous SA Regulated GA and ABA Metabolism under Salt Stress
2.7. Exogenous SA Alleviated the Inhibition of α-Amylase Activity by Salinity and Increased the Accumulation of Soluble Sugars
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Germination Treatments
4.2. Seed Germination Analysis
4.3. Determination of Na+ and K+ Content
4.4. Quantification of ROS Levels and Antioxidant Enzyme Assays
4.5. RNA Isolation, cDNA Synthesis, and Gene Expression Analysis
4.6. Quantification of GA1, GA4, and ABA in Rice Seeds
4.7. Quantitative Assay for α-Amylase Activity
4.8. Determination of Soluble Sugar Content in Rice Seeds
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rasheed, F.; Anjum, N.A.; Masood, A.; Sofo, A.; Khan, N.A. The key roles of salicylic acid and sulfur in plant salinity stress tolerance. J. Plant Growth Regul. 2020, 1–14. [Google Scholar] [CrossRef]
- Ismail, A.; Takeda, S.; Nick, P. Life and death under salt stress: Same players, different timing? J. Exp. Bot. 2014, 65, 2963–2979. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qadir, M.; Quillérou, E.; Nangia, V.; Murtaza, G.; Singh, M.; Thomas, R.J.; Drechsel, P.; Noble, A.D. Economics of salt-induced land degradation and restoration. Nat. Res. Forum. 2014, 38, 282–295. [Google Scholar] [CrossRef]
- Jamil, A.; Riaz, S.; Ashraf, M.; Foolad, M.R. Gene expression profling of plants under salt stress. Crit. Rev. Plant Sci. 2011, 30, 435–458. [Google Scholar] [CrossRef]
- Munns, R.; Termaat, A. Whole plant response to salinity. Aust. J. Plant Physiol. 1986, 13, 143–160. [Google Scholar] [CrossRef]
- Tester, M.; Langridge, P. Breeding technologies to increase crop production in a changing world. Science 2010, 327, 818–822. [Google Scholar] [CrossRef]
- Shabala, S. Learning from halophytes: Physiological basis and strategies to improve abiotic stress tolerance in crops. Ann. Bot. 2013, 112, 1209–1221. [Google Scholar] [CrossRef]
- Sasaki, T. The map-based sequence of the rice genome. Nature 2005, 436, 793–800. [Google Scholar] [CrossRef] [PubMed]
- Takehisa, H.; Shimodate, T.; Fukuta, Y.; Ueda, T.; Yano, M.; Yamaya, T.; Kameya, T.; Sato, T. Identification of quantitative trait loci for plant growth of rice in paddy field flooded with salt water. Field Crops Res. 2004, 89, 85–95. [Google Scholar] [CrossRef]
- Tuteja, N.; Sahoo, R.K.; Garg, B.; Tuteja, R. OsSUV3 dual helicase functions in salinity stress tolerance by maintaining photosynthesis and antioxidant machinery in rice (Oryza sativa L. cv. IR64). Plant J. 2013, 76, 115–127. [Google Scholar] [CrossRef]
- Razzaq, A.; Ali, A.; Safdar, L.B.; Zafar, M.M.; Rui, Y.; Shakeel, A.; Shaukat, A.; Ashraf, M.; Gong, W.; Yuan, Y. Salt stress induces physiochemical alterations in rice grain composition and quality. J. Food Sci. 2020, 85, 14–20. [Google Scholar] [CrossRef] [PubMed]
- Bewley, J.D. Seed germination and dormancy. Plant Cell 1997, 9, 1055–1066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gad, M.; Chao, H.; Li, H.; Zhao, W.; Lu, G.; Li, M. QTL mapping for seed germination response to drought stress in Brassica napus. Front. Plant Sci. 2021, 11, 629970. [Google Scholar] [CrossRef]
- Yang, L.; Liu, S.; Lin, R. The role of light in regulating seed dormancy and germination. J. Integr. Plant Biol. 2020, 62, 1310–1326. [Google Scholar] [CrossRef] [PubMed]
