Molecular Characterizations of the er1 Alleles Conferring Resistance to Erysiphe pisi in Three Chinese Pea (Pisum sativum L.) Landraces
Abstract
:1. Introduction
2. Results
2.1. Phenotypic Evaluation and Inheritence Analysis for Resistance
2.2. Mapping of Resistance Genes
2.3. PsMLO1 Sequence Analysis
2.4. Development of Functional Markers for er1-13 and er1-14
2.5. Validation and Application of Functional Markers
3. Discussion
4. Materials and Methods
4.1. Plant Material and E. pisi Inoculum
4.2. Powdery Mildew Resistance Evaluation
4.3. Inheritance Analysis of Resistant Pea Cultivars
4.4. Genetic Mapping of the Resistance Gene
4.5. RNA Extraction and PsMLO1 Sequence Analysis
4.6. Development of Functional Markers for the Novel er1 Alleles
4.7. Validation and Application of Functional Markers
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
SSR | Simple sequence repeat |
SNP | Single nucleotide polymorphism |
KASPar | Kompetitive allele-specific PCR |
References
- Ali, S.M.; Sharma, B.; Ambrose, M.J. Current status and future strategy in breeding pea to improve resistance to biotic and abiotic stresses. Euphytica 1993, 1, 115–126. [Google Scholar] [CrossRef]
- Wang, X.; Zhu, Z.; Duan, C.; Zong, X. Identification and Control Technology of Disease and Pest on Faba Bean and Pea; Chinese Agricultural Science and Technology Press: Beijing, China, 2007. [Google Scholar]
- Smith, P.H.; Foster, E.M.; Boyd, L.A.; Brown, J.K.M. The early development of Erysiphe pisi on Pisum sativum L. Plant Pathol. 1996, 45, 302–309. [Google Scholar] [CrossRef]
- Ghafoor, A.; McPhee, K. Marker assisted selection (MAS) for developing powdery mildew resistant pea cultivars. Euphytica 2012, 186, 593–607. [Google Scholar] [CrossRef]
- Fondevilla, S.; Rubiales, D. Powdery mildew control in pea, a review. Agron. Sustain. Dev. 2012, 32, 401–409. [Google Scholar] [CrossRef] [Green Version]
- Harland, S.C. Inheritance of immunity to mildew in Peruvian forms of Pisum sativum. Heredity 1948, 2, 263–269. [Google Scholar] [CrossRef] [Green Version]
- Heringa, R.J.; Van Norel, A.; Tazelaar, M.F. Resistance to powdery mildew (Erysiphe polygoni D.C.) in peas (Pisum sativum L.). Euphytica 1969, 18, 163–169. [Google Scholar] [CrossRef]
- Fondevilla, S.; Torres, A.M.; Moreno, M.T.; Rubiales, D. Identification of a new gene for resistance to powdery mildew in Pisum fulvum, a wild relative of pea. Breed. Sci. 2007, 57, 181–184. [Google Scholar] [CrossRef] [Green Version]
- Humphry, M.; Reinstädler, A.; Ivanov, S.; Bisseling, T.; Panstruga, R. Durable broad-spectrum powdery mildew resistance in pea er1 plants is conferred by natural loss-of-function mutations in PsMLO1. Mol. Plant Pathol. 2011, 12, 866–878. [Google Scholar] [CrossRef]
- Timmerman, G.M.; Frew, T.J.; Weeden, N.F. Linkage analysis of er1, a recessive Pisum sativum gene for resistance to powdery mildew fungus (Erysiphe pisi DC). Theor. Appl. Genet. 1994, 88, 1050–1055. [Google Scholar] [CrossRef]
- Tiwari, K.R.; Penner, G.A.; Warkentin, T.D. Identification of coupling and repulsion phase RAPD markers for powdery mildew resistance gene er1 in pea. Genome 1998, 41, 440–444. [Google Scholar] [CrossRef]
- Ek, M.; Eklund, M.; von Post, R.; Dayteg, C.; Henriksson, T.; Weibull, P.; Ceplitis, A.; Isaac, P.; Tuvesson, S. Microsatellite markers for powdery mildew resistance in pea (Pisum sativum L.). Hereditas 2005, 142, 86–91. [Google Scholar] [CrossRef]
- Pereira, G.; Marques, C.; Ribeiro, R.; Formiga, S.; Dâmaso, M.; Sousa, T.; Farinhó, M.; Leitão, J.M. Identification of DNA markers linked to an induced mutated gene conferring resistance to powdery mildew in pea (Pisum sativum L.). Euphytica 2010, 171, 327–335. [Google Scholar] [CrossRef]
