Gene Expression Landscape of Chronic Myeloid Leukemia K562 Cells Overexpressing the Tumor Suppressor Gene PTPRG
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines
2.2. Quantitative Real-Time Polymerase Chain Reaction
2.3. Flow Cytometry Analysis
2.4. Data Collection
- The effect of the PTPRG expression and its activation status;
- The impact of PTPRG expression (both active and inactive) in the presence of TKI, hereafter called by its clinical name Imatinib;
- The effect of Imatinib in combination with functional or mutant PTPRG expression.
2.5. Computational Analysis
2.5.1. Differential Gene Expression Analysis
2.5.2. Gene Ontology Enrichment Analysis of DEGs
- 1.
- The methods compute the significance of a node independently from its neighboring nodes [31]. This means that if a GO term contains the same genes as one of its children, then the traditional method gives the children the same score. While this setting could cause data redundancy, by not discarding any GO term based on parent–child relationships, it allows for keeping valuable information that can be exploited later on to investigate associations and dependencies between GO terms.
- 2.
- The Kolmogorov–Smirnov statistic computes enrichment based on gene scores [29]. Hence, it is possible to take full advantage of the information obtained by DEA by ranking genes according to their adjusted p-values.
- 1.
- GSEA
- Ranked list of significant GO terms.
- 2.
- Data cleaning
- The text is converted to lower case.
- Unnecessary white spaces, common stop words, and punctuation are removed from the text.
- 3.
- Term document matrix
- Each GO term is chunked into a single word.
- Each word is ranked based on the p-value of the GO term it belongs to. The rank is called order.
- Word significance for a given chunk is defined as the sum of the reciprocals of the respective orders retrieved by running down the whole list.
- Repeated chunks are removed, and the final list, i.e., the term document matrix, is sorted based on word significance.
- 4.
- Visual representation
- The word cloud is displayed.
- Correlation analysis between chunks is performed for the first top 10 words of the list.
- The results are shown in a bubble plot.
- 1.
- To compare the informative content of the labels to optimize the identification of genes relevant to CML. More generic and high-level labels were discarded in favor of more CML-specific ones.
- 2.
- To extend the analysis from TF-DEGs to their partners in the gene networks to gain biological insights on gene–gene interactions and better understand the impact of the treatment on the network topology.
3. Results
Validation
4. Identification of Molecular Pathways
4.1. Automated GSEA-Based Semantic Analysis
- In the first case, it appears as a small-sized chunk among other terms that are in all likelihood connected to CML;
- In the second case, it is represented as a middle-sized chunk among terms that seem quite distant from the target.
4.2. Final Expert-Curated GO Terms Selection
5. Discussion
- Method 1:
- -
- Up-regulated TF-DEGs: MECP2, NR2E1, RARG;
- -
- Down-regulated TF-DEGs: ZBTB16, TFAP2C, SOX5, SMAD1, LHX2, IKZF3, IFI16, EPAS1, BATF3, BACH2;
- Method 2:
- -
- Up-regulated TF-DEGs: MECP2, NR2E1, RARG;
- -
- Down-regulated TF-DEGs: ZBTB16, TRPS1, SOX5, SMAD1, IKZF3, IFI16, EPAS1, BATF3, BACH2.
- Control of gene expression (one-way relationship): we analyzed all the genes in control or controlled by TF-DEGs in terms of expression levels.
- Interaction between genes (two-way relationship): we analyzed all the genes that chemically interact with TF-DEGs.
6. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| DEG | Differential Expression Gene |
| TF-DEG | Transcription Factor Differential Expressed Gene |
| DEA | Differential Expression Analysis |
| GSEA | Gene Set Enrichment Analysis |
| GO | Gene Ontology |
| OPB | Ontology of Physics for Biology |
| CML | Chronic Myeloid Leukemia |
| IMA | Imatinib |
| Ct | Cycle threshold |
| RT-PCR | Real Time Polymerase Chain reaction |
| TSG | Tumor Suppressor Gene |
References
- Cortes, J.; Pavlovsky, C.; Saußele, S. Chronic myeloid leukaemia. The Lancet 2021, 398, 1914–1926. [Google Scholar] [CrossRef]
- Hanfstein, B.; Müller, M.C.; Hochhaus, A. Response-related predictors of survival in CML. Ann. Hematol. 2015, 94, 227–239. [Google Scholar] [CrossRef] [PubMed]
- Julien, S.G.; Dubé, N.; Hardy, S.; Tremblay, M.L. Inside the human cancer tyrosine phosphatome. Nat. Rev. Cancer 2010, 11, 35–49. [Google Scholar] [CrossRef] [PubMed]
- Chereda, B.; Melo, J.V. Natural course and biology of CML. Ann. Hematol. 2015, 94, 107–121. [Google Scholar] [CrossRef] [PubMed]
- Lecca, P.; Sorio, C. Accurate prediction of the age incidence of chronic myeloid leukemia with an improved two-mutation mathematical model. Integr. Biol. 2016, 8, 1261–1275. [Google Scholar] [CrossRef]
- Boni, C.; Sorio, C. Current Views on the Interplay between Tyrosine Kinases and Phosphatases in Chronic Myeloid Leukemia. Cancers 2021, 13, 2311. [Google Scholar] [CrossRef]
- Barnea, G.; Silvennoinen, O.; Shaanan, B.; Honegger, A.M.; Canoll, P.D.; D’Eustachio, P.; Morse, B.; Levy, J.B.; Laforgia, S.; Huebner, K. Identification of a carbonic anhydrase-like domain in the extracellular region of RPTP gamma defines a new subfamily of receptor tyrosine phosphatases. Mol. Cell. Biol. 1993, 13, 1497–1506. [Google Scholar] [CrossRef][Green Version]
- Vezzalini, M.; Mombello, A.; Menestrina, F.; Mafficini, A.; Peruta, M.D.; van Niekerk, C.; Barbareschi, M.; Scarpa, A.; Sorio, C. Expression of transmembrane protein tyrosine phosphatase gamma (PTPγ) in normal and neoplastic human tissues. Histopathology 2007, 50, 615–628. [Google Scholar] [CrossRef]
- Wang, Z. Mutational Analysis of the Tyrosine Phosphatome in colourectal Cancers. Science 2004, 304, 1164–1166. [Google Scholar] [CrossRef]
- Sorio, C.; Melotti, P.; D’Arcangelo, D.; Mendrola, J.; Calabretta, B.; Croce, C.M.; Huebner, K. Receptor protein tyrosine phosphatase gamma, Ptp gamma, regulates hematopoietic differentiation. Blood 1997, 90, 49–57. [Google Scholar] [CrossRef]
- Boni, C.; Sorio, C. The Role of the Tumor Suppressor Gene Protein Tyrosine Phosphatase Gamma in Cancer. Front. Cell Dev. Biol. 2022, 9, 768969. [Google Scholar] [CrossRef] [PubMed]
- Kastury, K.; Ohta, M.; Lasota, J.; Moir, D.; Dorman, T.; LaForgia, S.; Druck, T.; Huebner, K. Structure of the Human Receptor Tyrosine Phosphatase Gamma Gene (PTPRG) and Relation to the Familial RCC t(3-8) Chromosome Translocation. Genomics 1996, 32, 225–235. [Google Scholar] [CrossRef]
- van Niekerk, C.C.; Poels, L.G. Reduced expression of protein tyrosine phosphatase gamma in lung and ovarian tumors. Cancer Lett. 1999, 137, 61–73. [Google Scholar] [CrossRef]
