Targeted Delivery of Immunostimulatory CpG Oligodeoxynucleotides to Antigen-Presenting Cells in Draining Lymph Nodes by Stearic Acid Modification and Nanostructurization
Abstract
:1. Introduction
2. Results
2.1. Synthesis of SA-CpG1668
2.2. Binding to Bovine Serum Albumin (BSA)
2.3. Formation of SA-CpG1668/Tripodna
2.4. Binding to Plasma Components
2.5. Thermal Stability under Simulated Extracellular and Endosomal Conditions
2.6. Uptake by RAW264.7 Cells
2.7. Production of the Tumor Necrosis Factor (TNF)-α after Addition to RAW264.7 Cells
2.8. IL-12p40 Production in Inguinal Lymph Nodes
2.9. IL-6 Production in Plasma
2.10. Accumulation of PI-Labeled CpG1668/Tripodna and SA-CpG1668/Tripodna in Lymph Nodes
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. ODNs
4.3. Cells
4.4. Animals
4.5. Synthesis of SA-NHS
4.6. Synthesis of SA-CpG1668
4.7. Protein-Binding Assay
4.8. Preparation of Tripodna
4.9. PAGE
4.10. Measurement of Tm
4.11. Cellular Uptake
4.12. Release of TNF-α from RAW264.7 Cells
4.13. IL-12p40 Production in Inguinal Lymph Nodes of Mice after Subcutaneous Injection
4.14. IL-6 Production in Plasma of Mice after Subcutaneous Injection
4.15. Accumulation of PI-Labeled CpG1668/Tripodna and SA-CpG1668/Tripodna in Lymph Nodes after Subcutaneous Injection
4.16. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Krieg, A.M. Therapeutic potential of Toll-like receptor 9 activation. Nat. Rev. Drug Discov. 2016, 5, 471–484. [Google Scholar] [CrossRef] [PubMed]
- Krieg, A.M.; Yi, A.K.; Matson, S.; Waldschmidt, T.J.; Bishop, G.A.; Teasdale, R.; Koretzky, G.A.; Klinman, D.M. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 1995, 374, 546–549. [Google Scholar] [CrossRef] [PubMed]
- Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef] [PubMed]
- Murad, Y.M.; Clay, T.M. CpG oligodeoxynucleotides as TLR9 agonists: Therapeutic applications in cancer. BioDrugs 2009, 23, 361–375. [Google Scholar] [CrossRef]
- Shirota, H.; Klinman, D.M. Recent progress concerning CpG DNA and its use as a vaccine adjuvant. Expert Rev. Vaccines 2014, 13, 299–312. [Google Scholar] [CrossRef]
- Gupta, G.K.; Agrawal, D.K. CpG Oligodeoxynucleotides as TLR9 Agonists: Therapeutic Application in Allergy and Asthma. BioDrugs 2010, 24, 225–235. [Google Scholar] [CrossRef]
- Campbell, J.D. Development of the CpG adjuvant 1018: A case study. Methods Mol. Biol. 2017, 1494, 15–27. [Google Scholar] [PubMed]
- Hyer, R.; McGuire, D.K.; Xing, B.; Jackson, S.; Janssen, R. Safety of a two-dose investigational hepatitis B vaccine, HBsAg-1018, using a toll-like receptor 9 agonist adjuvant in adults. Vaccine 2018, 36, 2604–2611. [Google Scholar] [CrossRef]
- Scheiermann, J.; Klinman, D.M. Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer. Vaccine 2014, 32, 6377–6389. [Google Scholar] [CrossRef] [Green Version]
- Trevaskis, N.L.; Kaminskas, L.M.; Porter, C.J. From sewer to savior—Targeting the lymphatic system to promote drug exposure and activity. Nat. Rev. Drug Discov. 2015, 14, 781–803. [Google Scholar] [CrossRef]
