Early Changes in Transcriptomic Profiles in Synaptodendrosomes Reveal Aberrant Synaptic Functions in Alzheimer’s Disease
Abstract
:1. Introduction
2. Results
2.1. Transcriptomic Profiling of Synaptodendrosomes in Alzheimer’s Disease Mice
2.2. Changes in the Transcriptomic Profiles of Synaptodendrosomes in Alzheimer’s Disease Mice
2.3. Functional Diversity of Synaptodendrosomes-Localized mRNAs in Alzheimer’s Disease
2.4. Alzheimer’s Disease-Associated Transcript Changes Reveal Dysregulated Synaptic Molecular Pathways in Synaptodendrosomes
2.5. Reduced Expression of Cox6c, Cst3, or Prnp Alters Dendritic and Synaptic Morphology in Neurons
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Purification of Synaptodendrosomes
4.3. RNA Extraction and High-Throughput Sequencing
4.4. Data Analysis
4.5. Quantitative Real-Time PCR
4.6. Western Blotting
4.7. Short Hairpin RNA Construction
4.8. Primary Neuron Culture and Cell Transfection
4.9. Confocal Imaging and Morphological Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
AD | Alzheimer’s disease |
DEGs | differentially expressed genes |
GO | Gene Ontology |
Aβ | amyloid beta |
p-tau | hyperphosphorylated tau |
NFTs | neurofibrillary tangles |
RNA-seq | RNA sequencing |
WT | wild-type |
PrPs | protease-resistant proteins |
HOM | homogenate |
PPI | protein–protein interaction |
SD | Sprague Dawley |
qRT-PCR | quantitative real-time PCR |
DIV | days in vitro |
3D | three-dimensional |
GAPDH | glyceraldehyd-3-phosphat-dehydrogenase |
References
- Mathys, H.; Davila-Velderrain, J.; Peng, Z.; Gao, F.; Mohammadi, S.; Young, J.Z.; Menon, M.; He, L.; Abdurrob, F.; Jiang, X.; et al. Single-cell transcriptomic analysis of Alzheimer’s disease. Nature 2019, 570, 332–337. [Google Scholar] [CrossRef] [PubMed]
- Terry, R.D.; Masliah, E.; Salmon, D.P.; Butters, N.; DeTeresa, R.; Hill, R.; Hansen, L.A.; Katzman, R. Physical basis of cognitive alterations in Alzheimer’s disease: Synapse loss is the major correlate of cognitive impairment. Ann. Neurol. 1991, 30, 572–580. [Google Scholar] [CrossRef] [PubMed]
- Heller, G.T.; Aprile, F.A.; Michaels, T.C.T.; Limbocker, R.; Perni, M.; Ruggeri, F.S.; Mannini, B.; Löhr, T.; Bonomi, M.; Camilloni, C.; et al. Small-molecule sequestration of amyloid-β as a drug discovery strategy for Alzheimer’s disease. Sci. Adv. 2020, 6, eabb5924. [Google Scholar] [CrossRef] [PubMed]
- Hardy, J.; Selkoe, D.J. The amyloid hypothesis of Alzheimer’s disease: Progress and problems on the road to therapeutics. Science 2002, 297, 353–356. [Google Scholar] [CrossRef]
- DeKosky, S.T.; Scheff, S.W. Synapse loss in frontal cortex biopsies in Alzheimer’s disease: Correlation with cognitive severity. Ann. Neurol. 1990, 27, 457–464. [Google Scholar] [CrossRef]
- D’Amelio, M.; Cavallucci, V.; Middei, S.; Marchetti, C.; Pacioni, S.; Ferri, A.; Diamantini, A.; De Zio, D.; Carrara, P.; Battistini, L.; et al. Caspase-3 triggers early synaptic dysfunction in a mouse model of Alzheimer’s disease. Nat. Neurosci. 2011, 14, 69–76. [Google Scholar] [CrossRef] [PubMed]
