The Effects of Seven-Day Exposure to Silver Nanoparticles on Fertility and Homeostasis of Zebrafish (Danio rerio)
Abstract
:1. Introduction
2. Results
2.1. Histology of Liver
2.2. Ultrastructure of Hepatocytes
2.3. Histology of the Ovary
2.4. Histology of the Testis
2.5. Genotoxicity
2.6. Gene Expression
3. Discussion
4. Materials and Methods
4.1. Schematic of the Experiment
4.2. Origin and Characterization of Silver Nanoparticles and Silver Nitrate
4.3. Histology Analyses
4.4. Ultrastructure Analyses of Hepatocytes
4.5. Genotoxicity Analysis
4.6. Gene Expression Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
References
- Bruna, T.; Maldonado-Bravo, F.; Jara, P.; Caro, N. Silver Nanoparticles and Their Antibacterial Applications. Int. J. Mol. Sci. 2021, 22, 7202. [Google Scholar] [CrossRef] [PubMed]
- Costa, C.S.; Ronconi, J.V.V.; Daufenbach, J.F.; Gonçalves, C.L.; Rezin, G.T.; Streck, E.L.; da Silva Paula, M.M. In vitro effects of silver nanoparticles on the mitochondrial respiratory chain. Mol. Cell. Biochem. 2010, 342, 51–56. [Google Scholar] [CrossRef] [PubMed]
- Cronholm, P.; Karlsson, H.L.; Hedberg, J.; Lowe, T.A.; Winnberg, L.; Elihn, K.; Wallinder, I.O.; Möller, L. Intracellular Uptake and Toxicity of Ag and CuO Nanoparticles: A Comparison Between Nanoparticles and their Corresponding Metal Ions. Small 2013, 9, 970–982. [Google Scholar] [CrossRef] [PubMed]
- Lekamge, S.; Miranda, A.F.; Abraham, A.; Li, V.; Shukla, R.; Bansal, V.; Nugegoda, D. The Toxicity of Silver Nanoparticles (AgNPs) to Three Freshwater Invertebrates With Different Life Strategies: Hydra vulgaris, Daphnia carinata, and Paratya australiensis. Front. Environ. Sci. 2018, 6, 152. [Google Scholar] [CrossRef]
- Campion, S.; Aubrecht, J.; Boekelheide, K.; Brewster, D.W.; Vaidya, V.S.; Anderson, L.; Burt, D.; Dere, E.; Hwang, K.; Pacheco, S.; et al. The current status of biomarkers for predicting toxicity. Expert Opin. Drug Metab. Toxicol. 2013, 9, 1391–1408. [Google Scholar] [CrossRef]
- Chakraborty, C.; Sharma, A.R.; Sharma, G.; Lee, S.-S. Zebrafish: A complete animal model to enumerate the nanoparticle toxicity. J. Nanobiotechnol. 2016, 14, 65. [Google Scholar] [CrossRef]
- Ostaszewska, T.; Chojnacki, M.; Kamaszewski, M.; Sawosz-Chwalibóg, E. Histopathological effects of silver and copper nanoparticles on the epidermis, gills, and liver of Siberian sturgeon. Environ. Sci. Pollut. Res. 2016, 23, 1621–1633. [Google Scholar] [CrossRef]
- Ostaszewska, T.; Śliwiński, J.; Kamaszewski, M.; Sysa, P.; Chojnacki, M. Cytotoxicity of silver and copper nanoparticles on rainbow trout (Oncorhynchus mykiss) hepatocytes. Environ. Sci. Pollut. Res. 2018, 25, 908–915. [Google Scholar] [CrossRef]
- Jaworski, S.; Strojny-Cieślak, B.; Wierzbicki, M.; Kutwin, M.; Sawosz, E.; Kamaszewski, M.; Matuszewski, A.; Sosnowska, M.; Szczepaniak, J.; Daniluk, K.; et al. Comparison of the Toxicity of Pristine Graphene and Graphene Oxide, Using Four Biological Models. Materials 2021, 14, 4250. [Google Scholar] [CrossRef]
- Dumont, E.; Johnson, A.C.; Keller, V.D.; Williams, R.J. Nano silver and nano zinc-oxide in surface waters—Exposure estimation for Europe at high spatial and temporal resolution. Environ. Pollut. 2015, 196, 341–349. [Google Scholar] [CrossRef] [Green Version]
- Syafiuddin, A.; Salmiati, S.; Hadibarata, T.; Kueh, A.B.H.; Salim, M.R.; Zaini, M.A.A. Silver Nanoparticles in the Water Environment in Malaysia: Inspection, characterization, removal, modeling, and future perspective. Sci. Rep. 2018, 8, 986. [Google Scholar] [CrossRef] [PubMed]
