CRISPR/Cas9-Mediated Targeted DNA Integration: Rearrangements at the Junction of Plant and Plasmid DNA
Abstract
:1. Introduction
2. Results
2.1. Delivery of the Genetic Constructs to the Selected Target Region of the A. thaliana Genome
2.2. Sequencing of the Junction of Plant and Transgenic DNA
2.2.1. Analysis of Line 29
2.2.2. Analysis of Line 38
2.2.3. Analysis of Line 4-1
2.2.4. Analysis of Line I1
2.2.5. Analysis of Line I6
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Plasmids Carrying Cas9 and Guide RNA
4.3. The Sources of Elements of Genetic Constructs for Knock-In
4.4. Selection of Guide RNA
4.5. Creation of Genetic Constructs for Knock-In
4.6. Biolistic Transformation of A. thaliana Cells: Obtaining Transgenic Suspension Cultures
4.7. Identification of Cell Lines with Targeted Insertion of Transgenes
4.8. Detection of Rearrangements at the Target Insertion Site of Transgenes
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Khatodia, S.; Bhatotia, K.; Passricha, N.; Khurana, S.M.P.; Tuteja, N. The CRISPR/Cas Genome-Editing Tool: Application in Improvement of Crops. Front. Plant Sci. 2016, 7, 506. [Google Scholar] [CrossRef] [Green Version]
- Demirci, Y.; Zhang, B.; Unver, T. CRISPR/Cas9: An RNA-guided highly precise synthetic tool for plant genome editing. J. Cell. Physiol. 2018, 233, 1844–1859. [Google Scholar] [CrossRef]
- Salomon, S.; Puchta, H. Capture of genomic and T-DNA sequences during double-strand break repair in somatic plant cells. EMBO J. 1998, 17, 6086–6095. [Google Scholar] [CrossRef] [PubMed]
- Maresca, M.; Lin, V.G.; Guo, N.; Yang, Y. Obligate ligation-gated recombination (ObLiGaRe): Custom-designed nuclease-mediated targeted integration through nonhomologous end joining. Genome Res. 2013, 23, 539–546. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cristea, S.; Freyvert, Y.; Santiago, Y.; Holmes, M.C.; Urnov, F.D.; Gregory, P.D.; Cost, G.J. In vivo cleavage of transgene donors promotes nuclease-mediated targeted integration. Biotechnol. Bioeng. 2013, 110, 871–880. [Google Scholar] [CrossRef] [PubMed]
- Huang, T.-K.; Puchta, H. CRISPR/Cas-mediated gene targeting in plants: Finally a turn for the better for homologous recombination. Plant Cell Rep. 2019, 38, 443–453. [Google Scholar] [CrossRef]
- Rozov, S.M.; Permyakova, N.V.; Deineko, E.V. The Problem of the Low Rates of CRISPR/Cas9-Mediated Knock-ins in Plants: Approaches and Solutions. Int. J. Mol. Sci. 2019, 20, 3371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collonnier, C.; Guyon-Debast, A.; Maclot, F.; Mara, K.; Charlot, F.; Nogué, F. Towards mastering CRISPR-induced gene knock-in in plants: Survey of key features and focus on the model Physcomitrella patens. Methods 2017, 121–122, 103–117. [Google Scholar] [CrossRef]
- Mestiri, I.; Norre, F.; Gallego, M.E.; White, C.I. Multiple host-cell recombination pathways act in Agrobacterium-mediated transformation of plant cells. Plant J. 2014, 77, 511–520. [Google Scholar] [CrossRef]
- Park, S.Y.; Vaghchhipawala, Z.; Vasudevan, B.; Lee, L.Y.; Shen, Y.; Singer, K.; Waterworth, W.M.; Zhang, Z.J.; West, C.E.; Mysore, K.S.; et al. Agrobacterium T-DNA integration into the plant genome can occur without the activity of key non-homologous end-joining proteins. Plant J. 2015, 81, 934–946. [Google Scholar] [CrossRef]
- Kleinboelting, N.; Huep, G.; Appelhagen, I.; Viehoever, P.; Li, Y.; Weisshaar, B. The Structural Features of Thousands of T-DNA Insertion Sites Are Consistent with a Double-Strand Break Repair-Based Insertion Mechanism. Mol. Plant 2015, 8, 1651–1664. [Google Scholar] [CrossRef]
- Feldmann, K.A. T-DNA insertion mutagenesis in Arabidopsis: Mutational spectrum. Plant J. 1991, 1, 71–82. [Google Scholar] [CrossRef]