- Park, G.; Nhan, H.S.; Tyan, S.-H.; Kawakatsu, Y.; Zhang, C.; Navarro, M.; Koo, E.H. Caspase Activation and Caspase-Mediated Cleavage of APP Is Associated with Amyloid β-Protein-Induced Synapse Loss in Alzheimer’s Disease. Cell Rep. 2020, 31, 107839. [Google Scholar] [CrossRef]
- Dejanovic, B.; Huntley, M.A.; De Mazière, A.; Meilandt, W.J.; Wu, T.; Srinivasan, K.; Jiang, Z.; Gandham, V.; Friedman, B.A.; Ngu, H.; et al. Changes in the Synaptic Proteome in Tauopathy and Rescue of Tau-Induced Synapse Loss by C1q Antibodies. Neuron 2018, 100, 1322–1336.e7. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Tian, J.; Du, H. Mitochondrial Dysfunction and Synaptic Transmission Failure in Alzheimer’s Disease. J. Alzheimers Dis. JAD 2017, 57, 1071–1086. [Google Scholar] [CrossRef]
- St Johnston, D. Moving messages: The intracellular localization of mRNAs. Nat. Rev. Mol. Cell Biol. 2005, 6, 363–375. [Google Scholar] [CrossRef]
- Yoon, Y.J.; Wu, B.; Buxbaum, A.R.; Das, S.; Tsai, A.; English, B.P.; Grimm, J.B.; Lavis, L.D.; Singer, R.H. Glutamate-induced RNA localization and translation in neurons. Proc. Natl. Acad. Sci. USA 2016, 113, E6877–E6886. [Google Scholar] [CrossRef] [PubMed]
- Lécuyer, E.; Yoshida, H.; Parthasarathy, N.; Alm, C.; Babak, T.; Cerovina, T.; Hughes, T.R.; Tomancak, P.; Krause, H.M. Global Analysis of mRNA Localization Reveals a Prominent Role in Organizing Cellular Architecture and Function. Cell 2007, 131, 174–187. [Google Scholar] [CrossRef] [PubMed]
- Mili, S.; Moissoglu, K.; Macara, I.G. Genome-wide screen reveals APC-associated RNAs enriched in cell protrusions. Nature 2008, 453, 115–119. [Google Scholar] [CrossRef] [PubMed]
- Sutton, M.A.; Schuman, E.M. Dendritic Protein Synthesis, Synaptic Plasticity, and Memory. Cell 2006, 127, 49–58. [Google Scholar] [CrossRef]
- Bassell, G.J.; Warren, S.T. Fragile X syndrome: Loss of local mRNA regulation alters synaptic development and function. Neuron 2008, 60, 201–214. [Google Scholar] [CrossRef]
- Jung, Y.; Seo, J.-Y.; Ryu, H.G.; Kim, D.-Y.; Lee, K.-H.; Kim, K.-T. BDNF-induced local translation of GluA1 is regulated by HNRNP A2/B1. Sci. Adv. 2020, 6, eabd2163. [Google Scholar] [CrossRef]
- Rao, A.; Steward, O. Evaluation of RNAs present in synaptodendrosomes: Dendritic, glial, and neuronal cell body contribution. J. Neurochem. 1993, 61, 835–844. [Google Scholar] [CrossRef]
- Merkurjev, D.; Hong, W.T.; Iida, K.; Oomoto, I.; Goldie, B.J.; Yamaguti, H.; Ohara, T.; Kawaguchi, S.Y.; Hirano, T.; Martin, K.C.; et al. Synaptic N(6)-methyladenosine (m(6)A) epitranscriptome reveals functional partitioning of localized transcripts. Nat. Neurosci. 2018, 21, 1004–1014. [Google Scholar] [CrossRef] [PubMed]