- Qian, Y.; Jin, H.; Qiao, S.; Dai, Y.; Huang, C.; Lu, L.; Luo, Q.; Zhang, Z. Targeting dendritic cells in lymph node with an antigen peptide-based nanovaccine for cancer immunotherapy. Biomaterials 2016, 98, 171–183. [Google Scholar] [CrossRef]
- Jong, W.H.; Borm, P.J. Drug delivery and nanoparticles: Applications and hazards. Int. J. Nanomed. 2008, 3, 133–149. [Google Scholar] [CrossRef] [Green Version]
- Schudel, A.; Francis, D.M.; Thomas, S.N. Material design for lymph node drug delivery. Nat. Rev. Mater. 2019, 4, 415–428. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Moynihan, K.D.; Zheng, Y.; Szeto, G.L.; Li, A.V.; Huang, B.; Van Egeren, D.S.; Park, C.; Inrvine, D.J. Structure-based programming of lymph-node targeting in molecular vaccines. Nature 2014, 507, 519–522. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, C.; An, M.; Li, M.; Liu, H. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides. Mol. Pharm. 2017, 14, 2815–2823. [Google Scholar] [CrossRef] [PubMed]
- Appelbe, O.K.; Moynihan, K.D.; Flor, A.; Rymut, N.; Irvine, D.J.; Kron, S.J. Radiation-enhanced delivery of systemically administered amphiphilic-CpG oligodeoxynucleotide. J. Control. Release 2017, 266, 248–255. [Google Scholar] [CrossRef]
- Mohri, K.; Nishikawa, M.; Takahashi, N.; Shiomi, T.; Matsuoka, N.; Ogawa, K.; Endo, M.; Hidaka, K.; Sugiyama, H.; Takahashi, Y.; et al. Design and development of nanosized DNA assemblies in polypod-like structures as efficient vehicles for immunostimulatory CpG motifs to immune cells. ACS Nano 2012, 6, 5931–5940. [Google Scholar] [CrossRef]
- Uno, S.; Nishikawa, M.; Mohri, K.; Umeki, Y.; Matsuzaki, N.; Takahashi, Y.; Fujita, H.; Kadowaki, N.; Takakura, Y. Efficient delivery of immunostimulatory DNA to mouse and human immune cells through the construction of polypod-like structured DNA. Nanomedicine 2014, 10, 765–774. [Google Scholar] [CrossRef] [Green Version]
- Nishikawa, M.; Ogawa, K.; Umeki, Y.; Mohri, K.; Kawasaki, Y.; Watanabe, H.; Takahashi, N.; Kusuki, E.; Takahashi, R.; Takahashi, Y.; et al. Injectable, self-gelling, biodegradable, and immunomodulatory DNA hydrogel for antigen delivery. J. Control. Release 2014, 180, 25–32. [Google Scholar] [CrossRef] [Green Version]
- Mohri, K.; Kusuki, E.; Ohtsuki, S.; Takahashi, N.; Endo, M.; Hidaka, K.; Sugiyama, H.; Takahashi, Y.; Takakura, Y.; Nishikawa, M. Self-assembling DNA dendrimer for effective delivery of immunostimulatory CpG DNA to immune cells. Biomacromolecules 2015, 16, 1095–1101. [Google Scholar] [CrossRef]
- Ohtsuki, S.; Takahashi, Y.; Inoue, T.; Takakura, Y.; Nishikawa, M. Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene. Sci. Rep. 2017, 7, 13661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Umemura, K.; Ohtsuki, S.; Nagaoka, M.; Kusamori, K.; Inoue, T.; Takahashi, Y.; Takakura, Y.; Nishikawa, M. Critical contribution of macrophage scavenger receptor 1 to the uptake of nanostructured DNA by immune cells. Nanomedicine 2021, 34, 102386. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, Y.; Maezawa, T.; Araie, Y.; Takahashi, Y.; Takakura, Y.; Nishikawa, M. In vitro and in vivo stimulation of toll-like receptor 9 by CpG oligodeoxynucleotides incorporated into polypod-like DNA nanostructures. J. Pharm. Sci. 2017, 106, 2457–2462. [Google Scholar] [CrossRef] [Green Version]