- Gang, H.; Liu, G.; Zhang, M.; Zhao, Y.; Jiang, J.; Chen, S. Comprehensive characterization of T-DNA integration induced chromosomal rearrangement in a birch T-DNA mutant. BMC Genom. 2019, 20, 311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pucker, B.; Kleinbölting, N.; Weisshaar, B. Large scale genomic rearrangements in selected Arabidopsis thaliana T-DNA lines are caused by T-DNA insertion mutagenesis. BMC Genom. 2021, 22, 599. [Google Scholar] [CrossRef]
- Schiml, S.; Fauser, F.; Puchta, H. The CRISPR/Cas system can be used as nuclease for in planta gene targeting and as paired nickases for directed mutagenesis in Arabidopsis resulting in heritable progeny. Plant J. 2014, 80, 1139–1150. [Google Scholar] [CrossRef] [PubMed]
- Svitashev, S.; Young, J.K.; Schwartz, C.; Gao, H.; Falco, S.C.; Cigan, A.M. Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA. Plant Physiol. 2015, 169, 931–945. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Meng, X.; Zong, Y.; Chen, K.; Zhang, H.; Liu, J.; Li, J.; Gao, C. Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9. Nat. Plants 2016, 2, 16139. [Google Scholar] [CrossRef]
- Barone, P.; Wu, E.; Lenderts, B.; Anand, A.; Gordon-kamm, W.; Svitashev, S.; Kumar, S. Efficient Gene Targeting in Maize Using Inducible CRISPR-Cas9 and Marker-free Donor Template. Mol. Plant 2020, 13, 1219–1227. [Google Scholar] [CrossRef] [PubMed]
- Permyakova, N.V.; Marenkova, T.V.; Belavin, P.A.; Zagorskaya, A.A.; Sidorchuk, Y.V.; Uvarova, E.A.; Kuznetsov, V.V.; Rozov, S.M.; Deineko, E.V. Assessment of the Level of Accumulation of the dIFN Protein Integrated by the Knock-In Method into the Region. Cells 2021, 10, 2137. [Google Scholar] [CrossRef] [PubMed]
- Puchta, H. Double-strand break-induced recombination between ectopic homologous sequences in somatic plant cells. Genetics 1999, 152, 1173–1181. [Google Scholar] [CrossRef] [PubMed]
- Orel, N.; Kyryk, A.; Puchta, H. Different pathways of homologous recombination are used for the repair of double-strand breaks within tandemly arranged sequences in the plant genome. Plant J. 2003, 35, 604–612. [Google Scholar] [CrossRef] [PubMed]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A programmable dual-RNA—guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–822. [Google Scholar] [CrossRef] [PubMed]
- Xing, H.-L.; Dong, L.; Wang, Z.-P.; Zhang, H.-Y.; Han, C.-Y.; Liu, B.; Wang, X.-C.; Chen, Q.-J. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014, 14, 327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pramanik, D.; Shelake, R.M.; Kim, M.J.; Kim, J.Y. CRISPR-Mediated Engineering across the Central Dogma in Plant Biology for Basic Research and Crop Improvement. Mol. Plant 2021, 14, 127–150. [Google Scholar] [CrossRef]
- Huang, T.K.; Puchta, H. Novel CRISPR/Cas applications in plants: From prime editing to chromosome engineering. Transgenic Res. 2021, 30, 529–549. [Google Scholar] [CrossRef]
- Puchta, H. The repair of double-strand breaks in plants: Mechanisms and consequences for genome evolution. J. Exp. Bot. 2005, 56, 1–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mao, Y.; Botella, J.R.; Liu, Y.; Zhu, J.K. Gene editing in plants: Progress and challenges. Natl. Sci. Rev. 2019, 6, 421–437. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puchta, H.; Fauser, F. Gene targeting in plants: 25 years later. Int. J. Dev. Biol. 2013, 57, 629–637. [Google Scholar] [CrossRef] [Green Version]
- Paszkowski, J.; Baur, M.; Bogucki, A.; Potrykus, I. Gene targeting in plants. EMBO J. 1988, 7, 4021–4026. [Google Scholar] [CrossRef]
- Puchta, H. Applying CRISPR/Cas for genome engineering in plants: The best is yet to come. Curr. Opin. Plant Biol. 2017, 36, 1–8. [Google Scholar] [CrossRef]