- Galvan, A.; Colombo, F.; Frullanti, E.; Dassano, A.; Noci, S.; Wang, Y.; Eisen, T.; Matakidou, A.; Tomasello, L.; Vezzalini, M.; et al. Germline polymorphisms and survival of lung adenocarcinoma patients: A genome-wide study in two European patient series. Int. J. Cancer 2014, 136, E262–E271. [Google Scholar] [CrossRef] [PubMed]
- Drube, J.; Ernst, T.; Pfirrmann, M.; Albert, B.V.; Drube, S.; Reich, D.; Kresinsky, A.; Halfter, K.; Sorio, C.; Fabisch, C.; et al. PTPRG and PTPRC modulate nilotinib response in chronic myeloid leukemia cells. Oncotarget 2018, 9, 9442–9455. [Google Scholar] [CrossRef]
- Ismail, M.A.; Vezzalini, M.; Morsi, H.; Abujaber, A.; Sayab, A.A.; Siveen, K.; Yassin, M.A.; Monne, M.; Samara, M.; Cook, R.; et al. Predictive value of tyrosine phosphatase receptor gamma for the response to treatment tyrosine kinase inhibitors in chronic myeloid leukemia patients. Sci. Rep. 2021, 11, 8833. [Google Scholar] [CrossRef]
- Ismail, M.A.; Nasrallah, G.K.; Monne, M.; AlSayab, A.; Yassin, M.A.; Varadharaj, G.; Younes, S.; Sorio, C.; Cook, R.; Modjtahedi, H.; et al. Description of PTPRG genetic variants identified in a cohort of Chronic Myeloid Leukemia patients and their ability to influence response to Tyrosine kinase Inhibitors. Gene 2022, 813, 146101. [Google Scholar] [CrossRef]
- Peruta, M.D.; Martinelli, G.; Moratti, E.; Pintani, D.; Vezzalini, M.; Mafficini, A.; Grafone, T.; Iacobucci, I.; Soverini, S.; Murineddu, M.; et al. Protein Tyrosine Phosphatase Receptor Type γ Is a Functional Tumor Suppressor Gene Specifically Downregulated in Chronic Myeloid Leukemia. Cancer Res. 2010, 70, 8896–8906. [Google Scholar] [CrossRef]
- Stevenson, W.S.; Best, O.G.; Przybylla, A.; Chen, Q.; Singh, N.; Koleth, M.; Pierce, S.; Kennedy, T.; Tong, W.; Kuang, S.Q.; et al. DNA methylation of membrane-bound tyrosine phosphatase genes in acute lymphoblastic leukaemia. Leukemia 2013, 28, 787–793. [Google Scholar] [CrossRef]
- Ismail, M.A.; Samara, M.; Sayab, A.A.; Alsharshani, M.; Yassin, M.A.; Varadharaj, G.; Vezzalini, M.; Tomasello, L.; Monne, M.; Morsi, H.; et al. Aberrant DNA methylation of PTPRG as one possible mechanism of its under-expression in CML patients in the State of Qatar. Mol. Genet. Genom. Med. 2020, 8, e1319. [Google Scholar] [CrossRef]
- Tomasello, L.; Vezzalini, M.; Boni, C.; Bonifacio, M.; Scaffidi, L.; Yassin, M.; Al-Dewik, N.; Kamga, P.T.; Krampera, M.; Sorio, C. Regulative Loop between β-catenin and Protein Tyrosine Receptor Type γ in Chronic Myeloid Leukemia. Int. J. Mol. Sci. 2020, 21, 2298. [Google Scholar] [CrossRef]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [PubMed]
- Dotmatics. GraphPad Prism. Available online: https://www.graphpad.com/ (accessed on 1 January 2021).
- Miltenyi Biotec. MACSQuant Analyzer 10 Flow Cytometer from Miltenyi Biotec. Available online: https://www.miltenyibiotec.com/IT-en/products/macsquant-analyzer-10.html (accessed on 1 June 2022).
- BD. FLOWJO. Available online: https://www.flowjo.com/ (accessed on 1 June 2022).
- Agilent. SurePrint Technology. Available online: https://www.miltenyibiotec.com/IT-en/products/macsquant-analyzer-10.html (accessed on 1 June 2022).
