Effect of Tauroursodeoxycholic Acid on Inflammation after Ocular Alkali Burn
Abstract
:1. Introduction
2. Results
2.1. TUDCA Ameliorated Corneal Structural Damage after OAB
2.2. TUDCA Suppressed Corneal Inflammation after OAB
2.3. TUDCA Protected the Structure of the Retina in OAB Eyes
2.4. TUDCA Attenuated RGC Apoptosis after OAB
2.5. TUDCA Reduced the Retinal Inflammation after OAB
2.6. TUDCA Alleviated Neuroinflammation Induced by OAB
2.7. TUDCA Inhibited ER Stress in OAB Retinas
3. Discussion
4. Materials and Methods
4.1. Animals and OAB Model
4.2. Pharmaceutical Intervention
4.3. Experimental Design
4.4. Mouse Slit Lamp Examination
4.5. Terminal Deoxynucleotidyl Transferase-Mediated dUTP Nick-End Labeling (TUNEL) Assay
4.6. Histological Analysis
4.7. Immunofluorescence
4.8. Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR)
4.9. Enzyme-Linked Immunosorbent Assay (ELISA)
4.10. Western Blotting
4.11. Quantitative and Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Reim, M.; Redbrake, C.; Schrage, N. Chemical and thermal injuries of the eyes. Surgical and medical treatment based on clinical and pathophysiological findings. Arch. Soc. Esp. Oftalmol. 2001, 76, 79–124. [Google Scholar] [PubMed]
- Wagoner, M.D. Chemical injuries of the eye: Current concepts in pathophysiology and therapy. Surv. Ophthalmol. 1997, 41, 275–313. [Google Scholar] [CrossRef]
- Hong, J.; Qiu, T.; Wei, A.; Sun, X.; Xu, J. Clinical characteristics and visual outcome of severe ocular chemical injuries in Shanghai. Ophthalmology 2010, 117, 2268–2272. [Google Scholar] [CrossRef] [PubMed]
- Shanbhag, S.S.; Saeed, H.N.; Paschalis, E.I.; Chodosh, J. Boston keratoprosthesis type 1 for limbal stem cell deficiency after severe chemical corneal injury: A systematic review. Ocul. Surf. 2018, 16, 272–281. [Google Scholar] [CrossRef]
- Ştefan, C.; Timaru, C.M.; Iliescu, D.A.; Schmitzer, S.; De Algerino, S.; Batras, M.; Hosseini-Ramhormozi, J. Glaucoma after chemical burns and radiation. Rom. J. Ophthalmol. 2016, 60, 209–215. [Google Scholar]
- Paschalis, E.I.; Zhou, C.; Lei, F.; Scott, N.; Kapoulea, V.; Robert, M.-C.; Vavvas, D.; Dana, R.; Chodosh, J.; Dohlman, C.H. Mechanisms of Retinal Damage after Ocular Alkali Burns. Am. J. Pathol. 2017, 187, 1327–1342. [Google Scholar] [CrossRef] [Green Version]
- Sharma, N.; Kaur, M.; Agarwal, T.; Sangwan, V.S.; Vajpayee, R.B. Treatment of acute ocular chemical burns. Surv. Ophthalmol. 2018, 63, 214–235. [Google Scholar] [CrossRef]
- Roshandel, D.; Eslani, M.; Baradaran-Rafii, A.; Cheung, A.Y.; Kurji, K.; Jabbehdari, S.; Maiz, A.; Jalali, S.; Djalilian, A.R.; Holland, E.J. Current and emerging therapies for corneal neovascularization. Ocul. Surf. 2018, 16, 398–414. [Google Scholar] [CrossRef]
- Wang, L.; Huang, Y.; Du, G.; Dong, Y.; Guo, H.; Wang, D.; Yu, J.; Wang, Q.; Chen, B.; Hou, L. Long-term outcomes and complications of Moscow Eye Microsurgery Complex in Russia (MICOF) keratoprosthesis following ocular surface burns: Clinical experience in China. Br. J. Ophthalmol. 2015, 99, 1669–1674. [Google Scholar] [CrossRef]
- Paschalis, E.I.; Lei, F.; Zhou, C.; Kapoulea, V.; Thanos, A.; Dana, R.; Vavvas, D.G.; Chodosh, J.; Dohlman, C.H. The Role of Microglia and Peripheral Monocytes in Retinal Damage after Corneal Chemical Injury. Am. J. Pathol. 2018, 188, 1580–1596. [Google Scholar] [CrossRef] [Green Version]
