Structural and Dynamic Features of Liver Mitochondria and Mitophagy in Rats with Hyperthyroidism
Abstract
1. Introduction
2. Results
2.1. Characterization of Animals with Experimentally Induced Hyperthyroidism
2.2. Functioning of Liver Mitochondria of Control and Hyperthyroid Rats
2.3. Ultrastructural Features of Liver Tissue in Control and Hyperthyroid Rats
2.4. Differences of Gene Expression in Liver Tissue of Control and Hyperthyroid Rats
2.5. Immunoblotting Analysis of Liver Proteins of Control and Hyperthyroid Rats
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Electron Microscopy
4.3. Quantification of Mitochondrial DNA
4.4. Quantification of mRNA Expression of Mitochondrial Dynamics, Mitochondrial Biogenesis and Mitophagy Genes Using the Quantitative Real-Time PCR
4.5. Isolation of Rat Liver Mitochondria and Determination of Respiration and Oxidative Phosphorylation
4.6. Glutathione Assay
4.7. Immunoblotting Analysis
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tilokani, L.; Nagashima, S.; Paupe, V.; Prudent, J. Mitochondrial dynamics: Overview of molecular mechanisms. Essays Biochem. 2018, 62, 341–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cioffi, F.; Giacco, A.; Goglia, F.; Silvestri, E. Bioenergetic Aspects of Mitochondrial Actions of Thyroid Hormones. Cells 2022, 11, 997. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Westermann, B. Bioenergetic role of mitochondrial fusion and fission. Biochim. Biophys. Acta 2012, 1817, 1833–1838. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ni, H.-M.; Williams, J.A.; Ding, W.-X. Mitochondrial dynamics and mitochondrial quality control. Redox Biol. 2015, 4, 6–13. [Google Scholar] [CrossRef] [Scilit]
- Ryter, S.W.; Divya, B.; Choi, M.E. Autophagy: A Lysosome-Dependent Process with Implications in Cellular Redox Homeostasis and Human Disease. Antioxid. Redox Signal. 2019, 30, 138–159. [Google Scholar] [CrossRef] [Scilit]
- Venediktova, N.I.; Mashchenko, O.V.; Talanov, E.Y.; Belosludtseva, N.V.; Mironova, G.D. Energy metabolism and oxidative status of rat liver mitochondria in conditions of experimentally induced hyperthyroidism. Mitochondrion 2020, 52, 190–196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dupont, N.; Orhon, I.; Bauvy, C.; Codogno, P. Autophagy and autophagic flux in tumor cells. Methods Enzymol. 2014, 543, 73–88. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez-Arribas, M.; Yakhine-Diop, S.M.S.; González-Polo, R.A.; Niso-Santano, M.; Fuentes, J.M. Turnover of Lipidated LC3 and Autophagic Cargoes in Mammalian Cells. Methods Enzymol. 2017, 587, 55–70. [Google Scholar] [CrossRef] [Scilit]
- Quintana-Cabrera, R.; Mehrotra, A.; Rigoni, G.; Soriano, M.E. Who and how in the regulation of mitochondrial cristae shape and function. Biochem. Biophys. Res. Commun. 2018, 500, 94–101. [Google Scholar] [CrossRef] [Scilit]
