lncRNA 1700101O22Rik and NONMMUG030480.1 Are Not Essential for Spermatogenesis in Mice
Abstract
:1. Introduction
2. Results
2.1. O22Rik and NM480 Were Specifically Expressed from Secondary Spermatocytes to Round Spermatids
2.2. Construction of O22Rik and NM480 KO Mice
2.3. The Deletion of O22Rik or NM480 Did Not Affect Spermatogenesis
2.4. The Deficiency of O22Rik or NM480 Did Not Disturb Sperm Motility
2.5. Deletion of O22Rik Changed Its Surrounding Gene Expressions
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Histology
4.3. RNA Extraction and Quantitate Polymerase Chain Reaction (qPCR)
4.4. Analysis of Sperm Morphology, Counts, and Motility
4.5. Spermatogenic Cell Sorting
4.6. Sperm Motility Trajectory Analysis
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Griswold, M.D. Spermatogenesis: The Commitment to Meiosis. Physiol. Rev. 2016, 96, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Nishimura, H.; L’Hernault, S.W. Spermatogenesis. Curr. Biol. 2017, 27, R988–R994. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, C.; Wang, K.; Gao, Y.; Wang, C.; Li, L.; Liao, Y.; Hu, K.; Liang, M. Roles of Noncoding RNA in Reproduction. Front. Genet. 2021, 12, 777510. [Google Scholar] [CrossRef]
- Chadourne, M.; Poumerol, E.; Jouneau, L.; Passet, B.; Castille, J.; Sellem, E.; Pailhoux, E.; Mandon-Pepin, B. Structural and Functional Characterization of a Testicular Long Non-coding RNA (4930463O16Rik) Identified in the Meiotic Arrest of the Mouse Topaz1−/− Testes. Front. Cell Dev. Biol. 2021, 9, 700290. [Google Scholar] [CrossRef] [PubMed]
- Jarroux, J.; Morillon, A.; Pinskaya, M. History, Discovery, and Classification of lncRNAs. Adv. Exp. Med. Biol. 2017, 1008, 1–46. [Google Scholar] [PubMed]
- Necsulea, A.; Soumillon, M.; Warnefors, M.; Liechti, A.; Daish, T.; Zeller, U.; Baker, J.C.; Grutzner, F.; Kaessmann, H. The evolution of lncRNA repertoires and expression patterns in tetrapods. Nature 2014, 505, 635–640. [Google Scholar] [CrossRef] [PubMed]
- Washietl, S.; Kellis, M.; Garber, M. Evolutionary dynamics and tissue specificity of human long noncoding RNAs in six mammals. Genome Res. 2014, 24, 616–628. [Google Scholar] [CrossRef] [Green Version]
- Wen, K.; Yang, L.; Xiong, T.; Di, C.; Ma, D.; Wu, M.; Xue, Z.; Zhang, X.; Long, L.; Zhang, W.; et al. Critical roles of long noncoding RNAs in Drosophila spermatogenesis. Genome Res. 2016, 26, 1233–1244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Otsuka, K.; Matsubara, S.; Shiraishi, A.; Takei, N.; Satoh, Y.; Terao, M.; Takada, S.; Kotani, T.; Satake, H.; Kimura, A.P. A Testis-Specific Long Noncoding RNA, Start, Is a Regulator of Steroidogenesis in Mouse Leydig Cells. Front. Endocrinol. 2021, 12, 665874. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.H.; Han, G.; Lee, S.J.; Cocquet, J.; Cho, C. Testicular germ cell-specific lncRNA, Teshl, is required for complete expression of Y chromosome genes and a normal offspring sex ratio. Sci. Adv. 2021, 7, eabg5177. [Google Scholar] [CrossRef]
- Yan, P.; Luo, S.; Lu, J.Y.; Shen, X. Cis- and trans-acting lncRNAs in pluripotency and reprogramming. Curr. Opin. Genet. Dev. 2017, 46, 170–178. [Google Scholar] [CrossRef] [PubMed]