- Shen, Q.; Zhang, S.; Liu, S.; Chen, J.; Ma, H.; Cui, Z.; Zhang, X.; Ge, C.; Liu, R.; Li, Y.; et al. Comparative transcriptome analysis provides insights into the seed germination in cotton in response to chilling stress. Int. J. Mol. Sci. 2020, 21, 2067. [Google Scholar] [CrossRef] [Green Version]
- Cheng, B.; Li, Z.; Liang, L.; Cao, Y.; Zeng, W.; Zhang, X.; Ma, X.; Huang, L.; Nie, G.; Liu, W.; et al. The γ-aminobutyric acid (GABA) alleviates salt stress damage during seeds germination of white clover associated with Na+/K+ transportation, dehydrins accumulation, and stress-related genes expression in white clover. Int. J. Mol. Sci. 2018, 19, 2520. [Google Scholar] [CrossRef] [PubMed]
- Mahanta, S.; Habib, M.R.; Moore, J.M. Effect of high-voltage atmospheric cold plasma treatment on germination and heavy metal uptake by soybeans (Glycine max). Int. J. Mol. Sci. 2022, 23, 1611. [Google Scholar] [CrossRef] [PubMed]
- El Moukhtari, A.; Cabassa-Hourton, C.; Farissi, M.; Savouré, A. How does proline treatment promote salt stress tolerance during crop plant development? Front. Plant Sci. 2020, 11, 1127. [Google Scholar] [CrossRef]
- Shi, Y.; Gao, L.; Wu, Z.; Zhang, X.; Wang, M.; Zhang, C.; Zhang, F.; Zhou, Y.; Li, Z. Genome-wide association study of salt tolerance at the seed germination stage in rice. BMC Plant Biol. 2017, 17, 92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, E.; Chen, M.; He, H.; Zhan, C.; Cheng, Y.; Zhang, H.; Wang, Z. Proteomic analysis reveals proteins involved in seed imbibition under salt stress in rice. Front. Plant Sci. 2017, 7, 2006. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fujino, K.; Sekiguchi, H.; Sato, T.; Kiuchi, H.; Nonoue, Y.; Takeuchi, Y.; Ando, T.; Lin, S.Y.; Yano, M. Mapping of quantitative trait loci controlling low-temperature germinability in rice (Oryza sativa L.). Theor. Appl. Genet. 2004, 108, 794–799. [Google Scholar] [CrossRef] [PubMed]
- Binenbaum, J.; Weinstain, R.; Shani, E. Gibberellin localization and transport in plants. Trends Plant Sci. 2018, 23, 410–421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, L.; Xia, W.; Li, H.; Zeng, H.; Wei, B.; Han, S.; Yin, C. Salinity inhibits rice seed germination by reducing α-amylase activity via decreased bioactive gibberellin content. Front. Plant Sci. 2018, 9, 275. [Google Scholar] [CrossRef] [PubMed]
- Nakaune, M.; Hanada, A.; Yin, Y.G.; Matsukura, C.; Yamaguchi, S.; Ezura, H. Molecular and physiological dissection of enhanced seed germination using short-term low-concentration salt seed priming in tomato. Plant Physiol. Biochem. 2012, 52, 28–37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamaguchi, S. Gibberellin metabolism and its regulation. Annu. Rev. Plant Biol. 2008, 59, 225–251. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, M.; Yamaguchi, I.; Murofushi, N.; Ota, Y.; Takahashi, N. Fluctuation and localization of endogenous gibberellins in rice. Agric. Biol. Chem. 1988, 52, 1189–1194. [Google Scholar]
