Exposure to Bisphenol A Caused Hepatoxicity and Intestinal Flora Disorder in Rats
Abstract
1. Introduction
2. Results
2.1. Effects of BPA on Liver Weight and Oxidative Stress
2.2. Effects of BPA on Serological Markers
2.3. BPA-Induced Liver Histopathological Damage
2.4. Effects of BPA on SIRT1/PGC-1α Pathway
2.5. BPA-Induced Hepatocyte Apoptosis in Liver
2.6. Effects of BPA on α and β Diversity of Gut Microbiota in Rats
2.7. Effects of BPA on the Community of Gut Microbiota in Rats
2.8. Effects of BPA on Fecal SCFA Levels in Rats
3. Discussion
4. Materials and Methods
4.1. Animal Protocol
4.2. Chemicals
4.3. Evaluation of Hepatic Oxidative Stress
4.4. Detection of Serum Biochemical Parameters
4.5. Histopathology and Immunohistochemistry of Liver
4.6. TUNEL Analysis
4.7. Real-Time PCR Analysis
4.8. Western Blotting Analysis
4.9. Gut Microbiota Analysis by High-Throughput 16S rRNA Gene Sequencing
4.10. Analysis of Fecal Short Chain Fatty Acids (SCFAs)
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| PGC-1α | Peroxisome proliferator-activated receptor-gamma-coactivator 1alpha |
| Nrf1 | Nuclear respiratory factor |
| Nrf2 | Nuclear factor E2-related factor 2 |
| TFAM | Mitochondrial transcription factor A |
| NOAEL | No observed adverse effect level |
| LOAEL | The lowest observable adverse effect level |
| ROS | Reactive oxygen species |
| SOD | Superoxide dismutase |
| GSH | Glutathione |
| CAT | Catalase |
| MDA | Malondialdehyde |
| TC | Total cholesterol |
| TG | Triacylglycerols |
| LDL-C | Low-density lipoprotein cholesterol |
| HDL-C | High-density lipoprotein cholesterol |
| ALT | Alanine aminotransferase |
| AST | Aspartate aminotransferase |
| TUNEL | Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling |
| SCFAs | Short-chain fatty acids |
| GST | Glutathione S-transferase |
| GSH-Px | Glutathione peroxidase |
| PCA | Principal component analysis |
| ALP | Alkaline phosphatase |
| LDH | Lactate dehydrogenase |
References
- Le Corre, L.; Besnard, P.; Chagnon, M.C. BPA, an energy balance disruptor. Crit. Rev. Food Sci. Nutr. 2015, 55, 769–777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cimmino, I.; Fiory, F.; Perruolo, G.; Miele, C.; Oriente, F. Potential Mechanisms of Bisphenol A (BPA) Contributing to Human Disease. Int. J. Mol. Sci. 2020, 21, 5761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saadeldin, I.M.; Hussein, M.A.; Suleiman, A.H.; Abohassan, M.G.; Ahmed, M.M.; Moustafa, A.A. Ameliorative effect of ginseng extract on phthalate and bisphenol A reprotoxicity during pregnancy in rats. Environ. Sci. Pollut. Res. 2018, 25, 21205–21215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shafei, A.; Ramzy, M.M.; Hegazy, A.I.; Husseny, A.K.; El-Hadary, U.G.; Taha, M.M.; Mosa, A.A. The molecular mechanisms of action of the endocrine disrupting chemical bisphenol A in the development of cancer. Gene 2018, 647, 235–243. [Google Scholar] [CrossRef] [Scilit]
- Song, D.; Chen, Y.; Wang, B.; Li, D.; Xu, C.; Huang, H.; Huang, S.; Liu, R. Bisphenol A inhibits autophagosome-lysosome fusion and lipid droplet degradation. Ecotox. Environ. Saf. 2019, 183, 109492. [Google Scholar] [CrossRef] [Scilit]