- Chipman, P.H.; Fung, C.C.A.; Pazo Fernandez, A.; Sawant, A.; Tedoldi, A.; Kawai, A.; Ghimire Gautam, S.; Kurosawa, M.; Abe, M.; Sakimura, K.; et al. Astrocyte GluN2C NMDA receptors control basal synaptic strengths of hippocampal CA1 pyramidal neurons in the stratum radiatum. Elife 2021, 10, e70818. [Google Scholar] [CrossRef]
- Bramham, C.R.; Wells, D.G. Dendritic mRNA: Transport, translation and function. Nat. Rev. Neurosci. 2007, 8, 776–789. [Google Scholar] [CrossRef]
- Kashyap, G.; Bapat, D.; Das, D.; Gowaikar, R.; Amritkar, R.E.; Rangarajan, G.; Ravindranath, V.; Ambika, G. Synapse loss and progress of Alzheimer’s disease—A network model. Sci. Rep. 2019, 9, 6555. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, S.; Tanaka, T.; Soeda, Y.; Almeida, O.F.X.; Takashima, A. Local Somatodendritic Translation and Hyperphosphorylation of Tau Protein Triggered by AMPA and NMDA Receptor Stimulation. eBioMedicine 2017, 20, 120–126. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, A.; Mizuno, K.; Tiwari, S.S.; Proitsi, P.; Gomez Perez-Nievas, B.; Glennon, E.; Martinez-Nunez, R.T.; Giese, K.P. Alzheimer’s disease-related dysregulation of mRNA translation causes key pathological features with ageing. Transl. Psychiatry 2020, 10, 192. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, F.; Liu, P. Synaptosome as a tool in Alzheimer’s disease research. Brain Res. 2020, 1746, 147009. [Google Scholar] [CrossRef] [PubMed]
- Biever, A.; Glock, C.; Tushev, G.; Ciirdaeva, E.; Dalmay, T.; Langer, J.D.; Schuman, E.M. Monosomes actively translate synaptic mRNAs in neuronal processes. Science 2020, 367, eaay4991. [Google Scholar] [CrossRef] [PubMed]
- Donlin-Asp, P.G.; Polisseni, C.; Klimek, R.; Heckel, A.; Schuman, E.M. Differential regulation of local mRNA dynamics and translation following long-term potentiation and depression. Proc. Natl. Acad. Sci. USA 2021, 118, e2017578118. [Google Scholar] [CrossRef] [PubMed]
- Perez, J.D.; Fusco, C.M.; Schuman, E.M. A Functional Dissection of the mRNA and Locally Synthesized Protein Population in Neuronal Dendrites and Axons. Annu. Rev. Genet. 2021, 55, 183–207. [Google Scholar] [CrossRef] [PubMed]
- Györffy, B.A.; Tóth, V.; Török, G.; Gulyássy, P.; Kovács, R.Á.; Vadászi, H.; Micsonai, A.; Tóth, M.E.; Sántha, M.; Homolya, L.; et al. Synaptic mitochondrial dysfunction and septin accumulation are linked to complement-mediated synapse loss in an Alzheimer’s disease animal model. Cell. Mol. Life Sci. 2020, 77, 5243–5258. [Google Scholar] [CrossRef]
- Kao, Y.H.; Chou, M.C.; Chen, C.H.; Yang, Y.H. White Matter Changes in Patients with Alzheimer’s Disease and Associated Factors. J. Clin. Med. 2019, 8, 167. [Google Scholar] [CrossRef]
- Caso, F.; Agosta, F.; Mattavelli, D.; Migliaccio, R.; Canu, E.; Magnani, G.; Marcone, A.; Copetti, M.; Falautano, M.; Comi, G.; et al. White Matter Degeneration in Atypical Alzheimer Disease. Radiology 2015, 277, 162–172. [Google Scholar] [CrossRef]
- Gauba, E.; Chen, H.; Guo, L.; Du, H. Cyclophilin D deficiency attenuates mitochondrial F1Fo ATP synthase dysfunction via OSCP in Alzheimer’s disease. Neurobiol. Dis. 2019, 121, 138–147. [Google Scholar] [CrossRef] [PubMed]