- Johari, S.A. Toxicity Effect of Colloidal Silver Nanoparticles on Fertilization Capacity and Reproduction Success of Rainbow Trout (Oncorhynchus mykiss). J. Nanomed. Res. 2014, 1, 1–4. [Google Scholar] [CrossRef]
- McGillicuddy, E.; Murray, I.; Kavanagh, S.; Morrison, L.; Fogarty, A.; Cormican, M.; Dockery, P.; Prendergast, M.; Rowan, N.; Morris, D. Silver nanoparticles in the environment: Sources, detection and ecotoxicology. Sci. Total Environ. 2017, 575, 231–246. [Google Scholar] [CrossRef] [PubMed]
- Ong, C.; Lee, Q.Y.; Cai, Y.; Liu, X.; Ding, J.; Yung, L.-Y.L.; Bay, B.-H.; Baeg, G.-H. Silver nanoparticles disrupt germline stem cell maintenance in the Drosophila testis. Sci. Rep. 2016, 6, 20632. [Google Scholar] [CrossRef]
- Chen, Y.; Si, Y.; Zhou, D.; Dang, F. Differential bioaccumulation patterns of nanosized and dissolved silver in a land snail Achatina fulica. Environ. Pollut. 2017, 222, 50–57. [Google Scholar] [CrossRef] [PubMed]
- Katarzyńska-Banasik, D.; Grzesiak, M.; Kowalik, K.; Sechman, A. Administration of silver nanoparticles affects ovarian steroidogenesis and may influence thyroid hormone metabolism in hens (Gallus domesticus). Ecotoxicol. Environ. Saf. 2021, 208, 111427. [Google Scholar] [CrossRef]
- Liu, J.; Hurt, R.H. Ion Release Kinetics and Particle Persistence in Aqueous Nano-Silver Colloids. Environ. Sci. Technol. 2010, 44, 2169–2175. [Google Scholar] [CrossRef]
- Zhang, C.; Hu, Z.; Deng, B. Silver nanoparticles in aquatic environments: Physiochemical behavior and antimicrobial mechanisms. In Water Research; Elsevier Ltd.: Amsterdam, The Netherdlands, 2016; Volume 88, pp. 403–427. [Google Scholar] [CrossRef]
- Bélteky, P.; Rónavári, A.; Igaz, N.; Szerencsés, B.; Tóth, I.Y.; Pfeiffer, I.; Kiricsi, M.; Kónya, Z. Silver nanoparticles: Aggregation behavior in biorelevant conditions and its impact on biological activity. Int. J. Nanomed. 2019, 14, 667–687. [Google Scholar] [CrossRef]
- Degger, N.; Tse, A.C.; Wu, R.S. Silver nanoparticles disrupt regulation of steroidogenesis in fish ovarian cells. Aquat. Toxicol. 2015, 169, 143–151. [Google Scholar] [CrossRef]
- Glover, R.D.; Miller, J.M.; Hutchison, J.E. Generation of metal nanoparticles from silver and copper objects: Nanoparticle dynamics on surfaces and potential sources of nanoparticles in the environment. ACS Nano 2011, 5, 8950–8957. [Google Scholar] [CrossRef]
- Aziz, S.B.; Abidin, Z.H.Z.; Kadir, M.F.Z. Innovative method to avoid the reduction of silver to silver nanoparticles in silver ion conducting based polymer electrolytes. Phys. Scr. 2015, 90, 35808. [Google Scholar] [CrossRef]
- El Badawy, A.M.; Luxton, T.P.; Silva, R.G.; Scheckel, K.; Suidan, M.T.; Tolaymat, T.M. Impact of Environmental Conditions (pH, Ionic Strength, and Electrolyte Type) on the Surface Charge and Aggregation of Silver Nanoparticles Suspensions. Environ. Sci. Technol. 2010, 44, 1260–1266. [Google Scholar] [CrossRef] [PubMed]
- Römer, I.; White, T.A.; Baalousha, M.; Chipman, K.; Viant, M.R.; Lead, J.R. Aggregation and dispersion of silver nanoparticles in exposure media for aquatic toxicity tests. J. Chromatogr. A 2011, 1218, 4226–4233. [Google Scholar] [CrossRef] [PubMed]
- Ahlberg, S.; Antonopulos, A.; Diendorf, J.; Dringen, R.; Epple, M.; Flöck, R.; Goedecke, W.; Graf, C.; Haberl, N.; Helmlinger, J.; et al. PVP-coated, negatively charged silver nanoparticles: A multi-center study of their physicochemical characteristics, cell culture and in vivo experiments. Beilstein J. Nanotechnol. 2014, 5, 1944–1965. [Google Scholar] [CrossRef] [PubMed]
