Taste 2 Receptor Is Involved in Differentiation of 3T3-L1 Preadipocytes
Abstract
1. Introduction
2. Results
2.1. Tas2r Expression in 3T3-L1 Adipocytes Responds to External Stimuli
2.2. Tas2r Expression in Mouse WAT Responds to External Stimuli
2.3. RNA Sequencing (RNA-Seq) Analysis of 3T3-L1 Adipocytes Stimulated by Bitter Compounds
2.4. Overexpression of Tas2r108 or Tas2r126 Reduced Differentiation of 3T3-L1 Preadipocytes
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Animal Experiments
4.3. RT-qPCR
4.4. RNA-Seq Analysis
4.5. Overexpression of Tas2r Genes
4.6. Lipid Accumulation Assay
4.7. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lu, P.; Zhang, C.-H.; Lifshitz, L.M.; ZhuGe, R. Extraoral Bitter Taste Receptors in Health and Disease. J. Gen. Physiol. 2017, 149, 181–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carey, R.M.; Lee, R.J. Taste Receptors in Upper Airway Innate Immunity. Nutrients 2019, 11, 2017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liszt, K.I.; Ley, J.P.; Lieder, B.; Behrens, M.; Stöger, V.; Reiner, A.; Hochkogler, C.M.; Köck, E.; Marchiori, A.; Hans, J.; et al. Caffeine Induces Gastric Acid Secretion via Bitter Taste Signaling in Gastric Parietal Cells. Proc. Natl. Acad. Sci. USA 2017, 114, E6260–E6269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, X.-C.; Chen, Z.-H.; Xue, J.-B.; Zhao, D.-X.; Lu, C.; Li, Y.-H.; Li, S.-M.; Du, Y.-W.; Liu, Q.; Wang, P.; et al. Infection by the Parasitic Helminth Trichinella Spiralis Activates a Tas2r-Mediated Signaling Pathway in Intestinal Tuft Cells. Proc. Natl. Acad. Sci. USA 2019, 116, 5564–5569. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kimura, S.; Kato, E. TAS2R Expression Profile in Brown Adipose, White Adipose, Skeletal Muscle, Small Intestine, Liver and Common Cell Lines Derived from Mice. Gene Rep. 2020, 20, 100763. [Google Scholar] [CrossRef] [Scilit]
- Chupeerach, C.; Tapanee, P.; On-Nom, N.; Temviriyanukul, P.; Chantong, B.; Reeder, N.; Adegoye, G.; Tolar-Peterson, T. The Influence of TAS2R38 Bitter Taste Gene Polymorphisms on Obesity Risk in Three Racially Diverse Groups. Biomedicine 2021, 11, 43–49. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, T.; Pervin, M.; Goto, S.; Isemura, M.; Nakamura, Y. Beneficial Effects of Tea and the Green Tea Catechin Epigallocatechin-3-Gallate on Obesity. Molecules 2016, 21, 1305. [Google Scholar] [CrossRef] [Scilit]
- Szkudelska, K.; Szkudelski, T. Resveratrol, Obesity and Diabetes. Eur. J. Pharmacol. 2010, 635, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Ono, E.; Inoue, J.; Hashidume, T.; Shimizu, M.; Sato, R. Anti-Obesity and Anti-Hyperglycemic Effects of the Dietary Citrus Limonoid Nomilin in Mice Fed a High-Fat Diet. Biochem. Biophys. Res. Commun. 2011, 410, 677–681. [Google Scholar] [CrossRef] [Scilit]
- Konda, V.R.; Desai, A.; Darland, G.; Grayson, N.; Bland, J.S. KDT501, a Derivative from Hops, Normalizes Glucose Metabolism and Body Weight in Rodent Models of Diabetes. PLoS ONE 2014, 9, e87848. [Google Scholar] [CrossRef] [Scilit]
- Lossow, K.; Hübner, S.; Roudnitzky, N.; Slack, J.P.; Pollastro, F.; Behrens, M.; Meyerhof, W. Comprehensive Analysis of Mouse Bitter Taste Receptors Reveals Different Molecular Receptive Ranges for Orthologous Receptors in Mice and Humans. J. Biol. Chem. 2016, 291, 15358–15377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the Unification of Biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carbon, S.; Douglass, E.; Good, B.M.; Unni, D.R.; Harris, N.L.; Mungall, C.J.; Basu, S.; Chisholm, R.L.; Dodson, R.J.; Hartline, E.; et al. The Gene Ontology Resource: Enriching a GOld Mine. Nucleic Acids Res. 2021, 49, D325–D334. [Google Scholar] [CrossRef] [Scilit]
- Boyle, K.B.; Hadaschik, D.; Virtue, S.; Cawthorn, W.P.; Ridley, S.H.; O’Rahilly, S.; Siddle, K. The Transcription Factors Egr1 and Egr2 Have Opposing Influences on Adipocyte Differentiation. Cell Death Differ. 2009, 16, 782–789. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.; Torrens, J.I.; Anand, A.; Spiegelman, B.M.; Friedman, J.M. Krox20 Stimulates Adipogenesis via C/EBPβ-Dependent and -Independent Mechanisms. Cell Metab. 2005, 1, 93–106. [Google Scholar] [CrossRef] [Scilit]