- Batista, P.J.; Chang, H.Y. Long noncoding RNAs: Cellular address codes in development and disease. Cell. 2013, 152, 1298–1307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, W.; Alvarez-Dominguez, J.R.; Lodish, H.F. Regulation of mammalian cell differentiation by long non-coding RNAs. EMBO Rep. 2012, 13, 971–983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bai, Y.; Dai, X.; Harrison, A.P.; Chen, M. RNA regulatory networks in animals and plants: A long noncoding RNA perspective. Brief. Funct. Genom. 2015, 14, 91–101. [Google Scholar] [CrossRef] [Green Version]
- Gil, N.; Ulitsky, I. Regulation of gene expression by cis-acting long non-coding RNAs. Nat. Rev. Genet. 2020, 21, 102–117. [Google Scholar] [CrossRef] [PubMed]
- Andersen, R.E.; Hong, S.J.; Lim, J.J.; Cui, M.; Harpur, B.A.; Hwang, E.; Delgado, R.N.; Ramos, A.D.; Liu, S.J.; Blencowe, B.J.; et al. The Long Noncoding RNA Pnky Is a Trans-acting Regulator of Cortical Development In Vivo. Dev. Cell 2019, 49, 632–642.e7. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Qian, Z.; Ge, X.; Li, C.; Xue, M.; Liang, K.; Ma, R.; Ouyang, L.; Zheng, L.; Jing, J.; et al. LncRNA Tug1 maintains blood-testis barrier integrity by modulating Ccl2 expression in high-fat diet mice. Cell Mol. Life Sci. 2022, 79, 114. [Google Scholar] [CrossRef]
- Zhang, Y.; Jiao, L.; Sun, L.H.; Li, Y.R.; Gao, Y.Q.; Xu, C.Q.; Shao, Y.C.; Li, M.M.; Li, C.Y.; Lu, Y.J.; et al. LncRNA ZFAS1 as a SERCA2a Inhibitor to Cause Intracellular Ca2+ Overload and Contractile Dysfunction in a Mouse Model of Myocardial Infarction. Circ. Res. 2018, 122, 1354–1368. [Google Scholar] [CrossRef] [PubMed]
- Mise, S.; Matsumoto, A. Kastor and Polluks polypeptides encoded by a single gene locus cooperatively regulate VDAC and spermatogenesis. Nat. Commun. 2022, 13, 1071. [Google Scholar] [CrossRef] [PubMed]
- Capoano, C.A.; Ortiz-Laquintana, L.A.; Rodriguez-Casuriaga, R.; Schlapp, G.; Meikle, M.N.; Mulet, A.P.; Crispo, M.; Benavente, R.; Geisinger, A. SPATS1 (spermatogenesis-associated, serine-rich 1) is not essential for spermatogenesis and fertility in mouse. PLoS ONE 2021, 16, e0251028. [Google Scholar] [CrossRef] [PubMed]
- Fischer, J.M.; Dudley, S.; Miller, A.J.; Liskay, R.M. An intact Pms2 ATPase domain is not essential for male fertility. DNA Repair (Amst) 2016, 39, 46–51. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.; Zhang, X.; Xiong, S.; Zeng, X.; Zhang, X. Predicted gene 31453 (Gm31453) and the gene encoding carboxypeptidase A5 (Cpa5) are not essential for spermatogenesis and male fertility in the mouse. Reprod. Fertil. Dev. 2021, 33, 401–409. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Kyi-Tha-Thu, C.; Takizawa, T.; Naing, B.T.; Takizawa, T. 1700108J01Rik and 1700101O22Rik are mouse testis-specific long non-coding RNAs. Histochem. Cell Biol. 2018, 149, 517–527. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Atkins, J.; Cairns, M.; Ali, A.; Tanwar, P.S. Germ cell-specific sustained activation of Wnt signalling perturbs spermatogenesis in aged mice, possibly through non-coding RNAs. Oncotarget 2016, 7, 85709–85727. [Google Scholar] [CrossRef] [Green Version]
- Qin, X.; Krumrei, N.; Grubissich, L.; Dobarro, M.; Aktas, H.; Perez, G.; Halperin, J.A. Deficiency of the mouse complement regulatory protein mCd59b results in spontaneous hemolytic anemia with platelet activation and progressive male infertility. Immunity 2003, 18, 217–227. [Google Scholar] [CrossRef] [Green Version]
- Qi, H.; Moran, M.M.; Navarro, B.; Chong, J.A.; Krapivinsky, G.; Krapivinsky, L.; Kirichok, Y.; Ramsey, I.S.; Quill, T.A.; Clapham, D.E. All four CatSper ion channel proteins are required for male fertility and sperm cell hyperactivated motility. Proc. Natl. Acad. Sci. USA 2007, 104, 1219–1223. [Google Scholar] [CrossRef] [Green Version]