- Behra, R.; Sigg, L.; Clift, M.J.D.; Herzog, F.; Minghetti, M.; Johnston, B.; Petri-Fink, A.; Rothen-Rutishauser, B. Bioavailability of silver nanoparticles and ions: From a chemical and biochemical perspective. J. R. Soc. Interface 2013, 10, 20130396. [Google Scholar] [CrossRef]
- Sinha, A.K.; Matey, V.; Giblen, T.; Blust, R.; De Boeck, G. Gill remodeling in three freshwater teleosts in response to high environmental ammonia. Aquat. Toxicol. 2014, 155, 166–180. [Google Scholar] [CrossRef]
- Jemec, A.; Drobne, D.; Tisler, T.; Sepčić, K. Biochemical biomarkers in environmental studies—Lessons learnt from enzymes catalase, glutathione S-transferase and cholinesterase in two crustacean species. Environ. Sci. Pollut. Res. 2010, 17, 571–581. [Google Scholar] [CrossRef]
- Borase, H.P.; Muley, A.B.; Patil, S.V.; Singhal, R.S. Nano-eco toxicity study of gold nanoparticles on aquatic organism Moina macrocopa: As new versatile ecotoxicity testing model. Environ. Toxicol. Pharmacol. 2019, 68, 4–12. [Google Scholar] [CrossRef]
- Mwaanga, P.; Carraway, E.R.; Hurk, P.V.D. The induction of biochemical changes in Daphnia magna by CuO and ZnO nanoparticles. Aquat. Toxicol. 2014, 150, 201–209. [Google Scholar] [CrossRef]
- Lorentzen, M.; Maage, A.; Julshamn, K. Supplementing copper to a fish meal based diet fed to Atlantic salmon parr affects liver copper and selenium concentrations. Aquac. Nutr. 1998, 4, 67–72. [Google Scholar] [CrossRef]
- Yuan, F.; Wang, H.; Tian, Y.; Li, Q.; He, L.; Li, N.; Liu, Z. Fish oil alleviated high-fat diet–induced non-alcoholic fatty liver disease via regulating hepatic lipids metabolism and metaflammation: A transcriptomic study. Lipids Health Dis. 2016, 15, 20. [Google Scholar] [CrossRef] [PubMed]
- Al-Bairuty, G.A.; Shaw, B.J.; Handy, R.D.; Henry, T.B. Histopathological effects of waterborne copper nanoparticles and copper sulphate on the organs of rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 2013, 126, 104–115. [Google Scholar] [CrossRef] [PubMed]
- Brohi, R.D.; Wang, L.; Talpur, H.S.; Wu, D.; Khan, F.A.; Bhattarai, D.; Rehman, Z.-U.; FarmanUllah, F.; Huo, L.-J. Toxicity of Nanoparticles on the Reproductive System in Animal Models: A Review. Front. Pharmacol. 2017, 8, 606. [Google Scholar] [CrossRef]
- Castellini, C.; Ruggeri, S.; Mattioli, S.; Bernardini, G.; Macchioni, L.; Moretti, E.; Collodel, G. Long-term effects of silver nanoparticles on reproductive activity of rabbit buck. Syst. Biol. Reprod. Med. 2014, 60, 143–150. [Google Scholar] [CrossRef] [PubMed]
- Dayal, N.; Thakur, M.; Patil, P.; Singh, D.; Vanage, G.; Joshi, D.S. Histological and genotoxic evaluation of gold nanoparticles in ovarian cells of zebrafish (Danio rerio). J. Nanopart. Res. 2016, 18, 291. [Google Scholar] [CrossRef]
- Thakur, M.; Gupta, H.; Singh, D.; Mohanty, I.R.; Maheswari, U.; Vanage, G.; Joshi, D.S. Histopathological and ultra structural effects of nanoparticles on rat testis following 90 days (Chronic study) of repeated oral administration. J. Nanobiotechnol. 2014, 12, 42. [Google Scholar] [CrossRef]
- Fathi, N.; Hoseinipanah, S.M.; Alizadeh, Z.; Assari, M.J.; Moghimbeigi, A.; Mortazavi, M.; Hosseini, M.H.; Bahmanzadeh, M. The effect of silver nanoparticles on the reproductive system of adult male rats: A morphological, histological and DNA integrity study. Adv. Clin. Exp. Med. 2019, 28, 299–305. [Google Scholar] [CrossRef]
