Intravesicular Genomic DNA Enriched by Size Exclusion Chromatography Can Enhance Lung Cancer Oncogene Mutation Detection Sensitivity
Abstract
:1. Introduction
2. Results
2.1. Characterization of sEVs
2.2. sEV Encapsulated RNA and DNA
2.3. Genomic sEV-DNA Provides a Major Template for Mutation Detection
2.4. Mutation Enrichment by sEV Separation and Co-Isolated ctDNA
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Preparation of Conditioned Cell Media and Blank Controls
4.3. Preparation of sEV Spiked Platelet-Poor Plasma
4.4. Size Exclusion Chromatography
4.5. Exoeasy Membrane Affinity Chromatography
4.6. Ultracentrifugation
4.7. Characterization of sEV Separations
4.8. RNA/DNA Extraction
4.9. Small EV-RNA/DNA Yield and Purity Assessment
4.10. Mutation Detection
4.11. Confirmation of Genomic DNA Present in sEVs
4.12. EV-TRACK, ExoCarta and Vesiclepedia
4.13. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Théry, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G.K.; et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 2018, 7, 1535750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hannafon, B.N.; Ding, W.Q. Intercellular communication by exosome-derived microRNAs in cancer. Int. J. Mol. Sci. 2013, 14, 14240–14269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boukouris, S.; Mathivanan, S. Exosomes in bodily fluids are a highly stable resource of disease biomarkers. Proteom. Clin. Appl. 2015, 9, 358–367. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, T.H.; Chennakrishnaiah, S.; Audemard, E.; Montermini, L.; Meehan, B.; Rak, J. Oncogenic ras-driven cancer cell vesiculation leads to emission of double-stranded DNA capable of interacting with target cells. Biochem. Biophys. Res. Commun. 2014, 451, 295–301. [Google Scholar] [CrossRef] [Green Version]
- Turchinovich, A.; Drapkina, O.; Tonevitsky, A. Transcriptome of extracellular vesicles: State-of-the-art. Front. Immunol. 2019, 10, 202. [Google Scholar] [CrossRef] [Green Version]
- Skog, J.; Würdinger, T.; Van Rijn, S.; Meijer, D.H.; Gainche, L.; Curry, W.T., Jr.; Carter, B.S.; Krichevsky, A.M.; Breakefield, X.O. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat. Cell Biol. 2008, 10, 1470–1476. [Google Scholar] [CrossRef]
- Valadi, H.; Ekström, K.; Bossios, A.; Sjöstrand, M.; Lee, J.J.; Lötvall, J.O. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 2007, 9, 654–659. [Google Scholar] [CrossRef] [Green Version]
- Kahlert, C.; Melo, S.; Protopopov, A.; Tang, J.; Seth, S.; Koch, M.; Zhang, J.; Weitz, J.; Chin, L.; Futreal, A.; et al. Identification of double-stranded genomic DNA spanning all chromosomes with mutated KRAS and p53 DNA in the serum exosomes of patients with pancreatic cancer. J. Biol. Chem. 2014, 289, 3869–3875. [Google Scholar] [CrossRef] [Green Version]
- Thakur, B.K.; Zhang, H.; Becker, A.; Matei, I.; Huang, Y.; Costa-Silva, B.; Zheng, Y.; Hoshino, A.; Brazier, H.; Xiang, J.; et al. Double-stranded DNA in exosomes: A novel biomarker in cancer detection. Cell Res. 2014, 24, 766–769. [Google Scholar] [CrossRef] [Green Version]
- Lázaro-Ibáñez, E.; Lässer, C.; Shelke, G.V.; Crescitelli, R.; Jang, S.C.; Cvjetkovic, A.; García-Rodríguez, A.; Lötvall, J. DNA analysis of low- and high-density fractions defines heterogeneous subpopulations of small extracellular vesicles based on their DNA cargo and topology. J. Extracell. Vesicles 2019, 8, 1656993. [Google Scholar] [CrossRef]
- Krug, A.K.; Enderle, D.; Karlovich, C.; Priewasser, T.; Bentink, S.; Spiel, A.; Brinkmann, K.; Emenegger, J.; Grimm, D.; Castellanos-Rizaldos, E.; et al. Improved EGFR mutation detection using combined exosomal RNA and circulating tumor DNA in NSCLC patient plasma. Ann. Oncol. 2018, 29, 700–706. [Google Scholar] [CrossRef] [Green Version]