- Liu, K.S.; Li, T.P.; Ton, H.; Mao, X.D.; Chen, Y.J. Advances of Long Noncoding RNAs-mediated Regulation in Reproduction. Chin. Med. J. 2018, 131, 226–234. [Google Scholar] [CrossRef]
- Miyamoto, T.; Minase, G.; Shin, T.; Ueda, H.; Okada, H.; Sengoku, K. Human male infertility and its genetic causes. Reprod. Med. Biol. 2017, 16, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Harries, L.W. Long non-coding RNAs and human disease. Biochem. Soc. Trans. 2012, 40, 902–906. [Google Scholar] [CrossRef] [PubMed]
- Savolainen, H. Biochemical and clinical aspects of nickel toxicity. Rev. Environ. Health 1996, 11, 167–173. [Google Scholar] [CrossRef]
- Li, K.; Xu, J.; Luo, Y.; Zou, D.; Han, R.; Zhong, S.; Zhao, Q.; Mang, X.; Li, M.; Si, Y.; et al. Panoramic transcriptome analysis and functional screening of long noncoding RNAs in mouse spermatogenesis. Genome Res. 2021, 31, 13–26. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.H.; Kwon, J.T.; Kim, J.; Jeong, J.; Kim, J.; Lee, S.; Cho, C. Profiling of testis-specific long noncoding RNAs in mice. BMC Genom. 2018, 19, 539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.J.; Wei, D.; Han, H.L.; Song, Y.J.; Wang, Y.; Xu, H.Q.; Smagghe, G. lnc94638 is a testis-specific long non-coding RNA involved in spermatozoa formation in Zeugodacus cucurbitae (Coquillett). Insect Mol. Biol. 2021, 30, 605–614. [Google Scholar] [CrossRef] [PubMed]
- de Mateo, S.; Sassone-Corsi, P. Regulation of spermatogenesis by small non-coding RNAs: Role of the germ granule. Semin. Cell Dev. Biol. 2014, 29, 84–92. [Google Scholar] [CrossRef] [Green Version]
- Paronetto, M.P.; Sette, C. Role of RNA-binding proteins in mammalian spermatogenesis. Int. J. Androl. 2010, 33, 2–12. [Google Scholar] [CrossRef]
- Zhang, X.; Zhou, W.; Zhang, P.; Gao, F.; Zhao, X.; Shum, W.W.; Zeng, X. Cabs1 Maintains Structural Integrity of Mouse Sperm Flagella during Epididymal Transit of Sperm. Int. J. Mol. Sci. 2021, 22, 652. [Google Scholar] [CrossRef] [PubMed]
- Wichman, L.; Somasundaram, S.; Breindel, C.; Valerio, D.M.; McCarrey, J.R.; Hodges, C.A.; Khalil, A.M. Dynamic expression of long noncoding RNAs reveals their potential roles in spermatogenesis and fertility. Biol. Reprod. 2017, 97, 313–323. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.; Lin, Y.; He, Y.; Wang, H.; Chen, S.; Li, Z.; Song, N.; Sun, F. Deletion of lncRNA5512 has no effect on spermatogenesis and reproduction in mice. Reprod. Fertil. Dev. 2020, 32, 706–713. [Google Scholar] [CrossRef]
- Li, C.; Shen, C.; Shang, X.; Tang, L.; Xiong, W.; Ge, H.; Zhang, H.; Lu, S.; Shen, Y.; Wang, J.; et al. Two novel testis-specific long noncoding RNAs produced by 1700121C10Rik are dispensable for male fertility in mice. J. Reprod. Dev. 2020, 66, 57–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qu, M.; Zhao, Y.; Zhao, Y.; Rui, Q.; Kong, Y.; Wang, D. Identification of long non-coding RNAs in response to nanopolystyrene in Caenorhabditis elegans after long-term and low-dose exposure. Environ. Pollut. 2019, 255, 113137. [Google Scholar] [CrossRef]
- Goudarzi, M.; Berg, K.; Pieper, L.M.; Schier, A.F. Individual long non-coding RNAs have no overt functions in zebrafish embryogenesis, viability and fertility. Elife 2019, 8, e40815. [Google Scholar] [CrossRef]