- Olugbodi, J.O.; David, O.; Oketa, E.N.; Lawal, B.; Okoli, B.J.; Mtunzi, F. Silver Nanoparticles Stimulates Spermatogenesis Impairments and Hematological Alterations in Testis and Epididymis of Male Rats. Molecules 2020, 25, 1063. [Google Scholar] [CrossRef]
- Gao, G.; Ze, Y.; Zhao, X.; Sang, X.; Zheng, L.; Ze, X.; Gui, S.; Sheng, L.; Sun, Q.; Hong, J.; et al. Titanium dioxide nanoparticle-induced testicular damage, spermatogenesis suppression, and gene expression alterations in male mice. J. Hazard. Mater. 2013, 258–259, 133–143. [Google Scholar] [CrossRef]
- Skjolding, L.M.; Sørensen, S.N.; Hartmann, N.B.; Hjorth, R.; Hansen, S.F.; Baun, A. Aquatic Ecotoxicity Testing of Nanoparticles-The Quest To Disclose Nanoparticle Effects. Angew. Chem. Int. Ed. 2016, 55, 15224–15239. [Google Scholar] [CrossRef]
- Bacchetta, C.; Ale, A.; Simoniello, M.F.; Gervasio, S.; Davico, C.; Rossi, A.S.; Desimone, M.F.; Poletta, G.; López, G.; Monserrat, J.M.; et al. Genotoxicity and oxidative stress in fish after a short-term exposure to silver nanoparticles. Ecol. Indic. 2017, 76, 230–239. [Google Scholar] [CrossRef]
- Asare, N.; Instanes, C.; Sandberg, W.J.; Refsnes, M.; Schwarze, P.; Kruszewski, M.; Brunborg, G. Cytotoxic and genotoxic effects of silver nanoparticles in testicular cells. Toxicology 2012, 291, 65–72. [Google Scholar] [CrossRef] [PubMed]
- Puppel, K.; Kapusta, A.; Kuczyńska, B. The etiology of oxidative stress in the various species of animals, a review. J. Sci. Food Agric. 2015, 95, 2179–2184. [Google Scholar] [CrossRef] [PubMed]
- Nandi, A.; Yan, L.-J.; Jana, C.K.; Das, N. Role of Catalase in Oxidative Stress- and Age-Associated Degenerative Diseases. Oxidative Med. Cell. Longev. 2019, 2019, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Valerio-García, R.C.; Carbajal-Hernández, A.L.; Martínez-Ruíz, E.B.; Jarquín-Díaz, V.H.; Haro-Pérez, C.; Martínez-Jerónimo, F. Exposure to silver nanoparticles produces oxidative stress and affects macromolecular and metabolic biomarkers in the goodeid fish Chapalichthys pardalis. Sci. Total Environ. 2017, 583, 308–318. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhou, Q. Silver nanoparticles cause oxidative damage and histological changes in medaka (Oryzias latipes) after 14 days of exposure. Environ. Toxicol. Chem. 2013, 32, 165–173. [Google Scholar] [CrossRef] [PubMed]
- Kakakhel, M.A.; Wu, F.; Sajjad, W.; Zhang, Q.; Khan, I.; Ullah, K.; Wang, W. Long-term exposure to high-concentration silver nanoparticles induced toxicity, fatality, bioaccumulation, and histological alteration in fish (Cyprinus carpio). Environ. Sci. Eur. 2021, 33, 14. [Google Scholar] [CrossRef]
- Scown, T.M.; Santos, E.; Johnston, B.D.; Gaiser, B.K.; Baalousha, M.; Mitov, S.; Lead, J.R.; Stone, V.; Fernandes, T.; Jepson, M.A.; et al. Effects of Aqueous Exposure to Silver Nanoparticles of Different Sizes in Rainbow Trout. Toxicol. Sci. 2010, 115, 521–534. [Google Scholar] [CrossRef]
- Williams, S.Y.; Renquist, B.J. High Throughput Danio Rerio Energy Expenditure Assay. J. Vis. Exp. 2016, 107, e53297. [Google Scholar] [CrossRef] [Green Version]
- Kamaszewski, M.; Skrobisz, M.; Wójcik, M.; Kawalski, K.; Szczepański, A.; Bujarski, P.; Szudrowicz, H.; Herman, A.P.; Martynow, J. The Role of Transcription Factors in Gonad Development and Sex Differentiation of a Teleost Model Fish—Guppy (Poecilia reticulata). Animals 2020, 10, 2401. [Google Scholar] [CrossRef]
- van der Ven, L.; Wester, P. Histology and Histopathology Atlas of the Zebrafish. Available online: http://zfin.org/hh_atlas/ (accessed on 25 August 2022).