- Prange, K.H.; Singh, A.A.; Martens, J.H. The genome-wide molecular signature of transcription factors in leukemia. Exp. Hematol. 2014, 42, 637–650. [Google Scholar] [CrossRef] [PubMed]
- Draghici, S. Statistics and Data Analysis for Microarrays Using R and Bioconductor; Chapman and Hall/CRC: London, UK, 2016. [Google Scholar] [CrossRef]
- Gene Ontology Homepage. Available online: http://geneontology.org/ (accessed on 10 May 2021).
- Adrian Alexa, J.R. topGO. 2017. Available online: https://bioconductor.org/packages/release/bioc/html/topGO.html (accessed on 10 May 2021).
- Alexa, A.; Rahnenfuhrer, J.; Lengauer, T. Improved scoring of functional groups from gene expression data by decorrelating GO graph structure. Bioinformatics 2006, 22, 1600–1607. [Google Scholar] [CrossRef] [PubMed]
- R Wordcloud Package. Available online: https://CRAN.R-project.org/package=wordcloud (accessed on 10 May 2021).
- R Text Mining Package. Available online: https://cran.r-project.org/web/packages/tm (accessed on 10 May 2021).
- Walkley, C.R.; Olsen, G.H.; Dworkin, S.; Fabb, S.A.; Swann, J.; McArthur, G.A.; Westmoreland, S.V.; Chambon, P.; Scadden, D.T.; Purton, L.E. A Microenvironment-Induced Myeloproliferative Syndrome Caused by Retinoic Acid Receptor γ Deficiency. Cell 2007, 129, 1097–1110. [Google Scholar] [CrossRef]
- Dewamitta, S.R.; Joseph, C.; Purton, L.E.; Walkley, C.R. Erythroid-extrinsic regulation of normal erythropoiesis by retinoic acid receptors. Br. J. Haematol. 2013, 164, 280–285. [Google Scholar] [CrossRef]
- Mao, B.; Huang, S.; Lu, X.; Sun, W.; Zhou, Y.; Pan, X.; Yu, J.; Lai, M.; Chen, B.; Zhou, Q.; et al. Early Development of Definitive Erythroblasts from Human Pluripotent Stem Cells Defined by Expression of Glycophorin A/CD235a, CD34, and CD36. Stem Cell Rep. 2016, 7, 869–883. [Google Scholar] [CrossRef]
- Neff, T.; Armstrong, S.A. Chromatin maps, histone modifications and leukemia. Leukemia 2009, 23, 1243–1251. [Google Scholar] [CrossRef]
- Lodewick, J.; Lamsoul, I.; Polania, A.; Lebrun, S.; Burny, A.; Ratner, L.; Bex, F. Acetylation of the human T-cell leukemia virus type 1 Tax oncoprotein by p300 promotes activation of the NF-κB pathway. Virology 2009, 386, 68–78. [Google Scholar] [CrossRef]
- Shi, Y.; Tomic, J.; Wen, F.; Shaha, S.; Bahlo, A.; Harrison, R.; Dennis, J.W.; Williams, R.; Gross, B.J.; Walker, S.; et al. Aberrant O-GlcNAcylation characterizes chronic lymphocytic leukemia. Leukemia 2010, 24, 1588–1598. [Google Scholar] [CrossRef]
- Ni, F.; Yu, W.M.; Li, Z.; Graham, D.K.; Jin, L.; Kang, S.; Rossi, M.R.; Li, S.; Broxmeyer, H.E.; Qu, C.K. Critical role of ASCT2-mediated amino acid metabolism in promoting leukaemia development and progression. Nat. Metab. 2019, 1, 390–403. [Google Scholar] [CrossRef] [PubMed]
- Sell, S. Leukemia: Stem Cells, Maturation Arrest, and Differentiation Therapy. Stem Cell Rev. 2005, 1, 197–206. [Google Scholar] [CrossRef]