- Kuroki, S.; Akiyoshi, M.; Tokura, M.; Miyachi, H.; Nakai, Y.; Kimura, H.; Shinkai, Y.; Tachibana, M. JMJD1C, a JmjC domain-containing protein, is required for long-term maintenance of male germ cells in mice. Biol. Reprod. 2013, 89, 93. [Google Scholar] [CrossRef] [PubMed]
- Falender, A.E.; Freiman, R.N.; Geles, K.G.; Lo, K.C.; Hwang, K.; Lamb, D.J.; Morris, P.L.; Tjian, R.; Richards, J.S. Maintenance of spermatogenesis requires TAF4b, a gonad-specific subunit of TFIID. Genes Dev. 2005, 19, 794–803. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xia, X.; Zhou, X.; Quan, Y.; Hu, Y.; Xing, F.; Li, Z.; Xu, B.; Xu, C.; Zhang, A. Germline deletion of Cdyl causes teratozoospermia and progressive infertility in male mice. Cell Death Dis. 2019, 10, 229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.; Khan, S.; Li, L.; Ten Hagen, T.L.M.; Falahati, M. Molecular mechanisms of thyroid cancer: A competing endogenous RNA (ceRNA) point of view. Biomed. Pharmacother. 2022, 146, 112251. [Google Scholar] [CrossRef]
- Li, H.; Dai, Y.; Luo, Z.; Nie, D. Cloning of a new testis-enriched gene C4orf22 and its role in cell cycle and apoptosis in mouse spermatogenic cells. Mol. Biol. Rep. 2019, 46, 2029–2038. [Google Scholar] [CrossRef]
- Gaysinskaya, V.; Soh, I.Y.; van der Heijden, G.W.; Bortvin, A. Optimized flow cytometry isolation of murine spermatocytes. Cytom. A 2014, 85, 556–565. [Google Scholar] [CrossRef] [Green Version]
- Hwang, J.Y.; Mannowetz, N.; Zhang, Y.; Everley, R.A.; Gygi, S.P.; Bewersdorf, J.; Lishko, P.V.; Chung, J.J. Dual Sensing of Physiologic pH and Calcium by EFCAB9 Regulates Sperm Motility. Cell 2019, 177, 1480–1494.e19. [Google Scholar] [CrossRef]






| Application | Primer Name | Primer Sequence (5′-3′) |
|---|---|---|
| Genotyping | O22Rik-F | TGAATGCTTTGAGAATCCAGGTAGG |
| O22Rik-R1 | TCCAGTTAGGAAGTGAACAGGAAAA | |
| RT-qPCR | O22Rik-R2 | GAACTCATACCACTGCTACGG |
| NM480-F1 | TCTCCCAGTTGCTTCACTGTCAGG | |
| NM480-R1 | CCCAGGCTTGGGAACTCATTTACA | |
| NM480-F | TGTATGCACCGAAGGCTGGAGAG | |
| O22Rik-F | ACCTCTCACCAGAGTGCTTG | |
| O22Rik-R | GTGTCCTCTCCGTCTGGATG | |
| NM480-F | TGGCTTGTGTATGCACCGAA | |
| NM480-R | TAAGCAGACACAGCAGCTCG | |
| Gm32773-F | CTTGTGACGGTGGTGAGTGA | |
| Gm32773-R | TTGGCTCACAGTAGGTGGTC | |
| Gm32828-F | GCTTGTTCTCTCCAACCCTCA | |
| Gm32828-R | CCAGAAGGCTATGCGTGAGA | |
| Gm46311-F | CATGCACTGTCCCTGCGAA | |
| Gm46311-R | ATCATGGACACGAGTTGGGT | |
| β-actin-F | GGCTGTATTCCCCTCCATCG | |
| β-actin-R | CCAGTTGGTAACAATGCCATGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.; Dong, S.; Chen, C.; Liu, X.; Zeng, X.; Gao, Y.; Zhang, X. lncRNA 1700101O22Rik and NONMMUG030480.1 Are Not Essential for Spermatogenesis in Mice. Int. J. Mol. Sci. 2022, 23, 8627. https://doi.org/10.3390/ijms23158627
Zhou Y, Dong S, Chen C, Liu X, Zeng X, Gao Y, Zhang X. lncRNA 1700101O22Rik and NONMMUG030480.1 Are Not Essential for Spermatogenesis in Mice. International Journal of Molecular Sciences. 2022; 23(15):8627. https://doi.org/10.3390/ijms23158627
Chicago/Turabian StyleZhou, Yang, Shijue Dong, Chen Chen, Xiaojun Liu, Xuhui Zeng, Yuan Gao, and Xiaoning Zhang. 2022. "lncRNA 1700101O22Rik and NONMMUG030480.1 Are Not Essential for Spermatogenesis in Mice" International Journal of Molecular Sciences 23, no. 15: 8627. https://doi.org/10.3390/ijms23158627
APA StyleZhou, Y., Dong, S., Chen, C., Liu, X., Zeng, X., Gao, Y., & Zhang, X. (2022). lncRNA 1700101O22Rik and NONMMUG030480.1 Are Not Essential for Spermatogenesis in Mice. International Journal of Molecular Sciences, 23(15), 8627. https://doi.org/10.3390/ijms23158627