- Li, S.; Xia, L. Precise gene replacement in plants through CRISPR/Cas genome editing technology: Current status and future perspectives. aBIOTECH 2020, 1, 58–73. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Lu, Y.; Botella, J.R.; Mao, Y.; Hua, K.; Zhu, J.K. Gene Targeting by Homology-Directed Repair in Rice Using a Geminivirus-Based CRISPR/Cas9 System. Mol. Plant 2017, 10, 1007–1010. [Google Scholar] [CrossRef] [Green Version]
- Lee, K.; Eggenberger, A.L.; Banakar, R.; McCaw, M.E.; Zhu, H.; Main, M.; Kang, M.; Gelvin, S.B.; Wang, K. CRISPR/Cas9-mediated targeted T-DNA integration in rice. Plant Mol. Biol. 2019, 99, 317–328. [Google Scholar] [CrossRef]
- Clarke, R.; Heler, R.; MacDougall, M.S.; Yeo, N.C.; Chavez, A.; Regan, M.; Hanakahi, L.; Church, G.M.; Marraffini, L.A.; Merrill, B.J. Enhanced bacterial immunity and mammalian genome editing via RNA polymerase-mediated dislodging of Cas9 from double strand DNA breaks. Mol. Cell 2018, 71, 42–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Begemann, M.B.; Gray, B.N.; January, E.; Gordon, G.C.; He, Y.; Liu, H.; Wu, X.; Brutnell, T.P.; Mockler, T.C.; Oufattole, M. Precise insertion and guided editing of higher plant genomes using Cpf1 CRISPR nucleases. Sci. Rep. 2017, 7, 11606. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puchta, H. Repair of genomic double-strand breaks in somatic plant cells by one-sided invasion of homologous sequences. Plant J. 1998, 13, 331–339. [Google Scholar] [CrossRef]
- Guirouilh-Barbat, J.; Lambert, S.; Bertrand, P.; Lopez, B.S. Is homologous recombination really an error-free process? Front. Genet. 2014, 5, 175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- So, A.; Le Guen, T.; Lopez, B.S.; Guirouilh-Barbat, J. Genomic rearrangements induced by unscheduled DNA double strand breaks in somatic mammalian cells. FEBS J. 2017, 284, 2324–2344. [Google Scholar] [CrossRef] [Green Version]
- Anand, R.P.; Tsaponina, O.; Greenwell, P.W.; Lee, C.S.; Du, W.; Petes, T.D.; Haber, J.E. Chromosome rearrangements via template switching between diverged repeated sequences. Genes Dev. 2014, 28, 2394–2406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Armstrong, C.L.; Phillips, R.L. Genetic and Cytogenetic Variation in Plants Regenerated from Organogenic and Friable, Embryogenic Tissue Cultures of Maize. Crop Sci. 1988, 28, 363–369. [Google Scholar] [CrossRef]
- Fras, A.; Maluszynska, J. Regeneration of diploid and tetraploid plants of Arabidopsis thaliana via callus. Acta Biol. Crac. Ser. Bot. 2003, 45, 145–152. [Google Scholar]
- Côte, F.X.; Teisson, C.; Perrier, X. Somaclonal variation rate evolution in plant tissue culture: Contribution to understanding through a statistical approach. Vitr. Cell. Dev. Biol. Plant 2001, 37, 539–542. [Google Scholar] [CrossRef]
- Kuznetsova, O.I.; Ash, O.A.; Gostimsky, S.A. The effect of the duration of callus culture on the accumulation of genetic alterations in pea Pisum sativum L. Russ. J. Genet. 2006, 42, 555–562. [Google Scholar] [CrossRef]
- Sedov, K.A.; Fomenkov, A.A.; Solov’yova, A.I.; Nosov, A.V.; Dolgikh, Y.I. The level of genetic variability of cells in prolonged suspension culture of Arabidopsis thaliana. Biol. Bull. 2014, 41, 493–499. [Google Scholar] [CrossRef]
- Schenk, R.U.; Hildebrandt, A.C. Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Can. J. Bot. 1972, 50, 199–204. [Google Scholar] [CrossRef]
- Michno, J.-M.; Wang, X.; Liu, J.; Curtin, S.J.; Kono, T.J.Y.; Stupar, R.M. CRISPR/Cas mutagenesis of soybean and Medicago truncatula using a new web-tool and a modified Cas9 enzyme. GM Crops Food 2015, 5698, 243–252. [Google Scholar] [CrossRef] [Green Version]