- Minhas, P.S.; Latif-Hernandez, A.; McReynolds, M.R.; Durairaj, A.S.; Wang, Q.; Rubin, A.; Joshi, A.U.; He, J.Q.; Gauba, E.; Liu, L.; et al. Restoring metabolism of myeloid cells reverses cognitive decline in ageing. Nature 2021, 590, 122–128. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Perry, G.; Smith, M.A.; Wang, X.; Perry, G.; Zhu, X.; Smith, M.A.; Sorensen, A.; Avila, J. Abnormal Mitochondrial Dynamics in the Pathogenesis of Alzheimer’s Disease. J. Alzheimers Dis. 2012, 33, S253–S262. [Google Scholar] [CrossRef] [PubMed]
- Reeve, A.K.; Grady, J.P.; Cosgrave, E.M.; Bennison, E.; Chen, C.; Hepplewhite, P.D.; Morris, C.M. Mitochondrial dysfunction within the synapses of substantia nigra neurons in Parkinson’s disease. NPJ Parkinsons Dis. 2018, 4, 9. [Google Scholar] [CrossRef] [PubMed]
- Ding, Q. Ribosome Dysfunction Is an Early Event in Alzheimer’s Disease. J. Neurosci. 2005, 25, 9171–9175. [Google Scholar] [CrossRef]
- Serrano-Pozo, A.; Frosch, M.P.; Masliah, E.; Hyman, B.T. Neuropathological alterations in Alzheimer disease. Cold Spring Harb. Perspect. Med. 2011, 1, a006189. [Google Scholar] [CrossRef] [PubMed]
- Hijazi, S.; Heistek, T.S.; Scheltens, P.; Neumann, U.; Shimshek, D.R.; Mansvelder, H.D.; Smit, A.B.; van Kesteren, R.E. Early restoration of parvalbumin interneuron activity prevents memory loss and network hyperexcitability in a mouse model of Alzheimer’s disease. Mol. Psychiatry 2019, 25, 3380–3398. [Google Scholar] [CrossRef]
- Gelman, S.; Palma, J.; Tombaugh, G.; Ghavami, A. Differences in Synaptic Dysfunction Between rTg4510 and APP/PS1 Mouse Models of Alzheimer’s Disease. J. Alzheimers Dis. 2018, 61, 195–208. [Google Scholar] [CrossRef] [PubMed]
- Bittner, T.; Burgold, S.; Dorostkar, M.M.; Fuhrmann, M.; Wegenast-Braun, B.M.; Schmidt, B.; Kretzschmar, H.; Herms, J. Amyloid plaque formation precedes dendritic spine loss. Acta Neuropathol. 2012, 124, 797–807. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; He, J.; Zhang, Y.; Luo, H.; Zhu, S.; Yang, Y.; Zhao, T.; Wu, J.; Huang, Y.; Kong, J.; et al. Increased hippocampal neurogenesis in the progressive stage of Alzheimer’s disease phenotype in an APP/PS1 double transgenic mouse model. Hippocampus 2009, 19, 1247–1253. [Google Scholar] [CrossRef] [PubMed]
- Jankowsky, J.L.; Fadale, D.J.; Anderson, J.; Xu, G.M.; Gonzales, V.; Jenkins, N.A.; Copeland, N.G.; Lee, M.K.; Younkin, L.H.; Wagner, S.L.; et al. Mutant presenilins specifically elevate the levels of the 42 residue β-amyloid peptide in vivo: Evidence for augmentation of a 42-specific γ secretase. Hum. Mol. Genet. 2004, 13, 159–170. [Google Scholar] [CrossRef] [PubMed]
- Kamphuis, W.; Mamber, C.; Moeton, M.; Kooijman, L.; Sluijs, J.A.; Jansen, A.H.; Verveer, M.; de Groot, L.R.; Smith, V.D.; Rangarajan, S.; et al. GFAP isoforms in adult mouse brain with a focus on neurogenic astrocytes and reactive astrogliosis in mouse models of Alzheimer disease. PLoS ONE 2012, 7, e42823. [Google Scholar] [CrossRef]