- Castellanos-Rizaldos, E.; Grimm, D.G.; Tadigotla, V.; Hurley, J.; Healy, J.; Neal, P.L.; Sher, M.; Venkatesan, R.; Karlovich, C.; Raponi, M.; et al. Exosome-based detection of EGFR T790M in plasma from non-small cell lung cancer patients. Clin. Cancer Res. 2018, 24, 2944–2950. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wan, Y.; Liu, B.; Lei, H.; Zhang, B.; Huang, H.; Chen, S.; Feng, Y.; Zhu, L.; Gu, Y.; Zhang, Q.; et al. Nanoscale extracellular vesicle-derived DNA is superior to circulating cell-free DNA for mutation detection in early-stage non-small-cell lung cancer. Ann. Oncol. 2018, 29, 2379–2383. [Google Scholar] [CrossRef]
- Hur, J.Y.; Kim, H.J.; Lee, J.S.; Choi, C.-M.; Lee, J.C.; Jung, M.K.; Pack, C.G.; Lee, K.Y. Extracellular vesicle-derived DNA for performing EGFR genotyping of NSCLC patients. Mol. Cancer 2018, 17, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- EV-TRACK Consortium; Van Deun, J.; Mestdagh, P.; Agostinis, P.; Akay, Ö.; Anand, S.; Anckaert, J.; Martinez, Z.A.; Baetens, T.; Beghein, E.; et al. EV-TRACK: Transparent reporting and centralizing knowledge in extracellular vesicle research. Nat. Methods 2017, 14, 228–232. [Google Scholar] [PubMed]
- Konoshenko, M.Y.; Lekchnov, E.A.; Vlassov, A.V.; Laktionov, P.P. Isolation of extracellular vesicles: General methodologies and latest trends. BioMed Res. Int. 2018, 2018, 8545347. [Google Scholar] [CrossRef] [Green Version]
- Takov, K.; Yellon, D.M.; Davidson, S.M. Comparison of small extracellular vesicles isolated from plasma by ultracentrifugation or size-exclusion chromatography: Yield, purity and functional potential. J. Extracell. Vesicles 2019, 8, 1560809. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.-T.; Huang, Y.-Y.; Zheng, L.; Qin, S.-H.; Xu, X.-P.; An, T.-X.; Xu, Y.; Wu, Y.-S.; Hu, X.-M.; Ping, B.-H.; et al. Comparison of isolation methods of exosomes and exosomal RNA from cell culture medium and serum. Int. J. Mol. Med. 2017, 40, 834–844. [Google Scholar] [CrossRef] [Green Version]
- Van Deun, J.; Mestdagh, P.; Sormunen, R.; Cocquyt, V.; Vermaelen, K.; Vandesompele, J.; Bracke, M.; De Wever, O.; Hendrix, A. The impact of disparate isolation methods for extracellular vesicles on downstream RNA profiling. J. Extracell. Vesicles 2014, 3, 24858. [Google Scholar] [CrossRef] [Green Version]
- Ferguson, S.; Yang, K.S.; Weissleder, R. Single extracellular vesicle analysis for early cancer detection. Trends Mol. Med. 2022, 28, 681–692. [Google Scholar] [CrossRef]
- Jamaly, S.; Ramberg, C.; Olsen, R.; Latysheva, N.; Webster, P.; Sovershaev, T.; Brækkan, S.K.; Hansen, J.-B. Impact of preanalytical conditions on plasma concentration and size distribution of extracellular vesicles using Nanoparticle Tracking Analysis. Sci. Rep. 2018, 8, 17216. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hackner, K.; Buder, A.; Hochmair, M.J.; Strieder, M.; Grech, C.; Fabikan, H.; Burghuber, O.C.; Errhalt, P.; Filipits, M. Detection of EGFR Activating and Resistance Mutations by Droplet Digital PCR in Sputum of EGFR-Mutated NSCLC Patients. Clin. Med. Insights Oncol. 2021, 15, 1179554921993072. [Google Scholar] [CrossRef] [PubMed]
- Sanders, R.; Mason, D.J.; Foy, C.A.; Huggett, J.F. Evaluation of digital PCR for absolute RNA quantification. PLoS ONE 2013, 8, e75296. [Google Scholar] [CrossRef] [PubMed]