- Srivastava, R.K.; Mishra, S.K.; Singh, K.; Mohapatra, T. Development of a coupling-phase SCAR marker linked to the powdery mildew resistance gene er1 in pea (Pisum sativum L.). Euphytica 2012, 86, 855–866. [Google Scholar] [CrossRef] [Green Version]
- Wang, Z.; Fu, H.; Sun, S.; Duan, C.; Wu, X.; Yang, X.; Zhu, Z. Identification of powdery mildew resistance gene in pea line X9002. Acta Agron. Sin. 2015, 41, 515–523, (In Chinese with English abstract). [Google Scholar] [CrossRef]
- Sun, S.; Wang, Z.; Fu, H.; Duan, C.; Wang, X.; Zhu, Z. Resistance to powdery mildew in the pea cultivar Xucai 1 is conferred by the gene er1. Crop. J. 2015, 3, 489–499. [Google Scholar] [CrossRef] [Green Version]
- Sun, S.; Deng, D.; Wang, Z.; Duan, C.; Wu, X.; Wang, X.; Zong, X.; Zhu, Z. A novel er1 allele and the development and validation of its functional marker for breeding pea (Pisum sativum L.) resistance to powdery mildew. Appl. Genet. 2016, 129, 909–919. [Google Scholar]
- Sun, S.; Fu, H.; Wang, Z.; Duan, C.; Zong, X.; Zhu, Z. Discovery of a novel er1 allele conferring powdery mildew resistance in Chinese pea (Pisum sativum L.) landraces. PLoS ONE 2016, 11, e0147624. [Google Scholar] [CrossRef]
- Katoch, V.; Sharma, S.; Pathania, S.; Banayal, D.K.; Sharma, S.K.; Rathour, R. Molecular mapping of pea powdery mildew resistance gene er2 to pea linkage group III. Mol. Breed. 2010, 25, 229–237. [Google Scholar] [CrossRef]
- Cobos, M.J.; Satovic, Z.; Rubiales, D.; Fondevilla, S. Er3 gene, conferring resistance to Erysiphe pisi, is located in pea LGIV. Euphytica 2018, 214, 203. [Google Scholar] [CrossRef]
- Tiwari, K.R.; Penner, G.A.; Warkentin, T.D. Inheritance of powdery mildew resistance in pea. Can. J. Plant Sci. 1997, 77, 307–310. [Google Scholar] [CrossRef] [Green Version]
- Vaid, A.; Tyagi, P.D. Genetics of powdery mildew resistance in pea. Euphytica 1997, 96, 203–206. [Google Scholar] [CrossRef]
- Fondevilla, S.; Carver, T.L.W.; Moreno, M.T.; Rubiales, D. Macroscopic and histological characterisation of genes er1 and er2 for powdery mildew resistance in pea. Eur. J. Plant Pathol. 2006, 115, 309–321. [Google Scholar] [CrossRef]
- Fondevilla, S.; Cubero, J.I.; Rubiales, D. Confirmation that the Er3 gene, conferring resistance to Erysiphe pisi in pea, is a different gene from er1 and er2 genes. Plant Breed. 2011, 130, 281–282. [Google Scholar] [CrossRef] [Green Version]
- Bai, Y.; Pavan, S.; Zheng, Z.; Zappel, N.F.; Reinstadler, A.; Lotti, C.; DeGiovanni, C.; Ricciardi, L.; Lindhout, P.; Visser, R.; et al. Naturally occurring broad-spectrum powdery mildew resistance in a central American tomato accession is caused by loss of MLO1 function. Mol. Plant Microbe Interact. 2008, 21, 30–39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Büschges, R.; Hollricher, K.; Panstruga, R.; Simons, G.; Wolter, M.; Frijters, A.; van Daelen, R.; van der Lee, T.; Diergaarde, P.; Groenendijk, J. The barley MLO gene, a novel control element of plant pathogen resistance. Cell 1997, 88, 695–705. [Google Scholar] [CrossRef] [Green Version]
- Devoto, A.; Hartmann, H.A.; Piffanelli, P.; Elliott, C.; Simmons, C.; Taramino, G.; Goh, C.S.; Cohen, F.E.; Emerson, B.C.; Schulze-Lefert, P.; et al. Molecular phylogeny and evolution of the plant-specific seven-transmembrane MLO family. J. Mol. Evol. 2003, 56, 77–88. [Google Scholar] [CrossRef] [PubMed]