- Ly, S.; Echeverria, D.; Sousa, J.; Khvorova, A. Single-Stranded Phosphorothioated Regions Enhance Cellular Uptake of Cholesterol-Conjugated siRNA but Not Silencing Efficacy. Mol. Ther. Nucleic Acids 2020, 21, 991–1005. [Google Scholar] [CrossRef]
- Wada, S.; Yasuhara, H.; Wada, F.; Sawamura, M.; Waki, R.; Yamamoto, T.; Harada-Shiba, M.; Obika, S. Evaluation of the effects of chemically different linkers on hepatic accumulations, cell tropism and gene silencing ability of cholesterol-conjugated antisense oligonucleotides. J. Control. Release 2016, 226, 57–65. [Google Scholar] [CrossRef] [PubMed]
- Jin, C.; Liu, X.; Bai, H.; Wang, R.; Tan, J.; Peng, X.; Tan, W. Engineering Stability-Tunable DNA Micelles Using Photocontrollable Dissociation of an Intermolecular G-Quadruplex. ACS Nano 2017, 11, 12087–12093. [Google Scholar] [CrossRef] [PubMed]
- Cozzoli, L.; Gjonaj, L.; Stuart, M.C.; Poolman, B.; Roelfes, G. Responsive DNA G-quadruplex micelles. Chem. Commun. 2018, 54, 260–263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brown, D.A.; Kang, S.; Gryaznod, S.M.; DeDionision, L.; Heidenreich, O.; Sullivanll, S.; Xu, X.; Nerenberg, M.I. Effect of phosphorothioate modification of oligodeoxynucleotides on specific protein binding. J. Biol. Chem. 1994, 269, 26801–26805. [Google Scholar] [CrossRef]
- Curry, S.; Brick, P.; Franks, N.P. Fatty acid binding to human serum albumin: New insights from crystallographic studies. Biochim. Biophys. Acta 1999, 1441, 131–140. [Google Scholar] [CrossRef]
- Felber, A.E.; Bayó-Puxan, N.; Deleavey, G.F.; Castagner, B.; Damha, M.J.; Leroux, J. The interactions of amphiphilic antisense oligonucleotides with serum proteins and their effects on in vitro silencing activity. Biomaterials 2012, 33, 5955–5965. [Google Scholar] [CrossRef]
- Hvam, M.L.; Cai, Y.; Dagnæs-Hansen, F.; Nielsen, J.S.; Wengel, J.; Kjems, J.; Howard, K.A. Fatty Acid-Modified Gapmer Antisense Oligonucleotide and Serum Albumin Constructs for Pharmacokinetic Modulation. Mol. Ther. 2017, 25, 1710–1717. [Google Scholar] [CrossRef] [Green Version]
- Zaias, J.; Mineau, M.; Cray, C.; Yoon, D.; Altman, N.H. Reference values for serum proteins of common laboratory rodent strains. J. Am. Assoc. Lab. Anim. Sci. 2009, 48, 387–390. [Google Scholar] [PubMed]
- Sanada, Y.; Shiomi, T.; Okobira, T.; Tan, M.; Nishikawa, M.; Akiba, I.; Takakura, Y.; Sakurai, K. Polypod-shaped DNAs: Small-angle X-ray scattering and immunostimulatory activity. Langmuir 2016, 32, 3760–3765. [Google Scholar] [CrossRef] [PubMed]
- Meka, R.R.; Mukherjee, S.; Patra, C.R.; Chaudhuri, A. Shikimoyl-ligand decorated gold nanoparticles for use in ex vivo engineered dendritic cell based DNA vaccination. Nanoscale 2019, 11, 7931–7943. [Google Scholar] [CrossRef] [PubMed]