- Mineo, M.; Garfield, S.H.; Taverna, S.; Flugy, A.; Leo, G.D.; Alessandro, R.; Kohn, E.C. Exosomes released by K562 chronic myeloid leukemia cells promote angiogenesis in a src-dependent fashion. Angiogenesis 2011, 15, 33–45. [Google Scholar] [CrossRef] [PubMed]
- Lamalice, L.; Boeuf, F.L.; Huot, J. Endothelial Cell Migration During Angiogenesis. Circ. Res. 2007, 100, 782–794. [Google Scholar] [CrossRef] [PubMed]
- Gowda, C.; Song, C.; Ding, Y.; Iyer, S.; Dhanyamraju, P.K.; McGrath, M.; Bamme, Y.; Soliman, M.; Kane, S.; Payne, J.L.; et al. Cellular signaling and epigenetic regulation of gene expression in leukemia. Adv. Biol. Regul. 2020, 75, 100665. [Google Scholar] [CrossRef]
- Kato, R.; Kiryu-Seo, S.; Kiyama, H. Damage-Induced Neuronal Endopeptidase (DINE/ECEL) Expression Is Regulated by Leukemia Inhibitory Factor and Deprivation of Nerve Growth Factor in Rat Sensory Ganglia after Nerve Injury. J. Neurosci. 2002, 22, 9410–9418. [Google Scholar] [CrossRef]
- Gaspar, B.L.; Sharma, P.; Varma, N.; Sukhachev, D.; Bihana, I.; Naseem, S.; Malhotra, P.; Varma, S. Unique characteristics of leukocyte volume, conductivity and scatter in chronic myeloid leukemia. Biomed. J. 2019, 42, 93–98. [Google Scholar] [CrossRef]
- Li, J.; Dong, S. The Signaling Pathways Involved in Chondrocyte Differentiation and Hypertrophic Differentiation. Stem Cells Int. 2016, 2016, 2470351. [Google Scholar] [CrossRef]
- Koníková, E.; Kusenda, J. P53 protein expression in human leukemia and lymphoma cells. Neoplasma 2001, 48, 290–298. [Google Scholar]
- Petzer, A.L.; Gunsilius, E. Hematopoietic stem cells in chronic myeloid leukemia. Arch. Med. Res. 2003, 34, 496–506. [Google Scholar] [CrossRef]
- McCubrey, J.; May, W.S.; Duronio, V.; Mufson, A. Serine/threonine phosphorylation in cytokine signal transduction. Leukemia 2000, 14, 9–21. [Google Scholar] [CrossRef] [PubMed]
- Powell, A.E.; Shung, C.Y.; Saylor, K.W.; Müllendorf, K.A.; Weiss, J.B.; Wong, M.H. Lessons from development: A role for asymmetric stem cell division in cancer. Stem Cell Res. 2010, 4, 3–9. [Google Scholar] [CrossRef]
- Helming, L.; Winter, J.; Gordon, S. The scavenger receptor CD36 plays a role in cytokine-induced macrophage fusion. J. Cell Sci. 2009, 122, 453–459. [Google Scholar] [CrossRef] [PubMed]
- Vezzalini, M.; Mafficini, A.; Tomasello, L.; Lorenzetto, E.; Moratti, E.; Fiorini, Z.; Holyoake, T.L.; Pellicano, F.; Krampera, M.; Tecchio, C.; et al. A new monoclonal antibody detects downregulation of protein tyrosine phosphatase receptor type γ in chronic myeloid leukemia patients. J. Hematol. Oncol. 2017, 10, 129. [Google Scholar] [CrossRef] [PubMed]
- Bard, J.B.L.; Rhee, S.Y. Ontologies in biology: Design, applications and future challenges. Nat. Rev. Genet. 2004, 5, 213–222. [Google Scholar] [CrossRef] [PubMed]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- Robinson, P. Introduction to Bio-Ontologies; CRC Press: Boca Raton, FL, USA, 2020. [Google Scholar]