- Volianskis, A.; Kostner, R.; Molgaard, M.; Hass, S.; Jensen, M.S. Episodic memory deficits are not related to altered glutamatergic synaptic transmission and plasticity in the CA1 hippocampus of the APPswe/PS1deltaE9-deleted transgenic mice model of ss-amyloidosis. Neurobiol. Aging 2010, 31, 1173–1187. [Google Scholar] [CrossRef] [PubMed]
- Jadiya, P.; Kolmetzky, D.W.; Tomar, D.; Di Meco, A.; Lombardi, A.A.; Lambert, J.P.; Luongo, T.S.; Ludtmann, M.H.; Pratico, D.; and Elrod, J.W. Impaired mitochondrial calcium efflux contributes to disease progression in models of Alzheimer’s disease. Nat. Commun. 2019, 10, 3885. [Google Scholar] [CrossRef] [PubMed]
- Calvo-Rodriguez, M.; Hou, S.S.; Snyder, A.C.; Kharitonova, E.K.; Russ, A.N.; Das, S.; Fan, Z.; Muzikansky, A.; Garcia-Alloza, M.; Serrano-Pozo, A.; et al. Increased mitochondrial calcium levels associated with neuronal death in a mouse model of Alzheimer’s disease. Nat. Commun. 2020, 11, 2146. [Google Scholar] [CrossRef] [PubMed]
- Espino de la Fuente-Munoz, C.; Rosas-Lemus, M.; Moreno-Castilla, P.; Bermudez-Rattoni, F.; Uribe-Carvajal, S.; Arias, C. Age-Dependent Decline in Synaptic Mitochondrial Function Is Exacerbated in Vulnerable Brain Regions of Female 3xTg-AD Mice. Int. J. Mol. Sci. 2020, 21, 8727. [Google Scholar] [CrossRef]
- Li, Z.; Okamoto, K.; Hayashi, Y.; Sheng, M. The importance of dendritic mitochondria in the morphogenesis and plasticity of spines and synapses. Cell 2004, 119, 873–887. [Google Scholar] [CrossRef] [PubMed]
- John, A.; Reddy, P.H. Synaptic basis of Alzheimer’s disease: Focus on synaptic amyloid beta, P-tau and mitochondria. Ageing Res. Rev. 2021, 65, 101208. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.; Yang, W.; Cheng, G.; Zhou, X.; Yang, L.; Zhao, D. Prion protein is essential for the RE1 silencing transcription factor (REST)-dependent developmental switch in synaptic NMDA receptors. Cell Death Dis. 2018, 9, 541. [Google Scholar] [CrossRef] [PubMed]
- Mi, W.; Pawlik, M.; Sastre, M.; Jung, S.S.; Radvinsky, D.S.; Klein, A.M.; Sommer, J.; Schmidt, S.D.; Nixon, R.A.; Mathews, P.M.; et al. Cystatin C inhibits amyloid-β deposition in Alzheimer’s disease mouse models. Nat. Genet. 2007, 39, 1440–1442. [Google Scholar] [CrossRef]
- Tian, B.X.; Sun, W.; Wang, S.H.; Liu, P.J.; Wang, Y.C. Differential expression and clinical significance of COX6C in human diseases. Am. J. Transl. Res. 2021, 13, 1–10. [Google Scholar] [PubMed]
- Herms, J.; Tings, T.; Gall, S.; Madlung, A.; Giese, A.; Siebert, H.; Schurmann, P.; Windl, O.; Brose, N.; Kretzschmar, H. Evidence of presynaptic location and function of the prion protein. J. Neurosci. 1999, 19, 8866–8875. [Google Scholar] [CrossRef] [PubMed]