- Ohto, U.; Ishida, H.; Shibata, T.; Sato, R.; Miyake, K.; Shimizu, T. Toll-like receptor 9 contains two DNA binding sites that function cooperatively to promote receptor dimerization and activation. Immunity 2018, 48, 649–658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rutz, M.; Metzger, J.; Gellert, T.; Luppa, P.; Lipford, G.B.; Wagner, H.; Bauer, S. Toll-like receptor 9 binds single-stranded CpG-DNA in a sequence- and pH-dependent manner. Eur. J. Immunol. 2004, 34, 2541–2550. [Google Scholar] [CrossRef] [PubMed]
- Ohto, U.; Shibata, T.; Tanji, H.; Ishida, H.; Krayukhina, E.; Uchiyama, S.; Miyake, K.; Shimizu, T. Structural basis of CpG and inhibitory DNA recognition by Toll-like receptor 9. Nature 2015, 520, 702–705. [Google Scholar] [CrossRef]
- Scott, C.C.; Gruenberg, J. Ion flux and the function of endosomes and lysosomes: pH is just the start: The flux of ions across endosomal membranes influences endosome function not only through regulation of the luminal pH. Bioessays 2011, 33, 103–110. [Google Scholar] [CrossRef]
ODN | Sequence (5′ to 3′) |
---|---|
CpG1668 | TCCATGACGTTCCTGATGCT |
SA-CpG1668 | Stearoyl-TCCATGACGTTCCTGATGCT |
Tri-1 | GCTTGAATCCATGAGCTTGTATGACTGCAAGCAGCATCAGGAACTTCATGGA |
Tri-2 | GCTTGCAGTCATACAATCCTGAGCCTCTGAGCAGCATCAGGAACTTCATGGA |
Tri-3 | GCTCAGAGGCTCAGGAGCTCATGGATTCAAGCAGCATCAGGAACTTCATGGA |
Sample | Tm (°C) | |
---|---|---|
pH 7.4 | pH 5.5 | |
CpG1668/tri-1 | 52.2 | 49.8 |
SA-CpG1668/tri-1 | 61.0 | 58.8 |
Tripodna | 65.6 | 59.3 |
CpG1668/tripodna | 59.8 | 56.0 |
SA-CpG1668/tripodna | 63.5 | 60.2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nagaoka, M.; Liao, W.; Kusamori, K.; Nishikawa, M. Targeted Delivery of Immunostimulatory CpG Oligodeoxynucleotides to Antigen-Presenting Cells in Draining Lymph Nodes by Stearic Acid Modification and Nanostructurization. Int. J. Mol. Sci. 2022, 23, 1350. https://doi.org/10.3390/ijms23031350
Nagaoka M, Liao W, Kusamori K, Nishikawa M. Targeted Delivery of Immunostimulatory CpG Oligodeoxynucleotides to Antigen-Presenting Cells in Draining Lymph Nodes by Stearic Acid Modification and Nanostructurization. International Journal of Molecular Sciences. 2022; 23(3):1350. https://doi.org/10.3390/ijms23031350
Chicago/Turabian StyleNagaoka, Makoto, Wenqing Liao, Kosuke Kusamori, and Makiya Nishikawa. 2022. "Targeted Delivery of Immunostimulatory CpG Oligodeoxynucleotides to Antigen-Presenting Cells in Draining Lymph Nodes by Stearic Acid Modification and Nanostructurization" International Journal of Molecular Sciences 23, no. 3: 1350. https://doi.org/10.3390/ijms23031350
APA StyleNagaoka, M., Liao, W., Kusamori, K., & Nishikawa, M. (2022). Targeted Delivery of Immunostimulatory CpG Oligodeoxynucleotides to Antigen-Presenting Cells in Draining Lymph Nodes by Stearic Acid Modification and Nanostructurization. International Journal of Molecular Sciences, 23(3), 1350. https://doi.org/10.3390/ijms23031350