- Permyakova, N.V.; Zagorskaya, A.A.; Belavin, P.A.; Uvarova, E.A.; Nosareva, O.V.; Nesterov, A.E.; Novikovskaya, A.A.; Zav’yalov, E.L.; Moshkin, M.P.; Deineko, E.V. Transgenic Carrot Expressing Fusion Protein Comprising M. tuberculosis Antigens Induces Immune Response in Mice. BioMed Res. Int. 2015, 2015, 417565. [Google Scholar] [CrossRef] [Green Version]
- Allen, G.C.; Flores-Vergara, M.A.; Krasynanski, S.; Kumar, S.; Thompson, W.F. A modified protocol for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. Nat. Protoc. 2006, 1, 2320–2325. [Google Scholar] [CrossRef] [PubMed]



| Oligonucleotide | Oligonucleotide Sequence | |
|---|---|---|
| 1_gRNA_H Up | GATTCGGCCTAAACTAAATCCGAA | Sequence for guide RNA |
| 1_gRNA_H Lo | AAACTTCGGATTTAGTTTAGGCCG | |
| npt1 | CGACGTTGTCACTGAAGCG | nptII marker gene |
| npt2 | AAGCACGAGGAAGCGGTCAG | |
| dIFN 1 | GATGTAGCGGATAATGGAACTCTTTT | dIFN target gene |
| dIFN 2 | TGACTCCTTTTTCGCTTCCCTG | |
| Up_H3.3 | TAGGCAACGATGGTAAAGCGGATT | Testing of the left border |
| Up_H3.3_1 | AATCGCATAATCAAGAAAATCAAAACCC | |
| Lo_plan3 | AGCCGAATAGCCTCTCCACCCAA | |
| Lo10714 (D) | TCACAATCAAAAGCAATGGCGAGAA | Testing of the right border |
| Lo11187 (E) | GGTTTCAGTTTCAAGTGGGGAGAGC | |
| Lo11345 (F) | CGCATCATCATCATCACATTCGCTT | |
| UpINS9178 (A) | TGACCAGAGCATCCAAAAGAGTGTG | |
| UpINS9368 (B) | ACAGGGAAGCGAAAAAGGAGTCAGA | |
| UpINS9525 (C) | GCGATGAAGGTGATAAATGGCGAAA | |
| BclI1 | CAATGTGCCTGGATGCGTTC | |
| Bcl2 | CAACATCAAGAGCGTCATACA | |
| BclI3 | ATAAAACAACATCAAGAGCGTCA | |
| BclI4 | GGCCTTTGCAGGGCTGGCAA |
| Cell Line | Mutations Near LF | Mutations Near RF |
|---|---|---|
| Plasmid pIFN (H3.3).3 with plant flanks | ||
| 29 | Intact plant LF, 34 bp unknown DNA, 83 bp of sequence between the coding sequence of nptII and T-NOS, P-NOS with truncated first 46 bp * | Parts of P-NOS 98 and 69 bp, deletion of 4 bp of plant RF DNA |
| 38 | Intact plant LF, two additional cytosine residues | Part of GST tag from the middle of the gene, 150 and 160 bp from pIFN (H3.3).3 plasmid near RF in forward and reverse orientation interspersed with small parts of undefined plasmid DNA |
| 4-1 | Intact plant LF, insertion of 24 bp of A. thaliana DNA | 150 and 160 bp from pIFN (H3.3).3 plasmid near LF |
| Plasmid pIFN (H3.3).2 without plant flanks | ||
| I1 | Intact plant LF, insertion of 17 bp of A. thaliana DNA | Deletion of last 15 bp in GST gene, 400 bp from Cas9 gene from Cas9H33 plasmid |
| I6 | Intact plant LF, two additional cytosine residues | Addition of 2 bp (AC) after GST tag, 170 and 260 bp in forward and reverse orientation from pIFN (H3.3).3 plasmid near RF or from Cas9H33 plasmid |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Permyakova, N.V.; Marenkova, T.V.; Belavin, P.A.; Zagorskaya, A.A.; Sidorchuk, Y.V.; Deineko, E.V. CRISPR/Cas9-Mediated Targeted DNA Integration: Rearrangements at the Junction of Plant and Plasmid DNA. Int. J. Mol. Sci. 2022, 23, 8636. https://doi.org/10.3390/ijms23158636
Permyakova NV, Marenkova TV, Belavin PA, Zagorskaya AA, Sidorchuk YV, Deineko EV. CRISPR/Cas9-Mediated Targeted DNA Integration: Rearrangements at the Junction of Plant and Plasmid DNA. International Journal of Molecular Sciences. 2022; 23(15):8636. https://doi.org/10.3390/ijms23158636
Chicago/Turabian StylePermyakova, Natalya V., Tatyana V. Marenkova, Pavel A. Belavin, Alla A. Zagorskaya, Yuriy V. Sidorchuk, and Elena V. Deineko. 2022. "CRISPR/Cas9-Mediated Targeted DNA Integration: Rearrangements at the Junction of Plant and Plasmid DNA" International Journal of Molecular Sciences 23, no. 15: 8636. https://doi.org/10.3390/ijms23158636
APA StylePermyakova, N. V., Marenkova, T. V., Belavin, P. A., Zagorskaya, A. A., Sidorchuk, Y. V., & Deineko, E. V. (2022). CRISPR/Cas9-Mediated Targeted DNA Integration: Rearrangements at the Junction of Plant and Plasmid DNA. International Journal of Molecular Sciences, 23(15), 8636. https://doi.org/10.3390/ijms23158636