- Soundararajan, A.; Prabu, P.; Mohan, V.; Gibert, Y.; Balasubramanyam, M. Novel insights of elevated systemic levels of bisphenol-A (BPA) linked to poor glycemic control, accelerated cellular senescence and insulin resistance in patients with type 2 diabetes. Mol. Cell. Biochem. 2019, 458, 171–183. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Shi, Y.; Li, Z.; Sun, L.; Zhang, M.; Yu, L.; Wu, S. BPA disrupts 17-estradiol-mediated hepatic protection against ischemia/reperfusion injury in rat liver by upregulating the Ang II/AT1R signaling pathway. Mol. Med. Rep. 2020, 22, 416–422. [Google Scholar] [CrossRef] [Scilit]
- Ji, H.; Song, N.; Ren, J.; Li, W.; Xu, B.; Li, H.; Shen, G. Metabonomics reveals bisphenol A affects fatty acid and glucose metabolism through activation of LXR in the liver of male mice. Sci. Total Environ. 2020, 703, 134681. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Rahman, H.G.; Abdelrazek, H.M.A.; Zeidan, D.W.; Mohamed, R.M.; Abdelazim, A.M. Lycopene: Hepatoprotective and antioxidant effects toward Bisphenol A-induced toxicity in female Wistar rats. Oxid. Med. Cell. Longev. 2018, 2018, 5167524. [Google Scholar] [CrossRef] [Scilit]
- Hassani, F.V.; Abnous, K.; Mehri, S.; Jafarian, A.; Birner-Gruenberger, R.; Robati, R.Y.; Hosseinzadeh, H. Proteomics and phosphoproteomics analysis of liver in male rats exposed to bisphenol A: Mechanism of hepatotoxicity and biomarker discovery. Food Chem. Toxicol. 2018, 112, 26–38. [Google Scholar] [CrossRef] [Scilit]
- Chang, H.C.; Guarente, L. SIRT1 and other sirtuins in metabolism. Trends Endocrinol. Metab. 2014, 25, 138–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, V.; Ubaid, S. Role of silent information regulator 1 (SIRT1) in regulating oxidative stress and inflammation. Inflammation 2020, 43, 1589–1598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakamura, K.; Zhang, M.; Kageyama, S.; Ke, B.; Fujii, T.; Sosa, R.A.; Reed, E.F.; Datta, N.; Zarrinpar, A.; Busuttil, R.W.; et al. Macrophage heme oxygenase-1-SIRT1-p53 axis regulates sterile inflammation in liver ischemia-reperfusion injury. J. Hepatol. 2017, 67, 1232–1242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farghali, H.; Kemelo, M.K.; Canová, N.K. SIRT1 modulators in experimentally induced liver injury. Oxid. Med. Cell. Longev. 2019, 2019, 8765954. [Google Scholar] [CrossRef] [Scilit]
- Lagouge, M. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha. Cell 2006, 127, 1109–1122. [Google Scholar] [CrossRef] [Scilit]
- Chung, N.; Park, J.; Lim, K. The effects of exercise and cold exposure on mitochondrial biogenesis in skeletal muscle and white adipose tissue. J. Exerc. Nutr. Biochem. 2017, 21, 39–47. [Google Scholar] [CrossRef] [Scilit]
- Hao, L.; Zhong, W.; Dong, H.; Guo, W.; Sun, X.; Zhang, W.; Yue, R.; Li, T.; Griffiths, A.; Ahmadi, A.R.; et al. ATF4 activation promotes hepatic mitochondrial dysfunction by repressing NRF1–TFAM signalling in alcoholic steatohepatitis. Gut 2021, 70, 1933. [Google Scholar] [CrossRef] [Scilit]
- Wang, A.; Li, D.; Wang, S.; Zhou, F.; Li, P.; Wang, Y.; Lin, L. γ-Mangostin, a xanthone from mangosteen, attenuates oxidative injury in the liver via NRF2 and SIRT1 induction. J. Funct. Foods 2018, 40, 544–553. [Google Scholar] [CrossRef] [Scilit]
- Dai, J.; Yang, X.; Yuan, Y.; Jia, Y.; Liu, G.; Lin, N.; Xiao, H.; Zhang, L.; Chen, J. Toxicity, gut microbiota and metabolome effects after copper exposure during early life in SD rats. Toxicology 2020, 433–434, 152395. [Google Scholar] [CrossRef] [Scilit]
- Park, W. Gut microbiomes and their metabolites shape human and animal health. J. Microbiol. 2018, 56, 151–153. [Google Scholar] [CrossRef] [Scilit]