- Corbett, G.T.; Wang, Z.; Hong, W.; Colom-Cadena, M.; Rose, J.; Liao, M.; Asfaw, A.; Hall, T.C.; Ding, L.; DeSousa, A.; et al. PrP is a central player in toxicity mediated by soluble aggregates of neurodegeneration-causing proteins. Acta Neuropathol. 2020, 139, 503–526. [Google Scholar] [CrossRef] [PubMed]
- Um, J.W.; Nygaard, H.B.; Heiss, J.K.; Kostylev, M.A.; Stagi, M.; Vortmeyer, A.; Wisniewski, T.; Gunther, E.C.; Strittmatter, S.M. Alzheimer amyloid-beta oligomer bound to postsynaptic prion protein activates Fyn to impair neurons. Nat. Neurosci. 2012, 15, 1227–1235. [Google Scholar] [CrossRef]
- Zou, W.Q.; Xiao, X.; Yuan, J.; Puoti, G.; Fujioka, H.; Wang, X.; Richardson, S.; Zhou, X.; Zou, R.; Li, S.; et al. Amyloid-beta42 interacts mainly with insoluble prion protein in the Alzheimer brain. J. Biol. Chem. 2011, 286, 15095–15105. [Google Scholar] [CrossRef] [PubMed]
- Lauren, J.; Gimbel, D.A.; Nygaard, H.B.; Gilbert, J.W.; Strittmatter, S.M. Cellular prion protein mediates impairment of synaptic plasticity by amyloid-beta oligomers. Nature 2009, 457, 1128–1132. [Google Scholar] [CrossRef]
- Dohler, F.; Sepulveda-Falla, D.; Krasemann, S.; Altmeppen, H.; Schluter, H.; Hildebrand, D.; Zerr, I.; Matschke, J.; Glatzel, M. High molecular mass assemblies of amyloid-beta oligomers bind prion protein in patients with Alzheimer’s disease. Brain 2014, 137, 873–886. [Google Scholar] [CrossRef]
- Haas, L.T.; Salazar, S.V.; Kostylev, M.A.; Um, J.W.; Kaufman, A.C.; Strittmatter, S.M. Metabotropic glutamate receptor 5 couples cellular prion protein to intracellular signalling in Alzheimer’s disease. Brain 2016, 139, 526–546. [Google Scholar] [CrossRef] [PubMed]
- Hu, N.W.; Nicoll, A.J.; Zhang, D.; Mably, A.J.; O’Malley, T.; Purro, S.A.; Terry, C.; Collinge, J.; Walsh, D.M.; Rowan, M.J. mGlu5 receptors and cellular prion protein mediate amyloid-beta-facilitated synaptic long-term depression in vivo. Nat. Commun. 2014, 5, 3374. [Google Scholar] [CrossRef]
- Balducci, C.; Beeg, M.; Stravalaci, M.; Bastone, A.; Sclip, A.; Biasini, E.; Tapella, L.; Colombo, L.; Manzoni, C.; Borsello, T.; et al. Synthetic amyloid-β oligomers impair long-term memory independently of cellular prion protein. Proc. Natl. Acad. Sci. USA 2010, 107, 2295–2300. [Google Scholar] [CrossRef] [PubMed]
- Hyeon, J.W.; Kim, S.Y.; Park, J.S.; Choi, B.Y.; Lee, S.M.; Ju, Y.R.; An, S.S.; Kim, C.K. The association between prion proteins and Abeta(1)(-)(4)(2) oligomers in cytotoxicity and apoptosis. Biochem. Biophys. Res. Commun. 2012, 424, 214–220. [Google Scholar] [CrossRef] [PubMed]
- Xu, K.; Wang, R.; Xie, H.; Hu, L.; Wang, C.; Xu, J.; Zhu, C.; Liu, Y.; Gao, F.; Li, X.; et al. Single-cell RNA sequencing reveals cell heterogeneity and transcriptome profile of breast cancer lymph node metastasis. Oncogenesis 2021, 10, 66. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.T.; Lee, S.J.; Kang, M.A.; Park, J.E.; Kim, B.Y.; Yoon, D.Y.; Yang, Y.; Lee, C.H.; Yeom, Y.I.; Choe, Y.K.; et al. Cystatin SN neutralizes the inhibitory effect of cystatin C on cathepsin B activity. Cell Death Dis. 2013, 4, e974. [Google Scholar] [CrossRef] [PubMed]