- Frigerio, M.; Alabadí, D.; Pérez-Gómez, J.; García-Cárcel, L.; Phillips, A.L.; Hedden, P.; Blázquez, M.A. Transcriptional regulation of gibberellin metabolism genes by auxin signaling in Arabidopsis. Plant Physiol. 2006, 142, 553–563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fleet, C.M.; Yamaguchi, S.; Hanada, A.; Kawaide, H.; David, C.J.; Kamiya, Y.; Sun, T. Overexpression of AtCPS and AtKS in Arabidopsis confers increased ent-kaurene production but no increase in bioactive gibberellins. Plant Physiol. 2003, 132, 830–839. [Google Scholar] [CrossRef] [Green Version]
- Lo, S.F.; Yang, S.Y.; Chen, K.T.; Hsing, Y.I.; Zeevaart, J.A.; Chen, L.J.; Yu, S.M. A novel class of gibberellin 2-oxidases control semidwarfism, tillering, and root development in rice. Plant Cell 2008, 20, 2603–2618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.; Ye, N.; Liu, R.; Chen, M.; Zhang, J. H2O2 mediates the regulation of ABA catabolism and GA biosynthesis in Arabidopsis seed dormancy and germination. J. Exp. Bot. 2010, 61, 2979–2990. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Lu, B.; Liu, L.; Duan, W.; Jiang, D.; Li, J.; Zhang, K.; Sun, H.; Zhang, Y.; Li, C.; et al. Melatonin promotes seed germination under salt stress by regulating ABA and GA3 in cotton (Gossypium hirsutum L.). Plant Physiol. Biochem. 2021, 162, 506–516. [Google Scholar] [CrossRef]
- Zhu, G.; Ye, N.; Zhang, J. Glucose-induced delay of seed germination in rice is mediated by the suppression of ABA catabolism rather than an enhancement of ABA biosynthesis. Plant Cell Physiol. 2009, 50, 644–651. [Google Scholar] [CrossRef] [PubMed]
- Tan, B.C.; Joseph, L.M.; Deng, W.T.; Liu, L.; Li, Q.B.; Cline, K.; McCarty, D.R. Molecular characterization of the Arabidopsis 9-cis epoxycarotenoid dioxygenase gene family. Plant J. 2003, 35, 44–56. [Google Scholar] [CrossRef]
- Nambara, E.; Marion-Poll, A. Abscisic acid biosynthesis and catabolism. Annu. Rev. Plant Biol. 2005, 56, 165–185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chono, M.; Matsunaka, H.; Seki, M.; Fujita, M.; Kiribuchi-Otobe, C.; Oda, S.; Kojima, H.; Kobayashi, D.; Kawakami, N. Isolation of a wheat (Triticum aestivum L.) mutant in ABA 8′-hydroxylase gene: Effect of reduced ABA catabolism on germination inhibition under field condition. Breed. Sci. 2013, 63, 104–115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fidler, J.; Zdunek-Zastocka, E.; Prabucka, B.; Bielawski, W. Abscisic acid content and the expression of genes related to its metabolism during maturation of triticale grains of cultivars differing in pre-harvest sprouting susceptibility. J. Plant Physiol. 2016, 207, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Zhao, C.; Zhang, M.; Yuan, F.; Chen, M. Exogenous melatonin improves seed germination in Limonium bicolor under salt stress. Plant Signal. Behav. 2019, 14, 1659705. [Google Scholar] [CrossRef] [PubMed]
- Hoang, H.H.; Sechet, J.; Bailly, C.; Leymarie, J.; Corbineau, F. Inhibition of germination of dormant barley (Hordeum vulgare L.) grains by blue light as related to oxygen and hormonal regulation. Plant Cell Environ. 2014, 37, 1393–1403. [Google Scholar] [CrossRef] [PubMed]
- Damaris, R.N.; Lin, Z.; Yang, P.; He, D. The rice alpha-amylase, conserved regulator of seed maturation and germination. Int. J. Mol. Sci. 2019, 20, 450. [Google Scholar] [CrossRef] [Green Version]