- Letts, J.A.; Sazanov, L.A. Clarifying the supercomplex: The higher-order organization of the mitochondrial electron transport chain. Nat. Struct. Mol. Biol. 2017, 24, 800–808. [Google Scholar] [CrossRef] [Scilit]
- Lapuente-Brun, E.; Moreno-Loshuertos, R.; Acín-Pérez, R.; Latorre-Pellicer, A.; Colás, C.; Balsa, E.; Perales-Clemente, E.; Quirós, P.M.; Calvo, E.; Rodríguez-Hernández, M.A.; et al. Supercomplex assembly determines electron flux in the mitochondrial electron transport chain. Science 2013, 340, 1567–1570. [Google Scholar] [CrossRef] [Scilit]
- Moreno-Lastres, D.; Fontanesi, F.; García-Consuegra, I.; Martín, M.A.; Arenas, J.; Barrientos, A.; Ugalde, C. Mitochondrial complex I plays an essential role in human respirasome assembly. Cell Metab. 2012, 15, 324–335. [Google Scholar] [CrossRef] [Scilit]
- Schägger, H.; Pfeiffer, K. Supercomplexes in the respiratory chains of yeast and mammalian mitochondria. EMBO J. 2000, 19, 1777–1783. [Google Scholar] [CrossRef] [Scilit]
- Shamoto, M. Age differences in the ultrastructure of hepatic cells of thyroxine-treated rats. J. Gerontol. 1968, 23, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Klion, F.M.; Segal, R.; Schaffner, F. The effect of altered thyroid function on the ultrastructure of the human liver. Am. J. Med. 1971, 50, 317–324. [Google Scholar] [CrossRef] [Scilit]
- Mannella, C.A.; Pfeiffer, D.R.; Bradshaw, P.C.; Moraru, I.I.; Slepchenko, B.; Loew, L.M.; Hsieh, C.E.; Buttle, K.; Marko, M. Topology of the mitochondrial inner membrane: Dynamics and bioenergetic implications. IUBMB Life 2001, 52, 93–100. [Google Scholar] [CrossRef] [Scilit]
- Santillo, A.; Burrone, L.; Falvo, S.; Senese, R.; Lanni, A.; Chieffi Baccari, G. Triiodothyronine induces lipid oxidation and mitochondrial biogenesis in rat Harderian gland. J. Endocrinol. 2013, 219, 69–78. [Google Scholar] [CrossRef] [Scilit]
- Pasyechko, N.V.; Kuleshko, I.I.; Kulchinska, V.M.; Naumova, L.V.; Smachylo, I.V.; Bob, A.O.; Radetska, L.V.; Havryliuk, M.Y.; Sopel, O.M.; Mazur, L.P. Ultrastructural liver changes in the experimental thyrotoxicosis. Pol. J. Pathol. 2017, 68, 144–147. [Google Scholar] [CrossRef] [Scilit]
- Venediktova, N.I.; Pavlik, L.L.; Belosludtseva, N.V.; Khmil, N.V.; Murzaeva, S.V.; Mironova, G.D. Formation of lamellar bodies in rat liver mitochondria in hyperthyroidism. J. Bioenerg. Biomembr. 2018, 50, 289–295. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, P.J.; L’Abbate, C.; Abrahamsohn, P.A.; Gouveia, C.A.; Moriscot, A.S. Temporal and topographic ultrastructural alterations of rat heart myofibrils caused by thyroid hormone. Microsc. Res. Tech. 2003, 62, 451–459. [Google Scholar] [CrossRef] [Scilit]