- Dohlman, C.H.; Cade, F.; Regatieri, C.V.; Zhou, C.; Lei, F.; Crnej, A.; Harissi-Dagher, M.; Robert, M.-C.; Papaliodis, G.N.; Chen, D.; et al. Chemical Burns of the Eye: The Role of Retinal Injury and New Therapeutic Possibilities. Cornea 2018, 37, 248–251. [Google Scholar] [CrossRef] [PubMed]
- Miyamoto, F.; Sotozono, C.; Ikeda, T.; Kinoshita, S. Retinal cytokine response in mouse alkali-burned eye. Ophthalmic. Res. 1998, 30, 168–171. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Robert, M.-C.; Kapoulea, V.; Lei, F.; Stagner, A.; Jakobiec, F.A.; Dohlman, C.H.; Paschalis, E.I. Sustained Subconjunctival Delivery of Infliximab Protects the Cornea and Retina Following Alkali Burn to the Eye. Invest. Ophthalmol. Vis. Sci. 2017, 58, 96–105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodrigues, E.B.; Farah, M.E.; Maia, M.; Penha, F.M.; Regatieri, C.; Melo, G.B.; Pinheiro, M.M.; Zanetti, C.R. Therapeutic monoclonal antibodies in ophthalmology. Prog. Retin. Eye Res. 2009, 28, 117–144. [Google Scholar] [CrossRef]
- Huang, Y.; Yuan, M.; Duan, F.; Yang, Y.; Lou, B.; Lin, X. Inhibition of endoplasmic reticulum stress by 4-phenylbutyrate alleviates retinal inflammation and the apoptosis of retinal ganglion cells after ocular alkali burn in mice. Inflamm. Res. 2022, 1–14. [Google Scholar] [CrossRef]
- Pardue, M.T.; Allen, R.S. Neuroprotective strategies for retinal disease. Prog. Retin. Eye Res. 2018, 65, 50–76. [Google Scholar] [CrossRef]
- Daruich, A.; Picard, E.; Boatright, J.H.; Behar-Cohen, F. Review: The bile acids urso- and tauroursodeoxycholic acid as neuroprotective therapies in retinal disease. Mol. Vis. 2019, 25, 610–624. [Google Scholar]
- Kim, S.J.; Ko, W.-K.; Jo, M.-J.; Arai, Y.; Choi, H.; Kumar, H.; Han, I.-B.; Sohn, S. Anti-inflammatory effect of Tauroursodeoxycholic acid in RAW 264.7 macrophages, Bone marrow-derived macrophages, BV2 microglial cells, and spinal cord injury. Sci. Rep. 2018, 8, 3176. [Google Scholar] [CrossRef] [Green Version]
- Elia, A.E.; Lalli, S.; Monsurrò, M.R.; Sagnelli, A.; Taiello, A.C.; Reggiori, B.; La Bella, V.; Tedeschi, G.; Albanese, A. Tauroursodeoxycholic acid in the treatment of patients with amyotrophic lateral sclerosis. Eur. J. Neurol. 2016, 23, 45–52. [Google Scholar] [CrossRef] [Green Version]
- De La Barca, J.M.C.; Simard, G.; Amati-Bonneau, P.; Safiedeen, Z.; Prunier-Mirebeau, D.; Chupin, S.; Gadras, C.; Tessier, L.; Gueguen, N.; Chevrollier, A.; et al. The metabolomic signature of Leber's hereditary optic neuropathy reveals endoplasmic reticulum stress. Brain 2016, 139, 2864–2876. [Google Scholar] [CrossRef]
- Noailles, A.; Fernández-Sánchez, L.; Lax, P.; Cuenca, N. Microglia activation in a model of retinal degeneration and TUDCA neuroprotective effects. J. Neuroinflammation 2014, 11, 186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xia, H.; Nan, Y.; Huang, X.; Gao, J.; Pu, M. Effects of Tauroursodeoxycholic Acid and Alpha-Lipoic-Acid on the Visual Response Properties of Cat Retinal Ganglion Cells: An In Vitro Study. Invest. Ophthalmol. Vis. Sci. 2015, 56, 6638–6645. [Google Scholar] [CrossRef] [PubMed]
- Kitamura, Y.; Bikbova, G.; Baba, T.; Yamamoto, S.; Oshitari, T. In vivo effects of single or combined topical neuroprotective and regenerative agents on degeneration of retinal ganglion cells in rat optic nerve crush model. Sci. Rep. 2019, 9, 101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gómez-Vicente, V.; Lax, P.D.; Fernández-Sánchez, L.; Rondón, N.; Esquiva, G.; Germain, F.; De La Villa, P.; Cuenca, N. Neuroprotective Effect of Tauroursodeoxycholic Acid on N-Methyl-D-Aspartate-Induced Retinal Ganglion Cell Degeneration. PLoS ONE 2015, 10, e0137826. [Google Scholar] [CrossRef] [Green Version]