- Calvanese, D.; Lanti, D.; Farias, T.M.D.; Mosca, A.; Xiao, G. Accessing scientific data through knowledge graphs with Ontop. Patterns 2021, 2, 100346. [Google Scholar] [CrossRef]
- Xiao, G.; Lanti, D.; Kontchakov, R.; Komla-Ebri, S.; Güzel-Kalaycı, E.; Ding, L.; Corman, J.; Cogrel, B.; Calvanese, D.; Botoeva, E. The Virtual Knowledge Graph System Ontop. In Lecture Notes in Computer Science; Springer International Publishing: Cham, Switzerland, 2020; pp. 259–277. [Google Scholar] [CrossRef]
- Schuurman, N.; Leszczynski, A. Ontologies for bioinformatics. Bioinf. Biol. Insights 2008, 2, 187–200. [Google Scholar] [CrossRef]
- Bodenreider, O.; Stevens, R. Bio-ontologies: Current trends and future directions. Brief Bioinf. 2006, 7, 256–274. [Google Scholar] [CrossRef]
- Cook, D.L.; Mejino, J.L.; Neal, M.L.; Gennari, J.H. Bridging biological ontologies and biosimulation: The ontology of physics for biology. AMIA Annu. Symp. Proc. 2008, 2008, 136–140. [Google Scholar]
- Ontology of Physics for Biology. Available online: https://bioportal.bioontology.org/ontologies/OPB/?p=summary (accessed on 20 March 2021).
- Cook, D.L.; Neal, M.L.; Bookstein, F.L.; Gennari, J.H. Ontology of physics for biology: Representing physical dependencies as a basis for biological processes. J. Biomed. Semant. 2013, 4, 41. [Google Scholar] [CrossRef] [PubMed]
- BioPAX Homepage. Available online: http://www.biopax.org/ (accessed on 14 June 2021).
- Pathway Commons Homepage. Available online: http://www.pathwaycommons.org/ (accessed on 14 June 2021).
- Damiani, C.; Filisetti, A.; Graudenzi, A.; Lecca, P. Parameter sensitivity analysis of stochastic models: Application to catalytic reaction networks. Comput. Biol. Chem. 2013, 42, 5–17. [Google Scholar] [CrossRef] [PubMed]
- Lecca, P.; Palmisano, A.; Priami, C.; Sanguinetti, G. A new probabilistic generative model of parameter inference in biochemical networks. In Proceedings of the 2009 ACM Symposium on Applied Computing—SAC ’09, Honolulu, HI, USA, 9–12 March 2009; pp. 758–765. [Google Scholar] [CrossRef]
- Lecca, P. A time-dependent extension of Gillespie algorithm for biochemical stochastic π-calculus. In Proceedings of the 2006 ACM Symposium on Applied Computing—SAC ’06, Dijon, France, 23–27 April 2006; pp. 137–144. [Google Scholar] [CrossRef]

















| Gene | Forward 5–3 | Reverse 5–3 |
|---|---|---|
| MECP2 | CGTGAAGGAGTCTTCTATCCGA | GCTTCACCACTTCCTTGACC |
| TFAP2C | ATTCGCAAAGGTCCCATTTCC | GGCATTTAAGCATTCAGGTGG |
| RARG | GCAAGTATACCACGAACTCCAG | ACGCAGCATCAGGATATCTAGG |
| TRPS1 | CAAACAAGAAGCAAATCACCTG | GTGTGCTCTCCTGTAGTGTC |
| SMAD1 | TCCTTCCAACAATAAGAACCGT | CTACTGTCACTAAGGCATTCG |
| CD36 | TTTGGCTTAATGAGACTGGGAC | ACAAACATCACCACACCAACAC |
| Chunk | References | GO ID |
|---|---|---|
| chromatin | [37] | GO:0016569, GO:0034401, GO:0097549, |
| GO:1905269, GO:0006342 | ||
| acetylation | [38] | GO:0006473, GO:0006475, GO:0018393, |
| GO:0016573, GO:0018394 | ||