- Pujadas, G.; Palau, J. Evolution of alpha-amylases: Architectural features and key residues in the stabilization of the (β/α)(8) scaffold. Mol. Biol. Evol. 2001, 18, 38–54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaneko, M.; Itoh, H.; Ueguchi-Tanaka, M.; Ashikari, M.; Matsuoka, M. The α-amylase induction in endosperm during rice seed germination is caused by gibberellin synthesized in epithelium. Plant Physiol. 2002, 128, 1264–1270. [Google Scholar] [CrossRef] [Green Version]
- Hasegawa, P.M.; Bressan, R.A.; Zhu, J.K.; Bohnert, H.J. Plant cellular and molecular responses to high salinity. Annu. Rev. Plant Biol. 2000, 51, 463–499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
- Luo, X.; Dai, Y.; Zheng, C.; Yang, Y.; Chen, W.; Wang, Q.; Chandrasekaran, U.; Du, J.; Liu, W.; Shu, K. The ABI4-RbohD/VTC2 regulatory module promotes reactive oxygen species (ROS) accumulation to decrease seed germination under salinity stress. New Phytol. 2021, 2, 950–962. [Google Scholar] [CrossRef] [PubMed]
- Guzmán-Murillo, M.A.; Ascencio, F.; Larrinaga-Mayoral, J.A. Germination and ROS detoxification in bell pepper (Capsicum annuum L.) under NaCl stress and treatment with microalgae extracts. Protoplasma 2013, 1, 33–42. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.N.; Li, Y.; Khan, Z.; Chen, L.; Liu, J.; Hu, J. Nanoceria seed priming enhanced salt tolerance in rapeseed through modulating ROS homeostasis and α-amylase activities. J. Nanobiotechnol. 2021, 19, 276. [Google Scholar] [CrossRef]
- Raskin, I. Role of salicylic acid in plants. Annu. Rev. Plant Biol. 1992, 43, 439–463. [Google Scholar] [CrossRef]
- Xie, Z.; Zhang, Z.L.; Hanzlik, S.; Cook, E.; Shen, Q.J. Salicylic acid inhibits gibberellin-induced alpha-amylase expression and seed germination via a pathway involving an abscisic-acid-inducible WRKY gene. Plant Mol. Biol. 2007, 64, 293–303. [Google Scholar] [CrossRef]
- Misra, N.; Saxena, P. Effect of salicylic acid on proline metabolism in lentil grown under salinity stress. Plant Sci. 2009, 177, 181–189. [Google Scholar] [CrossRef]
- Shaki, F.; Maboud, H.E.; Niknam, V. Effects of salicylic acid on hormonal cross talk, fatty acids profile, and ions homeostasis from salt-stressed safflower. J. Plant Interact. 2019, 14, 340–346. [Google Scholar] [CrossRef] [Green Version]
- Ahanger, M.A.; Aziz, U.; Alsahli, A.A.; Alyemeni, M.N.; Ahmad, P. Influence of exogenous salicylic acid and nitric oxide on growth, photosynthesis, and ascorbate-glutathione cycle in salt stressed Vigna angularis. Biomolecules 2020, 10, 42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Afzal, I.; Basra, S.M.; Farooq, M.; Nawaz, A. Alleviation of salinity stress in spring wheat by hormonal priming with ABA, salicylic acid and ascorbic acid. Int. J. Agric. Biol. 2006, 8, 23–28. [Google Scholar]
- Hayat, S.; Maheshwari, P.; Wani, A.S.; Irfan, M.; Alyemeni, M.N.; Ahmad, A. Comparative effect of 28 homobrassinolide and salicylic acid in the amelioration of NaCl stress in Brassica juncea L. Plant Physiol. Biochem. 2012, 53, 61–68. [Google Scholar] [CrossRef] [PubMed]
- El-Khallal, S.M.; Hathout, T.A.; Ashour, A.A.; Kerrit, A.A. Brassinolide and salicylic acid induced growth, biochemical activities and productivity of maize plants grown under salt stress. Res. J. Agric. Biol. Sci. 2009, 5, 380–390. [Google Scholar]