- Gaspar, J.M.; Martins, A.; Cruz, R.; Rodrigues, C.M.P.; Ambrósio, A.F.; Santiago, A.R. Tauroursodeoxycholic acid protects retinal neural cells from cell death induced by prolonged exposure to elevated glucose. Neuroscience 2013, 253, 380–388. [Google Scholar] [CrossRef]
- Yanguas-Casás, N.; Barreda-Manso, M.A.; Nieto-Sampedro, M.; Romero-Ramírez, L. Tauroursodeoxycholic acid reduces glial cell activation in an animal model of acute neuroinflammation. J. Neuroinflamm. 2014, 11, 50. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Shahani, U.; Reilly, J.; Shu, X. Disease mechanisms and neuroprotection by tauroursodeoxycholic acid in Rpgr knockout mice. J. Cell Physiol. 2019, 234, 18801–18812. [Google Scholar] [CrossRef]
- Bakunowicz-Łazarczyk, A.; Urban, B. Assessment of therapeutic options for reducing alkali burn-induced corneal neovascularization and inflammation. Adv. Med. Sci. 2016, 61, 101–112. [Google Scholar] [CrossRef]
- Bian, F.; Xiao, Y.; Zaheer, M.; Volpe, E.A.; Pflugfelder, S.C.; Li, D.-Q.; De Paiva, C.S. Inhibition of NLRP3 Inflammasome Pathway by Butyrate Improves Corneal Wound Healing in Corneal Alkali Burn. Int. J. Mol. Sci. 2017, 18, 562. [Google Scholar] [CrossRef] [Green Version]
- Imanishi, J.; Kamiyama, K.; Iguchi, I.; Kita, M.; Sotozono, C.; Kinoshita, S. Growth factors: Importance in wound healing and maintenance of transparency of the cornea. Prog. Retin. Eye Res. 2000, 19, 113–129. [Google Scholar] [CrossRef]
- Liang, W.; Zhang, Y.; Zhou, L.; Lu, X.; Finn, M.E.; Wang, W.; Shao, H.; Dean, D.C.; Zhang, L.; Liu, Y. Zeb1 regulation of wound-healing-induced inflammation in alkali-damaged corneas. iScience 2022, 25, 104038. [Google Scholar] [CrossRef] [PubMed]
- Woo, S.J.; Kim, J.H.; Yu, H.G. Ursodeoxycholic acid and tauroursodeoxycholic acid suppress choroidal neovascularization in a laser-treated rat model. J. Ocul. Pharmacol. Ther. 2010, 26, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Cade, F.; Paschalis, E.I.; Regatieri, C.V.; Vavvas, D.G.; Dana, R.; Dohlman, C.H. Alkali burn to the eye: Protection using TNF-alpha inhibition. Cornea 2014, 33, 382–389. [Google Scholar] [CrossRef] [PubMed]
- Beli, E.; Yan, Y.; Moldovan, L.; Vieira, C.P.; Gao, R.; Duan, Y.; Prasad, R.; Bhatwadekar, A.; White, F.A.; Townsend, S.D.; et al. Restructuring of the Gut Microbiome by Intermittent Fasting Prevents Retinopathy and Prolongs Survival in db/db Mice. Diabetes 2018, 67, 1867–1879. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ouyang, H.; Mei, X.; Zhang, T.; Lu, B.; Ji, L. Ursodeoxycholic acid ameliorates diabetic retinopathy via reducing retinal inflammation and reversing the breakdown of blood-retinal barrier. Eur. J. Pharmacol. 2018, 840, 20–27. [Google Scholar] [CrossRef] [PubMed]
- McVicar, C.M.; Hamilton, R.; Colhoun, L.M.; Gardiner, T.A.; Brines, M.; Cerami, A.; Stitt, A.W. Intervention with an erythropoietin-derived peptide protects against neuroglial and vascular degeneration during diabetic retinopathy. Diabetes 2011, 60, 2995–3005. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mehrabian, Z.; Guo, Y.; Weinreich, D.; Bernstein, S.L. Oligodendrocyte death, neuroinflammation, and the effects of minocycline in a rodent model of nonarteritic anterior ischemic optic neuropathy (rNAION). Mol. Vis. 2017, 23, 963–976. [Google Scholar]