- Vignardi, C.P.; Hasue, F.M.; Sartório, P.V.; Cardoso, C.M.; Machado, A.S.; Passos, M.J.; Santos, T.C.; Nucci, J.M.; Hewer, T.L.; Watanabe, I.-S.; et al. Genotoxicity, potential cytotoxicity and cell uptake of titanium dioxide nanoparticles in the marine fish Trachinotus carolinus (Linnaeus, 1766). Aquat. Toxicol. 2015, 158, 218–222. [Google Scholar] [CrossRef] [PubMed]
Parameters | Experimental Groups | ||||||
---|---|---|---|---|---|---|---|
Control | AgNP 0.01 | AgNP 0.05 | AgNP 0.1 | AgNP 0.5 | AgNP 1.0 | AgNO3 0.01 | |
Percentage of micronuclei (%) | 0 ± 0 | 0 ± 0 | 0 ± 0 | 0 ± 0 | 0 ± 0 | 0.1 ± 0.04 | 0 ± 0 |
Percentage of segmented erythrocytes (%) | 0.15 ± 0.04 | 0.15 ± 0.04 | 0.3 ± 0.06 | 0.2 ± 0.04 | 0.45 ± 0.07 | 0.75 ± 0.08 | 0.3 ± 0.04 |
Percentage of reniform erythrocytes (%) | 0 ± 0 | 0.05 ± 0.02 | 0.05 ± 0.02 | 0 ± 0 | 0.05 ± 0.02 | 0 ± 0 | 0.05 ± 0.02 |
Gene Symbol (GenBank Accession Number) | Primer Sequence | Product Length | |
---|---|---|---|
Forward | Reverse | ||
actb (NM_131031) | CGAGCAGGAGATGGGAACC | CAACGGAAACGCTCATTGC | 102 |
b2m (NM_131163.2) | GCCTTCACCCCAGAGAAAGG | GCGGTTGGGATTTACATGTTG | 101 |
actb2 (NM_181601.5) | ACGATGGATGGGAAGACA | AAATTGCCGCACTGGTT | 94 |
gsr (NM_001020554.1) | TGTGCCAGGATCCAGTTTAGG | GCACCCCTCCTTGTCGTATG | 167 |
Cat (NM_130912.2) | CTCCTGATGTGGCCCGATAC | ATCAGGTTTTGCACCATGCG | 172 |
gpx1a (NM_001007281.2) | GCACCAGGAGAACTGCAAGAATG | CAGAGGGTGGGCGTTTTCAC | 130 |
sod1 (NM_131294.1) | TGGTGACAACACAAACGGCT | TCTCCGACGTGTCTCACACTA | 99 |
cyp1a (NM_131879.2) | GGAGCCGGTTTCGACACTAT | GTGCGATCCTTCCCGATCTT | 122 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szudrowicz, H.; Kamaszewski, M.; Adamski, A.; Skrobisz, M.; Frankowska-Łukawska, J.; Wójcik, M.; Bochenek, J.; Kawalski, K.; Martynow, J.; Bujarski, P.; et al. The Effects of Seven-Day Exposure to Silver Nanoparticles on Fertility and Homeostasis of Zebrafish (Danio rerio). Int. J. Mol. Sci. 2022, 23, 11239. https://doi.org/10.3390/ijms231911239
Szudrowicz H, Kamaszewski M, Adamski A, Skrobisz M, Frankowska-Łukawska J, Wójcik M, Bochenek J, Kawalski K, Martynow J, Bujarski P, et al. The Effects of Seven-Day Exposure to Silver Nanoparticles on Fertility and Homeostasis of Zebrafish (Danio rerio). International Journal of Molecular Sciences. 2022; 23(19):11239. https://doi.org/10.3390/ijms231911239
Chicago/Turabian StyleSzudrowicz, Hubert, Maciej Kamaszewski, Antoni Adamski, Marek Skrobisz, Justyna Frankowska-Łukawska, Maciej Wójcik, Joanna Bochenek, Kacper Kawalski, Jakub Martynow, Patryk Bujarski, and et al. 2022. "The Effects of Seven-Day Exposure to Silver Nanoparticles on Fertility and Homeostasis of Zebrafish (Danio rerio)" International Journal of Molecular Sciences 23, no. 19: 11239. https://doi.org/10.3390/ijms231911239