- Ramos, K.S.; Moore, S.; Runge, I.; Tavera-Garcia, M.A.; Cascone, I.; Courty, J.; Reyes-Reyes, E. The nucleolin antagonist N6L inhibits LINE1 retrotransposon activity in non-small cell lung carcinoma cells. J. Cancer 2020, 11, 733–740. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, M.; Zeringer, E.; Barta, T.; Schageman, J.; Cheng, A.; Vlassov, A.V. Analysis of the RNA content of the exosomes derived from blood serum and urine and its potential as biomarkers. Philos. Trans. R. Soc. B Biol. Sci. 2014, 369, 20130502. [Google Scholar] [CrossRef] [PubMed]
- Bæk, R.; Søndergaard, E.K.; Varming, K.; Jørgensen, M.M. The impact of various preanalytical treatments on the phenotype of small extracellular vesicles in blood analyzed by protein microarray. J. Immunol. Methods 2016, 438, 11–20. [Google Scholar] [CrossRef] [Green Version]
- Deville, S.; Berckmans, P.; Van Hoof, R.; Lambrichts, I.; Salvati, A.; Nelissen, I. Comparison of extracellular vesicle isolation and storage methods using high-sensitivity flow cytometry. PLoS ONE 2021, 16, e0245835. [Google Scholar] [CrossRef]
- Mateescu, B.; Kowal, E.J.K.; Van Balkom, B.W.M.; Bartel, S.; Bhattacharyya, S.N.; Buzás, E.I.; Buck, A.H.; de Candia, P.; Chow, F.W.N.; Das, S.; et al. Obstacles and opportunities in the functional analysis of extracellular vesicle RNA—An ISEV position paper. J. Extracell. Vesicles 2017, 6, 1286095. [Google Scholar] [CrossRef] [Green Version]
- Enderle, D.; Spiel, A.; Coticchia, C.M.; Berghoff, E.; Mueller, R.; Schlumpberger, M.; Sprenger-Haussels, M.; Shaffer, J.M.; Lader, E.; Skog, J.; et al. Characterization of RNA from exosomes and other extracellular vesicles isolated by a novel spin column-based method. PLoS ONE 2015, 10, e0136133. [Google Scholar] [CrossRef] [Green Version]
- Kawamura, Y.; Yamamoto, Y.; Sato, T.A.; Ochiya, T. Extracellular vesicles as trans-genomic agents: Emerging roles in disease and evolution. Cancer Sci. 2017, 108, 824–830. [Google Scholar] [CrossRef]
- Lässer, C.; Shelke, G.V.; Yeri, A.; Kim, D.-K.; Crescitelli, R.; Raimondo, S.; Sjöstrand, M.; Gho, Y.S.; Van Keuren Jensen, K.; Lötvall, J. Two distinct extracellular RNA signatures released by a single cell type identified by microarray and next-generation sequencing. RNA Biol. 2017, 14, 58–72. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Boza, J.; Lion, M.; Struman, I. Exploring the RNA landscape of endothelial exosomes. RNA 2018, 24, 423–435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, L.; Sun, X.; Scicluna, B.J.; Coleman, B.M.; Hill, A.F. Characterization and deep sequencing analysis of exosomal and non-exosomal miRNA in human urine. Kidney Int. 2014, 86, 433–444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buschmann, D.; Kirchner, B.; Hermann, S.; Märte, M.; Wurmser, C.; Brandes, F.; Kotschote, S.; Bonin, M.; Steinlein, O.K.; Pfaffl, M.W.; et al. Evaluation of serum extracellular vesicle isolation methods for profiling miRNAs by next-generation sequencing. J. Extracell. Vesicles 2018, 7, 1481321. [Google Scholar] [CrossRef]
- Cai, J.; Han, Y.; Ren, H.; Chen, C.; He, D.; Zhou, L.; Eisner, G.M.; Asico, L.D.; Jose, P.A.; Zeng, C. Extracellular vesicle-mediated transfer of donor genomic DNA to recipient cells is a novel mechanism for genetic influence between cells. J. Mol. Cell Biol. 2013, 5, 227–238. [Google Scholar] [CrossRef] [Green Version]
- Zocco, D.; Bernardi, S.; Novelli, M.; Astrua, C.; Fava, P.; Zarovni, N.; Carpi, F.M.; Bianciardi, L.; Malavenda, O.; Quaglino, P.; et al. Isolation of extracellular vesicles improves the detection of mutant DNA from plasma of metastatic melanoma patients. Sci. Rep. 2020, 10, 15745. [Google Scholar] [CrossRef]