- Yau, W.W.; Singh, B.K.; Lesmana, R.; Zhou, J.; Sinha, R.A.; Wong, K.A.; Wu, Y.; Bay, B.-H.; Sugii, S.; Sun, L.; et al. Thyroid hormone (T3) stimulates brown adipose tissue activation via mitochondrial biogenesis and MTOR-mediated mitophagy. Autophagy 2019, 15, 131–150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lesmana, R.; Sinha, R.A.; Singh, B.K.; Zhou, J.; Ohba, K.; Wu, Y.; Yau, W.Y.; Bay, B.-H.; Yen, P.M. Thyroid Hormone Stimulation of Autophagy Is Essential for Mitochondrial Biogenesis and Activity in Skeletal Muscle. Endocrinology 2016, 157, 23–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jang, S.; Javadov, S. OPA1 regulates respiratory supercomplexes assembly: The role of mitochondrial swelling. Mitochondrion 2020, 51, 30–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Twig, G.; Shirihai, O.S. The Interplay Between Mitochondrial Dynamics and Mitophagy. Antioxid. Redox Signal. 2011, 14, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chi, H.-C.; Tsai, C.-Y.; Tsai, M.-M.; Yeh, C.-T.; Lin, K.-H. Molecular functions and clinical impact of thyroid hormone-triggered autophagy in liver-related diseases. J. Biomed. Sci. 2019, 26, 24. [Google Scholar] [CrossRef] [Scilit]
- Chi, H.C.; Chen, S.L.; Lin, S.L.; Tsai, C.Y.; Chuang, W.Y.; Lin, Y.H.; Huang, Y.H.; Tsai, M.M.; Yeh, C.T.; Lin, K.H. Thyroid hormone protects hepatocytes from HBx-induced carcinogenesis by enhancing mitochondrial turnover. Oncogene 2017, 36, 5274–5284. [Google Scholar] [CrossRef] [Scilit]
- Iannucci, L.F.; Cioffi, F.; Senese, R.; Goglia, F.; Lanni, A.; Yen, P.M.; Sinha, R.A. Metabolomic analysis shows differential hepatic effects of T2 and T3 in rats after short-term feeding with high fat diet. Sci. Rep. 2017, 7, 2023. [Google Scholar] [CrossRef] [Scilit]
- Klionsky, D.J.; Abdelmohsen, K.; Abe, A.; Abedin, M.J.; Abeliovich, H.; Adachi, H.; Adams, C.M.; Adams, P.D.; Adeli, K.; Adhihetty, P.J.; et al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 2016, 12, 1–222. [Google Scholar] [CrossRef] [Scilit]
- Quiros, P.M.; Goyal, A.; Jha, P.; Auwerx, J. Analysis of mtDNA/nDNA Ratio in Mice. Curr. Protoc. Mouse Biol. 2017, 7, 47–54. [Google Scholar] [CrossRef] [Scilit]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Scilit]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef] [Scilit]
- Venediktova, N.; Solomadin, I.; Nikiforova, A.; Starinets, V.; Mironova, G. Functional State of Rat Heart Mitochondria in Experimental Hyperthyroidism. Int. J. Mol. Sci. 2021, 22, 11744. [Google Scholar] [CrossRef] [Scilit]
- Chance, B.; Williams, G.R. Respiratory enzymes in oxidative phosphorylation. III. The steady state. J. Biol. Chem. 1955, 217, 409–427. [Google Scholar] [CrossRef] [Scilit]







| CR | HR | |
|---|---|---|
| T3 free, pmol/L | 5.2 ± 0.1 | 9.3 ± 1.2 *** |
| T4 free, pmol/L | 19.2 ± 1.0 | 66.2 ± 4.4 *** |
| Body weight, g | 256 ± 3.8 | 236 ± 3.6 ** |
| Body weight gain, g | 36 ± 2.6 | 15 ± 2 *** |