- Chao, L.C.; Bensinger, S.J.; Villanueva, C.J.; Wroblewski, K.; Tontonoz, P. Inhibition of Adipocyte Differentiation by Nur77, Nurr1, and Nor1. Mol. Endocrinol. 2008, 22, 2596–2608. [Google Scholar] [CrossRef] [Scilit]
- Duszka, K.; Bogner-Strauss, J.G.; Hackl, H.; Rieder, D.; Neuhold, C.; Prokesch, A.; Trajanoski, Z.; Krogsdam, A.M. Nr4a1 Is Required for Fasting-Induced down-Regulation of Pparγ2 in White Adipose Tissue. Mol. Endocrinol. 2013, 27, 135–149. [Google Scholar] [CrossRef] [Scilit]
- Amisten, S.; Neville, M.; Hawkes, R.; Persaud, S.J.; Karpe, F.; Salehi, A. An Atlas of G-Protein Coupled Receptor Expression and Function in Human Subcutaneous Adipose Tissue. Pharmacol. Ther. 2015, 146, 61–93. [Google Scholar] [CrossRef] [Scilit]
- Vegezzi, G.; Anselmi, L.; Huynh, J.; Barocelli, E.; Rozengurt, E.; Raybould, H.; Sternini, C. Diet-Induced Regulation of Bitter Taste Receptor Subtypes in the Mouse Gastrointestinal Tract. PLoS ONE 2014, 9, e107732. [Google Scholar] [CrossRef] [Scilit]
- Avau, B.; Bauters, D.; Steensels, S.; Vancleef, L.; Laermans, J.; Lesuisse, J.; Buyse, J.; Lijnen, H.R.; Tack, J.; Depoortere, I. The Gustatory Signaling Pathway and Bitter Taste Receptors Affect the Development of Obesity and Adipocyte Metabolism in Mice. PLoS ONE 2015, 10, e0145538. [Google Scholar] [CrossRef] [Scilit]
- Ning, X.; He, J.; Shi, X.; Yang, G. Regulation of Adipogenesis by Quinine through the ERK/S6 Pathway. Int. J. Mol. Sci. 2016, 17, 504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meyerhof, W.; Batram, C.; Kuhn, C.; Brockhoff, A.; Chudoba, E.; Bufe, B.; Appendino, G.; Behrens, M. The Molecular Receptive Ranges of Human TAS2R Bitter Taste Receptors. Chem. Senses 2010, 35, 157–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Compound (Abbreviation) | Target T2R | Threshold (μM) |
|---|---|---|
| quinine (Q) | Tas2r108, Tas2r126, Tas2r137 | 10 |
| emetine (EM) | Tas2r108 | 30 |
| 6-propyl-2-thiouracil (PROP) | Tas2r108, Tas2r135, Tas2r137 | 1000 |
| epicatechin (EC) | Tas2r126 | 1000 |
| denatonium benzoate (DB) | Tas2r135 | 100 |
| allyl isothiocyanate (AITC) | Tas2r135 | 300 |
| camphor (CA) | Tas2r137 | 1000 |
| Target | Forward | Reverse |
|---|---|---|
| Actb | TACGACCAGAGGCATACAG | GCCAACCGTGAAAAGATGAC |
| Tas2r108 | AACAGGACCAGCTTTTGGAATC | GAGGAAACAGATCATCAGCCTCAT |
| Tas2r126 | GCTCAGCGTCCTGTTCTGTA | CAACGCTGGGAATCTCCACT |
| Tas2r135 | GAACTTCGGGATGTCTGGGC | TATGGTGTGTTGCTGGCAGA |
| Tas2r137 | TTCTACTGCCTGAAAATAGCCAGTT | AACAACCACTCTAGAAGCTCTCCATT |
| Tas2r143 | TCCCAGTTAGTTCCCAGGCT | AAGTTCCCGGTGGCTGAAAT |
| Pparg | GTACTGTCGGTTTCAGAAGTGCC | ATCTCCGCCAACAGCTTCTCCT |
| Cebpa | GCAAAGCCAAGAAGTCGGTGGA | CCTTCTGTTGCGTCTCCACGTT |
| Egr2 | CCTTTGACCAGATGAACGGAGTG | CTGGTTTCTAGGTGCAGAGATGG |
| Nr4a1 | GTGCAGTCTGTGGTGACAATGC | CAGGCAGATGTACTTGGCGCTT |
| Nr4a2 | CCGCCGAAATCGTTGTCAGTAC | TTCGGCTTCGAGGGTAAACGAC |
| Nr4a3 | ACGCCGAAACCGATGTCAGTAC | CTCCTGTTGTAGTGGGCTCTTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kimura, S.; Tsuruma, A.; Kato, E. Taste 2 Receptor Is Involved in Differentiation of 3T3-L1 Preadipocytes. Int. J. Mol. Sci. 2022, 23, 8120. https://doi.org/10.3390/ijms23158120
Kimura S, Tsuruma A, Kato E. Taste 2 Receptor Is Involved in Differentiation of 3T3-L1 Preadipocytes. International Journal of Molecular Sciences. 2022; 23(15):8120. https://doi.org/10.3390/ijms23158120
Chicago/Turabian StyleKimura, Shunsuke, Ai Tsuruma, and Eisuke Kato. 2022. "Taste 2 Receptor Is Involved in Differentiation of 3T3-L1 Preadipocytes" International Journal of Molecular Sciences 23, no. 15: 8120. https://doi.org/10.3390/ijms23158120
APA StyleKimura, S., Tsuruma, A., & Kato, E. (2022). Taste 2 Receptor Is Involved in Differentiation of 3T3-L1 Preadipocytes. International Journal of Molecular Sciences, 23(15), 8120. https://doi.org/10.3390/ijms23158120