- Ghassemi-Golezani, K.; Farhangi-Abriz, S. Changes in oil accumulation and fatty acid composition of soybean seeds under salt stress in response to salicylic acid and jasmonic acid. Russ. J. Plant Physiol. 2018, 65, 229–236. [Google Scholar] [CrossRef]
- Sheteiwy, M.S.; An, J.; Yin, M.; Jia, X.; Guan, Y.; He, F.; Hu, J. Cold plasma treatment and exogenous salicylic acid priming enhances salinity tolerance of Oryza sativa seedlings. Protoplasma 2019, 256, 79–99. [Google Scholar] [CrossRef] [PubMed]
- Jini, D.; Joseph, B. Physiological mechanism of salicylic acid for alleviation of salt stress in rice. Rice Sci. 2017, 24, 97–108. [Google Scholar] [CrossRef]
- Yu, Y.; Wang, J.; Shi, H.; Gu, J.; Dong, J.; Deng, X.; Huang, R. Salt Stress and Ethylene Antagonistically Regulate Nucleocytoplasmic Partitioning of COP1 to Control Seed Germination. Plant Physiol. 2016, 170, 2340–2350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kamran, M.; Xie, K.; Sun, J.; Wang, D.; Shi, C.; Lu, Y.; Gu, W.; Xu, P. Modulation of growth performance and coordinated induction of ascorbate-glutathione and methylglyoxal detoxification systems by salicylic acid mitigates salt toxicity in choysum (Brassica parachinensis L.). Ecotoxicol. Environ. Saf. 2020, 188, 109877. [Google Scholar] [CrossRef]
- Ma, X.; Zheng, J.; Zhang, X.; Hu, Q.; Qian, R. Salicylic acid alleviates the adverse effects of salt stress on Dianthus superbus (caryophyllaceae) by activating photosynthesis, protecting morphological structure, and enhancing the antioxidant system. Front. Plant Sci. 2017, 8, 600. [Google Scholar] [CrossRef] [PubMed]
- Hafez, E.M. Influence of salicylic acid on ion distribution, enzymatic activity and some agromorphological characteristics of wheat under salt-affected soil. Egypt. J. Agron. 2016, 38, 455–469. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.; Kim, S.G.; Park, C.M. Salicylic acid promotes seed germination under high salinity by modulating antioxidant activity in Arabidopsis. New Phytol. 2010, 188, 626–637. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Guo, Y. Elucidating the molecular mechanisms mediating plant salt-stress responses. New Phytol. 2018, 217, 523–539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lekklar, C.; Chadchawan, S.; Boon-Long, P.; Pfeiffer, W.; Chaidee, A. Salt stress in rice: Multivariate analysis separates four components of beneficial silicon action. Protoplasma 2019, 256, 331–347. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Liu, L.; Lu, B.; Ma, T.; Jiang, D.; Li, J.; Zhang, K.; Sun, H.; Zhang, Y.; Bai, Z.; et al. Exogenous melatonin promotes seed germination and osmotic regulation under salt stress in cotton (Gossypium hirsutum L.). PLoS ONE 2020, 15, e0228241. [Google Scholar] [CrossRef] [Green Version]
- Wang, R.; Jing, W.; Xiao, L.; Jin, Y.; Shen, L.; Zhang, W. The OsHKT1;1 transporter is involved in salt tolerance and regulated by an MYB-Type transcription factor. Plant Physiol. 2015, 168, 1076–1090. [Google Scholar] [CrossRef] [Green Version]
- Ren, Z.H.; Gao, J.P.; Li, L.G.; Cai, X.L.; Huang, W.; Chao, D.Y.; Zhu, M.Z.; Wang, Z.Y.; Luan, S.; Lin, H.X. A rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nat Genet. 2005, 37, 1141. [Google Scholar] [CrossRef]