- Ouasti, S.; Matarrese, P.; Paddon, R.; Khosravi-Far, R.; Sorice, M.; Tinari, A.; Malorni, W.; Degli Esposti, M. Death receptor ligation triggers membrane scrambling between Golgi and mitochondria. Cell Death Differ. 2007, 14, 453–461. [Google Scholar] [CrossRef] [PubMed]
- Vinters, H.V.; Nishimura, G.S.; Secor, D.L.; Pardridge, W.M. Immunoreactive A4 and gamma-trace peptide colocalization in amyloidotic arteriolar lesions in brains of patients with Alzheimer’s disease. Am. J. Pathol. 1990, 137, 233–240. [Google Scholar] [PubMed]
- Haan, J.; Maat-Schieman, M.; Van Duinen, S.; Jensson, O.; Thorsteinsson, L.; Roos, R. Co-localization of β/A4 and cystatin C in cortical blood vessels in Dutch, but not in Icelandic hereditary cerebral hemorrhage with amyloidosis. Acta Neurol. Scand. 1994, 89, 367–371. [Google Scholar] [CrossRef]
- Mathews, P.M.; Levy, E. Cystatin C in aging and in Alzheimer’s disease. Ageing Res. Rev. 2016, 32, 38–50. [Google Scholar] [CrossRef]
- Sun, B.; Zhou, Y.; Halabisky, B.; Lo, I.; Cho, S.H.; Mueller-Steiner, S.; Devidze, N.; Wang, X.; Grubb, A.; Gan, L. Cystatin C-cathepsin B axis regulates amyloid beta levels and associated neuronal deficits in an animal model of Alzheimer’s disease. Neuron 2008, 60, 247–257. [Google Scholar] [CrossRef] [PubMed]
- Kish, S.J.; Mastrogiacomo, F.; Guttman, M.; Furukawa, Y.; Taanman, J.W.; Dozic, S.; Pandolfo, M.; Lamarche, J.; DiStefano, L.; Chang, L.J. Decreased brain protein levels of cytochrome oxidase subunits in Alzheimer’s disease and in hereditary spinocerebellar ataxia disorders: A nonspecific change? J. Neurochem. 1999, 72, 700–707. [Google Scholar] [CrossRef] [PubMed]
- Llombart, V.; Trejo, S.A.; Bronsoms, S.; Morancho, A.; Feifei, M.; Faura, J.; Garcia-Berrocoso, T.; Simats, A.; Rosell, A.; Canals, F.; et al. Profiling and identification of new proteins involved in brain ischemia using MALDI-imaging-mass-spectrometry. J. Proteom. 2017, 152, 243–253. [Google Scholar] [CrossRef] [PubMed]
- Kanhema, T.; Dagestad, G.; Panja, D.; Tiron, A.; Messaoudi, E.; Havik, B.; Ying, S.W.; Nairn, A.C.; Sonenberg, N.; Bramham, C.R. Dual regulation of translation initiation and peptide chain elongation during BDNF-induced LTP in vivo: Evidence for compartment-specific translation control. J. Neurochem. 2006, 99, 1328–1337. [Google Scholar] [CrossRef] [PubMed]
- Michaelis, M.L.; Jiang, L.; Michaelis, E.K. Isolation of Synaptosomes, Synaptic Plasma Membranes, and Synaptic Junctional Complexes. Methods Mol. Biol. 2017, 1538, 107–119. [Google Scholar] [PubMed]
- Westmark, P.R.; Westmark, C.J.; Jeevananthan, A.; Malter, J.S. Preparation of synaptoneurosomes from mouse cortex using a discontinuous percoll-sucrose density gradient. J. Vis. Exp. 2011, 17, 3196. [Google Scholar] [CrossRef] [PubMed]