- Pavan, S.; Schiavulli, A.; Appiano, M.; Marcotrigiano, A.R.; Cillo, F.; Visser, R.G.F.; Bai, Y.; Lotti, C.; Luigi Ricciardi, L. Pea powdery mildew er1 resistance is associated to loss-of-function mutations at a MLO homologous locus. Appl. Genet. 2011, 123, 1425–1431. [Google Scholar] [CrossRef]
- Rispail, N.; Rubiales, D. Genome-wide identification and comparison of legume MLO gene family. Sci. Rep. 2016, 6, 32673. [Google Scholar] [CrossRef] [Green Version]
- Santo, T.; Rashkova, M.; Alabaca, C.; Leitao, J. The ENU–induced powdery mildew resistant mutant pea (Pisum sativum L.) lines S (er1mut1) and F (er1mut2) harbour early stop codons in the PsMLO1 gene. Mol. Breed. 2013, 32, 723–727. [Google Scholar] [CrossRef]
- Fu, H.; Sun, S.; Zhu, Z.; Duan, C.; Yang, X. Phenotypic and genotypic identification of powdery mildew resistance in pea cultivars or lines from Canada. J. Plant. Genet. Resour. 2014, 15, 1028–1033, (In Chinese with English abstract). [Google Scholar]
- Sun, S.; Deng, D.; Duan, C.; Zong, X.; Xu, D.; He, Y.; Zhu, Z. Two novel er1 alleles conferring powdery mildew (Erysiphe pisi) resistance identified in a worldwide collection of pea (Pisum sativum L.) germplasms. Int. J. Mol. Sci. 2019, 20, 5071. [Google Scholar] [CrossRef] [Green Version]
- Ma, Y.; Coyne, C.J.; Main, D.; Pavan, S.; Sun, S.; Zhu, Z.; Zong, X.; Leitão, J.; McGee, R.J. Development and validation of breeder-friendly KASPar markers for er1, a powdery mildew resistance gene in pea (Pisum sativum L.). Mol. Breed. 2017, 37, 151. [Google Scholar] [CrossRef]
- Sudheesh, S.; Lombardi, M.; Leonforte, A.; Cogan, N.O.I.; Materne, M.; Forster, J.W.; Kaur, S. Consensus Genetic Map Construction for Field Pea (Pisum sativum L.), Trait dissection of biotic and abiotic stress tolerance and development of a diagnostic marker for the er1 powdery mildew resistance gene. Plant. Mol. Biol. Rep. 2015, 33, 1391–1403. [Google Scholar] [CrossRef]
- Sulima, A.S.; Zhukov, V.A. War and Peas: Molecular bases of resistance to powdery mildew in pea (Pisum sativum L.) and other legumes. Plants 2022, 11, 339. [Google Scholar] [CrossRef]
- Pavan, S.; Schiavulli, A.; Appiano, M.; Miacola, C.; Visser, R.G.F.; Bai, Y.L.; Lotti, C.; Ricciardi, L. Identification of a complete set of functional markers for the selection of er1 powdery mildew resistance in Pisum sativum L. Mol. Breed. 2013, 31, 247–253. [Google Scholar] [CrossRef]
- Wang, Z.; Bao, S.; Duan, C.; Zong, X.; Zhu, Z. Screening and molecular identification of resistance to powdery mildew in pea germplasm. Acta Agron. Sin. 2013, 39, 1030–1038, (In Chinese with English abstract). [Google Scholar] [CrossRef]
- Liu, R.; Wang, F.; Fang, L.; Yang, T.; Zhang, H.; Huang, Y.; Wang, D.; Ji, Y.; Xu, D.; Li, G.; et al. An integrated high-density SSR genetic linkage map from two F2 population in Chinese pea. Acta Agron. Sin. 2020, 46, 1496–1506, (In Chinese with English abstract). [Google Scholar]
- Fu, H. Phenotyping and Genotyping Powdery Mildew Resistance in Pea. Ph.D. Thesis, Gansu Agricultural University, Gansu, China, 2014. (In Chinese with English abstract). [Google Scholar]
- Sun, S.; He, Y.; Dai, C.; Duan, C.; Zhu, Z. Two major er1 alleles confer powdery mildew resistance in three pea cultivars bred in Yunnan Province, China. Crop. J. 2016, 4, 353–359. [Google Scholar] [CrossRef] [Green Version]
- Kusch, S.; Panstruga, R. Mlo–based resistance, an apparently universal “Weapon” to defeat powdery mildew disease. MPMI 2017, 30, 179–189. [Google Scholar] [CrossRef] [Green Version]
- Shure, M.; Wessler, S.; Fedoroff, N. Molecular-identification and isolation of the waxy locus in maize. Cell 1983, 35, 225–233. [Google Scholar] [CrossRef]