- Cheng, Y.W.; Kong, X.W.; Wang, N.; Wang, T.T.; Chen, J.; Shi, Z.Q. Thymol confers tolerance to salt stress by activating anti-oxidative defense and modulating Na+ homeostasis in rice root. Ecotoxicol. Environ. Saf. 2020, 188, 109894. [Google Scholar] [CrossRef]
- Faried, H.N.; Ayyub, C.M.; Amjad, M.; Ahmed, R.; Wattoo, F.M.; Butt, M.; Bashir, M.; Shaheen, M.R.; Waqas, M.A. Salicylic acid confers salt tolerance in potato plants by improving water relations, gaseous exchange, antioxidant activities and osmoregulation. J. Sci. Food Agric. 2017, 6, 1868–1875. [Google Scholar] [CrossRef]
- Al-Whaibi, M.H.; Siddiqui, M.H.; Basalah, M.O. Salicylic acid and calcium-induced protection of wheat against salinity. Protoplasma 2012, 3, 769–778. [Google Scholar] [CrossRef] [PubMed]
- Shu, K.; Qi, Y.; Chen, F.; Meng, Y.; Luo, X.; Shuai, H.; Zhou, W.; Ding, J.; Du, J.; Liu, J.; et al. Salt stress represses soybean seed germination by negatively regulating GA biosynthesis while positively mediating ABA biosynthesis. Front. Plant Sci. 2007, 8, 1372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Q.; Yang, A.; Zhang, W. Higher endogenous bioactive gibberellins and α-amylase activity confer greater tolerance of rice seed germination to saline-alkaline stress. Environ. Exp. Bot. 2019, 162, 357–363. [Google Scholar] [CrossRef]
- Liu, J.; Li, L.; Yuan, F.; Chen, M. Exogenous salicylic acid improves the germination of Limonium bicolor seeds under salt stress. Plant Signal. Behav. 2019, 14, e1644595. [Google Scholar] [CrossRef]
- Silva, N.C.; de Souza, G.A.; Pimenta, T.M.; Brito, F.A.; Picoli, E.A.; Zsögön, A.; Ribeiro, D.M. Salt stress inhibits germination of Stylosanthes humilis seeds through abscisic acid accumulation and associated changes in ethylene production. Plant Physiol. Biochem. 2018, 130, 399–407. [Google Scholar] [CrossRef]
- Huang, Y.; Jiao, Y.; Xie, N.; Guo, Y.; Zhang, F.; Xiang, Z.; Wang, R.; Wang, F.; Gao, Q.; Tian, L.; et al. OsNCED5, a 9-cis-epoxycarotenoid dioxygenase gene, regulates salt and water stress tolerance and leaf senescence in rice. Plant Sci. 2019, 287, 110188. [Google Scholar] [CrossRef]
- Kong, X.; Luo, Z.; Zhang, Y.; Li, W.; Dong, H. Soaking in H2O2 regulates ABA biosynthesis and GA catabolism in germinating cotton seeds under salt stress. Acta Physiol. Plant. 2017, 39, 2. [Google Scholar] [CrossRef]
- Li, Q.; Yang, A. Comparative studies on seed germination of two rice genotypes with different tolerances to low temperature. Environ. Exp. Bot. 2020, 179, 104216. [Google Scholar] [CrossRef]
- Wang, Y.; Hou, Y.; Qiu, J.; Wang, H.; Wang, S.; Tang, L.; Tong, X.; Zhang, J. Abscisic acid promotes jasmonic acid biosynthesis via a ‘SAPK10-bZIP72-AOC’ pathway to synergistically inhibit seed germination in rice (Oryza sativa). New Phytol. 2020, 228, 1336–1353. [Google Scholar] [CrossRef]
- Liang, S.X.; Gao, N.; Li, X.; Xi, X. Toxic effects of antimony on the seed germination and seedlings accumulation in Raphanus sativus L. radish and Brassica napus L. Mol. Biol. Rep. 2018, 45, 2609–2614. [Google Scholar] [CrossRef]