| Liver weight, g | 12 ± 0.3 | 9 ± 0.2 *** |
| Succ + Glu | Glu + Mal | Pyr + Mal | Asc + TMPD | |||||
|---|---|---|---|---|---|---|---|---|
| CR | HR | CR | HR | CR | HR | CR | HR | |
| State2 | 10 ± 0.4 | 15 ± 0.6 ** | 3.2 ± 0.2 | 4.4 ± 0.2 *** | 2 ± 0.2 | 2.1 ± 0.3 | 65 ± 6 | 86 ± 4.8 * |
| State3 | 71 ± 2.8 | 95 ± 5 ** | 43 ± 1.7 | 56 ± 2.5 *** | 20 ± 0.6 | 18 ± 0.7 * | 100 ± 8 | 127 ± 8 * |
| State4 | 12 ± 0.4 | 19 ± 0.6 *** | 5 ± 0.3 | 8 ± 0.2 *** | 3.8 ± 0.3 | 5 ± 0.3 * | 63 ± 5 | 85 ± 4 ** |
| StateDNP | 82 ± 4.2 | 98 ± 6 * | 48 ± 2.3 | 60 ± 2.5 ** | 17 ± 0.3 | 18 ± 0.8 | 120 ± 11 | 158 ± 10 * |
| RCR | 5.6 ± 0.1 | 4.9 ± 0.1 *** | 8.2 ± 0.3 | 7.2 ± 0.3 * | 5.6 ± 0.2 | 3.6 ± 0.2 *** | 1.6 ± 0.03 | 1.5 ± 0.03 * |
| ADP/O | 1.8 ± 0.03 | 1.7 ± 0.03 ** | 2.7 ± 0.04 | 2.4 ± 0.06 *** | 2.6 ± 0.1 | 2.4 ± 0.1 * | 0.90 ± 0.05 | 0.75 ± 0.03 * |
| CR | HR | |
|---|---|---|
| GSHtotal, nmol/mg | 4.9 ± 0.4 | 3 ± 0.4 ** |
| GSHred, nmol/mg | 4.8 ± 0.4 | 2.9 ± 0.04 ** |
| GSSG, nmol/mg | 0.13 ± 0.02 | 0.16 ± 0.03 |
| GSH/GSSG | 40 ± 4.4 | 19 ± 3.1 ** |
| Gene | Forward (5′ → 3′) | Reverse (5′ → 3′) |
|---|---|---|
| mt-tRNA | AATGGTTCGTTTGTTCAACGATT | AGAAACCGACCTGGATTGCTC |
| GAPDH | TGGCCTCCAAGGAGTAAGAAAC | GGCTCTCTCCTTGCTCTCAGTATC |
| Gene | Forward (5′ → 3′) | Reverse (5′ → 3′) |
|---|---|---|
| Drp1 | GATCCAGATGGGCGCAGAAC | ATGTCCAGTTGGCTCCTGTT |
| Mfn2 | AGCGTCCTCTCCCTCTGACA | TTCCACACCACTCCTCCGAC |
| OPA1 | GCAGAAGACAGCTTGAGGGT | TGCGTCCCACTGTTGCTTAT |
| PINK1 | GATGTGGAATATCTCGGCAGGA | TGTTTGCTGAACCCAAGGCT |
| Parkin | GGCCAGAGGAAAGTCACCTG | CACCCGGTATGCCTGAGAAG |
| Ppargc1α | TGACATAGAGTGTGCTGCCC | GCTGTCTGTGTCCAGGTCAT |
| Actb | GACCCAGATCATGTTTGAGACCT | CCAGAGGCATACAGGGACAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Venediktova, N.; Solomadin, I.; Starinets, V.; Mironova, G. Structural and Dynamic Features of Liver Mitochondria and Mitophagy in Rats with Hyperthyroidism. Int. J. Mol. Sci. 2022, 23, 14327. https://doi.org/10.3390/ijms232214327
Venediktova N, Solomadin I, Starinets V, Mironova G. Structural and Dynamic Features of Liver Mitochondria and Mitophagy in Rats with Hyperthyroidism. International Journal of Molecular Sciences. 2022; 23(22):14327. https://doi.org/10.3390/ijms232214327
Chicago/Turabian StyleVenediktova, Natalya, Ilya Solomadin, Vlada Starinets, and Galina Mironova. 2022. "Structural and Dynamic Features of Liver Mitochondria and Mitophagy in Rats with Hyperthyroidism" International Journal of Molecular Sciences 23, no. 22: 14327. https://doi.org/10.3390/ijms232214327
APA StyleVenediktova, N., Solomadin, I., Starinets, V., & Mironova, G. (2022). Structural and Dynamic Features of Liver Mitochondria and Mitophagy in Rats with Hyperthyroidism. International Journal of Molecular Sciences, 23(22), 14327. https://doi.org/10.3390/ijms232214327