- Soto, I.; Howell, G.R. The complex role of neuroinflammation in glaucoma. Cold Spring Harb. Perspect. Med. 2014, 4, a017269. [Google Scholar] [CrossRef]
- Weishaupt, J.H.; Rohde, G.; Pölking, E.; Siren, A.-L.; Ehrenreich, H.; Bähr, M. Effect of erythropoietin axotomy-induced apoptosis in rat retinal ganglion cells. Invest. Ophthalmol. Vis. Sci. 2004, 45, 1514–1522. [Google Scholar] [CrossRef] [Green Version]
- Bhargava, P.; Smith, M.D.; Mische, L.; Harrington, E.; Fitzgerald, K.C.; Martin, K.; Kim, S.; Reyes, A.A.; Gonzalez-Cardona, J.; Volsko, C.; et al. Bile acid metabolism is altered in multiple sclerosis and supplementation ameliorates neuroinflammation. J. Clin. Invest. 2020, 130, 3467–3482. [Google Scholar] [CrossRef] [Green Version]
- Oveson, B.C.; Iwase, T.; Hackett, S.F.; Lee, S.Y.; Usui, S.; Sedlak, T.W.; Snyder, S.H.; Campochiaro, P.A.; Sung, J.U. Constituents of bile, bilirubin and TUDCA, protect against oxidative stress-induced retinal degeneration. J. Neurochem. 2011, 116, 144–153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lawson, E.; Bhatia, S.K.; Han, M.K.; Aung, M.H.; Ciavatta, V.; Boatright, J.H.; Pardue, M.T. Tauroursodeoxycholic Acid Protects Retinal Function and Structure in rd1 Mice. Adv. Exp. Med. Biol. 2016, 854, 431–436. [Google Scholar] [CrossRef]
- Drack, A.; Dumitrescu, A.; Bhattarai, S.; Gratie, D.; Stone, E.M.; Mullins, R.; Sheffield, V.C. TUDCA slows retinal degeneration in two different mouse models of retinitis pigmentosa and prevents obesity in Bardet-Biedl syndrome type 1 mice. Invest. Ophthalmol. Vis. Sci. 2012, 53, 100–106. [Google Scholar] [CrossRef] [PubMed]
- Cheng, L.; Huang, C.; Chen, Z. Tauroursodeoxycholic Acid Ameliorates Lipopolysaccharide-Induced Depression Like Behavior in Mice via the Inhibition of Neuroinflammation and Oxido-Nitrosative Stress. Pharmacology 2019, 103, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.; Phillips, C.; Oh, J.Y.; Stock, E.M.; Kim, D.-K.; Won, J.-K.; Fulcher, S. Comprehensive Modeling of Corneal Alkali Injury in the Rat Eye. Curr. Eye Res. 2017, 42, 1348–1357. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward | Reverse |
---|---|---|
TNF-α | TGCCTATGTCTCAGCCTCTT | GAGGCCATTTGGGAACTTCT |
IL-1β | TAGAGCTGCTGGCCTTGTTA | ACCTGTAAAGGCTTCTCGGA |
GAPDH | TGCACCACCAACTGCTTAG | GGATGCAGGGATGATGTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, Y.; Lin, L.; Yang, Y.; Duan, F.; Yuan, M.; Lou, B.; Lin, X. Effect of Tauroursodeoxycholic Acid on Inflammation after Ocular Alkali Burn. Int. J. Mol. Sci. 2022, 23, 11717. https://doi.org/10.3390/ijms231911717
Huang Y, Lin L, Yang Y, Duan F, Yuan M, Lou B, Lin X. Effect of Tauroursodeoxycholic Acid on Inflammation after Ocular Alkali Burn. International Journal of Molecular Sciences. 2022; 23(19):11717. https://doi.org/10.3390/ijms231911717
Chicago/Turabian StyleHuang, Yanqiao, Lixia Lin, Yao Yang, Fang Duan, Miner Yuan, Bingsheng Lou, and Xiaofeng Lin. 2022. "Effect of Tauroursodeoxycholic Acid on Inflammation after Ocular Alkali Burn" International Journal of Molecular Sciences 23, no. 19: 11717. https://doi.org/10.3390/ijms231911717
APA StyleHuang, Y., Lin, L., Yang, Y., Duan, F., Yuan, M., Lou, B., & Lin, X. (2022). Effect of Tauroursodeoxycholic Acid on Inflammation after Ocular Alkali Burn. International Journal of Molecular Sciences, 23(19), 11717. https://doi.org/10.3390/ijms231911717