- Wang, Y.; Stevanato, P.; Yu, L.; Zhao, H.; Sun, X.; Sun, F.; Li, J.; Geng, G. The physiological and metabolic changes in sugar beet seedlings under different levels of salt stress. J. Plant Res. 2017, 130, 1079–1093. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.B.; Li, X.H.; Xiao, J.H.; Wang, S.P. A convenient method for simultaneous quantification of multiple phytohormones and metabolites: Application in study of rice-bacterium interaction. Plant Methods 2012, 8, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, M.L.; Fu, X.M.; Liu, J.Q.; Ye, T.T.; Hou, S.Y.; Huang, Y.Q.; Yuan, B.-F.; Wu, Y.; Feng, Y.-Q. Highly sensitive and quantitative profiling of acidic phytohormones using derivatization approach coupled with nano-LC-ESI-Q-TOF-MS analysis. J. Chromatogr. B 2012, 905, 67–74. [Google Scholar] [CrossRef]
- Wang, Y.; Cui, Y.; Hu, G.; Wang, X.; Chen, H.; Shi, Q.; Xiang, J.; Zhang, Y.; Zhu, D.; Zhang, Y. Reduced bioactive gibberellin content in rice seeds under low temperature leads to decreased sugar consumption and low seed germination rates. Plant Physiol. Biochem. 2018, 133, 1–10. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession Numbers | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|---|
OsActin | LOC4333919 | GACTCTGGTGATGGTGTCAGC | GGCTGGAAGAGGACCTCAGG |
OsGA20ox1 | LOC4334841 | CCACTACTTCCGGCGATTCTTCCAGCG | GACGTGGTCCTGGTGGAGGATGGTG |
OsGA3ox2 | LOC4337968 | GGAGAGCAAGGCCGTGTATCAGG | CTCTCCTTGTCCTCTTCCTTCGCTAC |
OsGA2ox1 | LOC4337874 | TGACGATGATGACAGCGACAA | CCATAGGCATCGTCTGCAATT |
OsGA2ox3 | LOC4325145 | TGGTGGCCAACAGCCTAAAG | TGGTGCAATCCTCTGTGCTAAC |
OsNCED1 | LOC4330451 | CTGGAGCACATGGAGCTAGTGCACTCC | CCGACGCCGAAGTAGCCGTACCTG |
OsNCED3 | LOC4333566 | CCCCTCCCAAACCATCCAAACCGA | TGTGAGCATATCCTGGCGTCGTGA |
OsNCED5 | LOC9270250 | TCATTCCAAAACACCTTCCA | TCCGGGGACCTCCTATGTAT |
OsABA8′OH1 | LOC9269675 | AAGTACAGGTGGTCCACGTCCAA | CCAGCTTAGCTGATGCTAGTATTC |
OsABA8′OH2 | LOC4345810 | GACGAGGTGGAGTACAGCCCGTTC | GGACACATCAGCCACCATCAGCAGTAG |
OsABA8′OH3 | LOC4347261 | CAGTGTGGAAACAGATGGTTGC | CGGACTTCCCTTGAGGAAATAGA |
OsHKT1;1 | LOC9266695 | TTCACCACTCTTGCGGCTATG | TGTTTGTAGCCAGTCTCCCCAG |
OsHKT1;5 | LOC4327757 | CCACCTTTTCCTTTTCCATGC | GGTCTTCATCGGCAGAGCTTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Z.; Ma, C.; Hou, L.; Wu, X.; Wang, D.; Zhang, L.; Liu, P. Exogenous SA Affects Rice Seed Germination under Salt Stress by Regulating Na+/K+ Balance and Endogenous GAs and ABA Homeostasis. Int. J. Mol. Sci. 2022, 23, 3293. https://doi.org/10.3390/ijms23063293
Liu Z, Ma C, Hou L, Wu X, Wang D, Zhang L, Liu P. Exogenous SA Affects Rice Seed Germination under Salt Stress by Regulating Na+/K+ Balance and Endogenous GAs and ABA Homeostasis. International Journal of Molecular Sciences. 2022; 23(6):3293. https://doi.org/10.3390/ijms23063293
Chicago/Turabian StyleLiu, Zhiguo, Chunyang Ma, Lei Hou, Xiuzhe Wu, Dan Wang, Li Zhang, and Peng Liu. 2022. "Exogenous SA Affects Rice Seed Germination under Salt Stress by Regulating Na+/K+ Balance and Endogenous GAs and ABA Homeostasis" International Journal of Molecular Sciences 23, no. 6: 3293. https://doi.org/10.3390/ijms23063293
APA StyleLiu, Z., Ma, C., Hou, L., Wu, X., Wang, D., Zhang, L., & Liu, P. (2022). Exogenous SA Affects Rice Seed Germination under Salt Stress by Regulating Na+/K+ Balance and Endogenous GAs and ABA Homeostasis. International Journal of Molecular Sciences, 23(6), 3293. https://doi.org/10.3390/ijms23063293