| acylation | [39] | GO:0043543 |
| amino acid | [40] | GO:0018193 |
| cell growth | GO:0016049 | |
| myeloid cell | [41] | GO:0045637 |
| differentiation | ||
| angiogenesis | [42] | GO:0090049 |
| Process | References | GO ID |
|---|---|---|
| regulation of myeloid | [41] | GO:0045637 |
| cell differentiation | ||
| regulation of blood vessel | [43] | GO:0043535 |
| endothelial cell migration |
| Process | References | GO ID |
|---|---|---|
| growth | GO:00071559, GO:0071560 | |
| differentiation | [41] | GO:0046637, GO:0006475, GO:0018393, |
| GO:0016573, GO:0046632 | ||
| immune | GO:0002376, GO:0002253 | |
| kinase | [41] | GO:0007178 |
| epigenetic | [44] | GO:0040029 |
| endopeptidase | [45] | GO:2000117 |
| cell population | GO:0045637 |
| Process | References | GO ID |
|---|---|---|
| leukocyte | [46] | GO:0002521, GO:1902105, GO:0045321, |
| GO:0002573 | ||
| immune | GO:0002376, GO:0006955, GO:0002520, | |
| GO:0002550 | ||
| chondrocyte | [47] | GO:0002062, GO:0032330 |
| p53 | [48] | GO:0072331 |
| myeloid | [41] | GO:0030099, GO:0002573 |
| growth | GO:0071560, GO:0071559 | |
| differentiation | [41] | GO:0002521, GO:1902105, GO:0030099, |
| GO:0002573, GO:0032330 | ||
| hemopoiesis | [49] | GO:0030097 |
| hematopoietic | [49] | GO:0048534 |
| cytokine | [50] | GO:0001816, GO:0001817 |
| phosphorylation | [50] | GO:0006468 |
| stem | [51] | GO:0098722, GO:0008356 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lombardi, G.; Latorre, R.V.; Mosca, A.; Calvanese, D.; Tomasello, L.; Boni, C.; Ferracin, M.; Negrini, M.; Dewik, N.A.; Yassin, M.; et al. Gene Expression Landscape of Chronic Myeloid Leukemia K562 Cells Overexpressing the Tumor Suppressor Gene PTPRG. Int. J. Mol. Sci. 2022, 23, 9899. https://doi.org/10.3390/ijms23179899
Lombardi G, Latorre RV, Mosca A, Calvanese D, Tomasello L, Boni C, Ferracin M, Negrini M, Dewik NA, Yassin M, et al. Gene Expression Landscape of Chronic Myeloid Leukemia K562 Cells Overexpressing the Tumor Suppressor Gene PTPRG. International Journal of Molecular Sciences. 2022; 23(17):9899. https://doi.org/10.3390/ijms23179899
Chicago/Turabian StyleLombardi, Giulia, Roberta Valeria Latorre, Alessandro Mosca, Diego Calvanese, Luisa Tomasello, Christian Boni, Manuela Ferracin, Massimo Negrini, Nader Al Dewik, Mohamed Yassin, and et al. 2022. "Gene Expression Landscape of Chronic Myeloid Leukemia K562 Cells Overexpressing the Tumor Suppressor Gene PTPRG" International Journal of Molecular Sciences 23, no. 17: 9899. https://doi.org/10.3390/ijms23179899
APA StyleLombardi, G., Latorre, R. V., Mosca, A., Calvanese, D., Tomasello, L., Boni, C., Ferracin, M., Negrini, M., Dewik, N. A., Yassin, M., Ismail, M. A., Carpentieri, B., Sorio, C., & Lecca, P. (2022). Gene Expression Landscape of Chronic Myeloid Leukemia K562 Cells Overexpressing the Tumor Suppressor Gene PTPRG. International Journal of Molecular Sciences, 23(17), 9899. https://doi.org/10.3390/ijms23179899