- Bindhumol, V.; Chitra, K.C.; Mathur, P.P. Bisphenol A induces reactive oxygen species generation in the liver of male rats. Toxicology 2003, 188, 117–124. [Google Scholar] [CrossRef] [Scilit]
- Marmugi, A.; Ducheix, S.; Lasserre, F.; Polizzi, A.; Paris, A.; Priymenko, N.; Bertrand-Michel, J.; Pineau, T.; Guillou, H.; Martin, P.G.; et al. Low doses of bisphenol A induce gene expression related to lipid synthesis and trigger triglyceride accumulation in adult mouse liver. Hepatology 2012, 55, 395–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, H.; Duan, S.; Guan, T.; Yuan, X.; Lin, J.; Hou, S.; Lai, X.; Huang, S.; Du, X.; Chen, S. Vitexin protects against ethanol-induced liver injury through Sirt1/p53 signaling pathway. Eur. J. Pharmacol. 2020, 873, 173007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, Z.; He, H.; Zuo, Z.; Xu, Z.; Wei, Z.; Deng, J. The role of different SIRT1-mediated signaling pathways in toxic injury. Cell. Mol. Biol. Lett. 2019, 24, 36. [Google Scholar] [CrossRef] [Scilit]
- Guicciardi, M.E.; Malhi, H.; Mott, J.L.; Gores, G.J. Apoptosis and Necrosis in the Liver. Compr. Physiol. 2013, 3, 977–1010. [Google Scholar] [CrossRef] [Scilit]
- Youle, R.J.; Strasser, A. The BCL-2 protein family: Opposing activities that mediate cell death. Nat. Rev. Mol. Cell Biol. 2008, 9, 47–59. [Google Scholar] [CrossRef] [Scilit]
- Feng, Y.; Liu, T.; Dong, S.Y.; Guo, Y.J.; Jankovic, J.; Xu, H.; Wu, Y.C. Rotenone affects p53 transcriptional activity and apoptosis via targeting SIRT1 and H3K9 acetylation in SH-SY5Y cells. J. Neurochem. 2015, 134, 668–676. [Google Scholar] [CrossRef] [Scilit]
- Xie, S.Z.; Liu, B.; Ye, H.Y.; Li, Q.M.; Pan, L.H.; Zha, X.Q.; Liu, J.; Duan, J.; Luo, J.P. Dendrobium huoshanense polysaccharide regionally regulates intestinal mucosal barrier function and intestinal microbiota in mice. Carbohydr. Polym. 2019, 206, 149–162. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, S.; Atlas, E. Bisphenol S- and bisphenol A-induced adipogenesis of murine preadipocytes occurs through direct peroxisome proliferator-activated receptor-gamma activation. Int. J. Obes. 2016, 40, 1566–1573. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Song, L. Quercetin protects human liver cells from o,p’-DDT-induced toxicity by suppressing Nrf2 and NADPH oxidase-regulated ROS production. Food Chem. Toxicol. 2022, 161, 112849. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Chen, C.; Jiang, Z.; Wang, M.; Jiang, H.; Zhang, X. Protective effect of Cordyceps militaris extract against bisphenol A induced reproductive damage. Syst. Biol. Reprod. Med. 2016, 62, 249–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, Z.; Wang, D.; Yan, S.; Li, R.; Yan, J.; Teng, M.; Zhou, Z.; Zhu, W. Effects of perinatal exposure to BPA and its alternatives (BPS, BPF and BPAF) on hepatic lipid and glucose homeostasis in female mice adolescent offspring. Chemosphere 2018, 212, 297–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vahdati Hassani, F.; Mehri, S.; Abnous, K.; Birner-Gruenberger, R.; Hosseinzadeh, H. Protective effect of crocin on BPA-induced liver toxicity in rats through inhibition of oxidative stress and downregulation of MAPK and MAPKAP signaling pathway and miRNA-122 expression. Food. Chem. Toxicol. 2017, 107, 395–405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahmoudi, A.; Ghorbel, H.; Bouallegui, Z.; Marrekchi, R.; Isoda, H.; Sayadi, S. Oleuropein and hydroxytyrosol protect from bisphenol A effects in livers and kidneys of lactating mother rats and their pups’. Exp. Toxicol. Pathol. 2015, 67, 413–425. [Google Scholar] [CrossRef] [Scilit]