- Bordat, A.; Savois, V.; Nicolas, M.; Salse, J.; Chauveau, A.; Bourgeois, M.; Potier, J.; Houtin, H.; Rond, C.; Murat, F.; et al. Translational genomics in legumes allowed placing in silico 5460 unigenes on the pea functional map and identified candidate genes in Pisum sativum L. Genes Genome Genet. 2011, 1, 93–103. [Google Scholar] [CrossRef] [Green Version]
- Loridon, K.; McPhee, K.; Morin, J.; Dubreuil, P.; Pilet-Nayel, M.L.; Aubert, G.; Rameau, C.; Baranger, A.; Coyne, C.; Lejeune-Hénaut, I.; et al. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). Theor. Appl. Genet. 2005, 111, 1022–1031. [Google Scholar] [CrossRef]
- Lander, E.S.; Daly, M.J.; Lincoln, S.E. Constructing genetic linkage maps with MAPMAKER/EXP Version 3.0, a tutorial and reference manual. In Institute for Biomedical Research Technical Report, 3rd ed.; Whitehead, A., Ed.; Whitehead Institute for Biomedical Research: Cambridge, MA, USA, 1993. [Google Scholar]
- Kosambi, D.D. The estimation of map distances from recombination values. Ann. Eugen. 1944, 12, 172–175. [Google Scholar] [CrossRef]
- Liu, R.H.; Meng, J.L. MapDraw, A Microsoft excel macro for drawing genetic linkage maps based on given genetic linkage data. Hereditas 2003, 25, 317–321, (In Chinese with English abstract). [Google Scholar]
Parents and the Cross | Generation | Amount | No. of Plant or Families | Expected Ratio and Goodness of Fit | ||||
---|---|---|---|---|---|---|---|---|
R | Rs | S | R:Rs:S | χ2 | P | |||
Bawan 6 | P1 | 30 | - | - | 30 | - | ||
Suoshadabaiwan | P2 | 30 | 30 | - | - | - | ||
Bawan 6 × Suoshadabaiwan | F1 | 5 | - | - | 5 | - | ||
F2 | 102 | 26 | - | 76 | 1:3 | 0.02 | 0.88 | |
F2:3 | 102 | 26 | 51 | 25 | 1:2:1 | 0.03 | 0.99 | |
Longwan 1 | P1 | 30 | - | - | 30 | - | ||
Dabaiwandou | P2 | 30 | 30 | - | - | - | ||
F1 | 6 | - | - | 6 | - | |||
Longwan 1 × Dabaiwandou | F2 | 121 | 29 | - | 92 | 1:3 | 0.07 | 0.79 |
F2:3 | 121 | 29 | 56 | 36 | 1:2:1 | 1.41 | 0.49 | |
Chengwan 8 | P1 | 30 | - | - | 30 | - | ||
Guiwan 1 | P2 | 30 | 30 | - | - | - | ||
F1 | 8 | - | - | 8 | - | |||
Chengwan 8 × Guiwan 1 | F2 | 131 | 36 | - | 95 | 1:3 | 0.43 | 0.51 |
F2:3 | 131 | 36 | 61 | 34 | 1:2:1 | 0.67 | 0.71 |
Markers | Primers | Sequence Information (5′–3′) | Annealing Tm |
---|---|---|---|
KASPar-er1-13 | Forward-T | GAAGAGGGAGTTAAGGAACGAACTTT | 65–57 °C touchdown |
Forward | AAGAGGGAGTTAAGGAACGAACTTG | ||
Common reverse | TGCAACAGCCCAAGTTGGTGTTTCT | ||
KASPar-er1-14 | Forward-T | ATATGCGTATCACAAAAAATTGGATCAACTT | 65–57 °C touchdown |
Forward | GCGTATCACAAAAAATTGGATCAACTG | ||
Common reverse | CCTTGGCCTTTGTGTTTGAAGTGGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, S.; Deng, D.; Wu, W.; He, Y.; Luo, G.; Du, C.; Duan, C.; Zhu, Z. Molecular Characterizations of the er1 Alleles Conferring Resistance to Erysiphe pisi in Three Chinese Pea (Pisum sativum L.) Landraces. Int. J. Mol. Sci. 2022, 23, 12016. https://doi.org/10.3390/ijms231912016
Sun S, Deng D, Wu W, He Y, Luo G, Du C, Duan C, Zhu Z. Molecular Characterizations of the er1 Alleles Conferring Resistance to Erysiphe pisi in Three Chinese Pea (Pisum sativum L.) Landraces. International Journal of Molecular Sciences. 2022; 23(19):12016. https://doi.org/10.3390/ijms231912016
Chicago/Turabian StyleSun, Suli, Dong Deng, Wenqi Wu, Yuhua He, Gaoling Luo, Chengzhang Du, Canxing Duan, and Zhendong Zhu. 2022. "Molecular Characterizations of the er1 Alleles Conferring Resistance to Erysiphe pisi in Three Chinese Pea (Pisum sativum L.) Landraces" International Journal of Molecular Sciences 23, no. 19: 12016. https://doi.org/10.3390/ijms231912016