- Li, H. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics 2011, 27, 2987–2993. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.-F.; Chen, C.; Fu, W.-Y.; Qu, J.Y.; Cheung, T.H.; Fu, A.K.Y.; Ip, N.Y. IL-33-PU.1 Transcriptome Reprogramming Drives Functional State Transition and Clearance Activity of Microglia in Alzheimer’s Disease. Cell Rep. 2020, 31, 107530. [Google Scholar] [CrossRef] [PubMed]
- Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K.P.; et al. STRING v10: Protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 2015, 43, D447–D452. [Google Scholar] [CrossRef] [PubMed]
- Fu, W.Y.; Chen, Y.; Sahin, M.; Zhao, X.S.; Shi, L.; Bikoff, J.B.; Lai, K.O.; Yung, W.H.; Fu, A.K.; Greenberg, M.E.; et al. Cdk5 regulates EphA4-mediated dendritic spine retraction through an ephexin1-dependent mechanism. Nat. Neurosci. 2007, 10, 67–76. [Google Scholar] [CrossRef] [PubMed]
- Sala, C.; Piech, V.; Wilson, N.R.; Passafaro, M.; Liu, G.; Sheng, M. Regulation of dendritic spine morphology and synaptic function by Shank and Homer. Neuron 2001, 31, 115–130. [Google Scholar] [CrossRef]
Target Gene | Directions | Sequences | Accession No. | Product Size |
---|---|---|---|---|
Cox6c | Forward | gggaaggacgttggtgtaga | NM_053071.2 | 111 |
Reverse | ccagcaatatgaacccgcag | |||
Cst3 | Forward | atacaggtggtgagagctcg | NM_009976.4 | 147 |
Reverse | tgccttcctcatcagatggg | |||
Prnp | Forward | accagaacaacttcgtgcac | NM_001278256.1 | 177 |
Reverse | ttctcccgtcgtaataggcc | |||
Gapdh | Forward | tcaacagcaactcccactcttcca | NM_001289726.1 | 115 |
Reverse | accctgttgctgtagccgtattca |
Target Gene | Sequence (5′->3′) |
---|---|
ShCox6c #1 | GCAGATTTCTACAGGAATT |
ShCox6c #2 | GGAATTATGACTCCATGAA |
ShCst3 #1 | GCAGCTTGTGGCTGGAATA |
ShCst3 #2 | GCCGAACTACATGTACCAA |
ShPrnp #1 | CCTGTGATCCTCCTCATCT |
ShPrnp #2 | TCCTCATCTCCTTCCTCAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qu, X.; Lin, L.; Yi, W.; Sun, C.; Chen, Y.; Chen, Y. Early Changes in Transcriptomic Profiles in Synaptodendrosomes Reveal Aberrant Synaptic Functions in Alzheimer’s Disease. Int. J. Mol. Sci. 2022, 23, 8888. https://doi.org/10.3390/ijms23168888
Qu X, Lin L, Yi W, Sun C, Chen Y, Chen Y. Early Changes in Transcriptomic Profiles in Synaptodendrosomes Reveal Aberrant Synaptic Functions in Alzheimer’s Disease. International Journal of Molecular Sciences. 2022; 23(16):8888. https://doi.org/10.3390/ijms23168888
Chicago/Turabian StyleQu, Xueqi, Li Lin, Wanying Yi, Changyu Sun, Yuewen Chen, and Yu Chen. 2022. "Early Changes in Transcriptomic Profiles in Synaptodendrosomes Reveal Aberrant Synaptic Functions in Alzheimer’s Disease" International Journal of Molecular Sciences 23, no. 16: 8888. https://doi.org/10.3390/ijms23168888
APA StyleQu, X., Lin, L., Yi, W., Sun, C., Chen, Y., & Chen, Y. (2022). Early Changes in Transcriptomic Profiles in Synaptodendrosomes Reveal Aberrant Synaptic Functions in Alzheimer’s Disease. International Journal of Molecular Sciences, 23(16), 8888. https://doi.org/10.3390/ijms23168888