- Tóth, E.; Turiák, L.; Visnovitz, T.; Cserép, C.; Mázló, A.; Sódar, B.W.; Försönits, A.I.; Petővári, G.; Sebestyén, A.; Komlósi, Z.; et al. Formation of a protein corona on the surface of extracellular vesicles in blood plasma. J. Extracell. Vesicles 2021, 10, e12140. [Google Scholar] [CrossRef]
- Ghanam, J.; Chetty, V.K.; Barthel, L.; Reinhardt, D.; Hoyer, P.-F.; Thakur, B.K. DNA in extracellular vesicles: From evolution to its current application in health and disease. Cell Biosci. 2022, 12, 37. [Google Scholar] [CrossRef]
- Lai, J.; Du, B.; Wang, Y.; Wu, R.; Yu, Z. Next-generation sequencing of circulating tumor DNA for detection of gene mutations in lung cancer: Implications for precision treatment. OncoTargets Ther. 2018, 11, 9111–9116. [Google Scholar] [CrossRef] [Green Version]
- Chen, M.; Zhao, H. Next-generation sequencing in liquid biopsy: Cancer screening and early detection. Hum. Genom. 2019, 13, 34. [Google Scholar] [CrossRef]
- Lacroix, R.; Judicone, C.; Poncelet, P.; Robert, S.; Arnaud, L.; Sampol, J.; Dignat-George, F. Impact of pre-analytical parameters on the measurement of circulating microparticles: Towards standardization of protocol. J. Thromb. Haemost. 2012, 10, 437–446. [Google Scholar] [CrossRef] [PubMed]
- van der Vlist, E.J.; Nolte-’t Hoen, E.N.; Stoorvogel, W.; Arkesteijn, G.J.; Wauben, M.H. Fluorescent labeling of nano-sized vesicles released by cells and subsequent quantitative and qualitative analysis by high-resolution flow cytometry. Nat. Protoc. 2012, 7, 1311–1326. [Google Scholar] [CrossRef] [PubMed]
- Keerthikumar, S.; Chisanga, D.; Ariyaratne, D.; Al Saffar, H.; Anand, S.; Zhao, K.; Samuel, M.; Pathan, M.; Jois, M.; Chilamkurti, N.; et al. ExoCarta: A web-based compendium of exosomal cargo. J. Mol. Biol. 2016, 428, 688–692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pathan, M.; Fonseka, P.; Chitti, S.V.; Kang, T.; Sanwlani, R.; Van Deun, J.; Hendrix, A.; Mathivanan, S. Vesiclepedia 2019: A compendium of RNA, proteins, lipids and metabolites in extracellular vesicles. Nucleic Acids Res. 2019, 47, 516–519. [Google Scholar] [CrossRef]
Primer Pair | Sequence 5′ → 3′ | Amplicon Length (bp) | |
---|---|---|---|
Exon–exon | FWD: | ATCTGCCTCACCTCCAC | 80 |
REV: | TTGTGTTCCCGGACATAGTC | ||
Exon–exon junction | FWD: | CAATATTGGCTCCCAGTACCTG | 75 |
REV: | CGACGGTCCTCCAAGTAGTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Van Hoof, R.; Deville, S.; Hollanders, K.; Berckmans, P.; Wagner, P.; Hooyberghs, J.; Nelissen, I. Intravesicular Genomic DNA Enriched by Size Exclusion Chromatography Can Enhance Lung Cancer Oncogene Mutation Detection Sensitivity. Int. J. Mol. Sci. 2022, 23, 16052. https://doi.org/10.3390/ijms232416052
Van Hoof R, Deville S, Hollanders K, Berckmans P, Wagner P, Hooyberghs J, Nelissen I. Intravesicular Genomic DNA Enriched by Size Exclusion Chromatography Can Enhance Lung Cancer Oncogene Mutation Detection Sensitivity. International Journal of Molecular Sciences. 2022; 23(24):16052. https://doi.org/10.3390/ijms232416052
Chicago/Turabian StyleVan Hoof, Rebekka, Sarah Deville, Karen Hollanders, Pascale Berckmans, Patrick Wagner, Jef Hooyberghs, and Inge Nelissen. 2022. "Intravesicular Genomic DNA Enriched by Size Exclusion Chromatography Can Enhance Lung Cancer Oncogene Mutation Detection Sensitivity" International Journal of Molecular Sciences 23, no. 24: 16052. https://doi.org/10.3390/ijms232416052
APA StyleVan Hoof, R., Deville, S., Hollanders, K., Berckmans, P., Wagner, P., Hooyberghs, J., & Nelissen, I. (2022). Intravesicular Genomic DNA Enriched by Size Exclusion Chromatography Can Enhance Lung Cancer Oncogene Mutation Detection Sensitivity. International Journal of Molecular Sciences, 23(24), 16052. https://doi.org/10.3390/ijms232416052