- Yang, Q.; Han, B.; Xue, J.; Lv, Y.; Li, S.; Liu, Y.; Wu, P.; Wang, X.; Zhang, Z. Hexavalent chromium induces mitochondrial dynamics disorder in rat liver by inhibiting AMPK/PGC-1alpha signaling pathway. Environ. Pollut. 2020, 265, 114855. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Lan, Z.; Li, Q.; Liu, Y.; Ruan, X.; Hou, W.; Ding, Y. Naringin protects against lipopolysaccharide-induced cardiac injury in mice. Environ. Toxicol. Pharmacol. 2016, 48, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Pi, S.; Nie, G.; Wei, Z.; Yang, F.; Wang, C.; Xing, C.; Hu, G.; Zhang, C. Inhibition of ROS/NLRP3/Caspase-1 mediated pyroptosis alleviates excess molybdenum-induced apoptosis in duck renal tubular epithelial cells. Ecotox. Environ. Saf. 2021, 208, 111528. [Google Scholar] [CrossRef] [Scilit]
- Hassan, Z.K.; Elobeid, M.A.; Virk, P.; Omer, S.A.; El Amin, M.; Daghestani, M.H.; Al Olayan, E.M.; Romero, F.J.; Bisphenol, A. Induces Hepatotoxicity through Oxidative Stress in Rat Model. Oxid. Med. Cell. Longev. 2012, 2012, 194829. [Google Scholar] [CrossRef] [Scilit]
- Franco, R.; Cidlowski, J.A. Glutathione efflux and cell death. Antioxid. Redox Signal. 2012, 17, 1694–1713. [Google Scholar] [CrossRef] [Scilit]
- Lozano-Paniagua, D.; Parron, T.; Alarcon, R.; Requena, M.; Lopez-Guarnido, O.; Lacasana, M.; Hernandez, A.F. Evaluation of conventional and non-conventional biomarkers of liver toxicity in greenhouse workers occupationally exposed to pesticides. Food Chem. Toxicol. 2021, 151, 112127. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Zhang, H.; Zou, J.; Mai, H.; Su, D.; Feng, X.; Feng, D. Bisphenol A exposure induces cholesterol synthesis and hepatic steatosis in C57BL/6 mice by down-regulating the DNA methylation levels of SREBP-2. Food Chem. Toxicol. 2019, 133, 110786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- AnvariFar, H.; Amirkolaie, A.K.; Miandare, H.K.; Ouraji, H.; Jalali, M.A.; Üçüncü, S.İ. Apoptosis in fish: Environmental factors and programmed cell death. Cell. Tissue Res. 2017, 368, 425–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Nie, G.; Yang, F.; Chen, J.; Zhuang, Y.; Dai, X.; Liao, Z.; Yang, Z.; Cao, H.; Xing, C.; et al. Molybdenum and cadmium co-induce oxidative stress and apoptosis through mitochondria-mediated pathway in duck renal tubular epithelial cells. J. Hazard. Mater. 2020, 383, 121157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, S.; Beigh, S.; Chaudhari, B.P.; Sharma, S.; Aliul, H.A.S.; Ahmad, S.; Ahmad, F.; Parvez, S.; Raisuddin, S. Mitochondrial dysfunction induced by Bisphenol A is a factor of its hepatotoxicity in rats. Environ. Toxicol. 2016, 31, 1922–1934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, C.; Yang, W.; He, Z.; Guo, J.; Yang, X.; Wang, R.; Li, H. Kaempferol alleviates oxidative stress and apoptosis through mitochondria-dependent pathway during lung ischemia-reperfusion injury. Front. Pharmacol. 2021, 12, 624402. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liang, H.; Ren, B.; Zhao, T.; Chen, H.; Zhao, Y.; Liang, H. Enantioselective toxic effects of mefentrifluconazole in the liver of adult zebrafish (Danio rerio) based on transcription level and metabolomic profile. Toxicology 2022, 467, 153095. [Google Scholar] [CrossRef] [Scilit]
- Palikaras, K.; Tavernarakis, N. Mitochondrial homeostasis: The interplay between mitophagy and mitochondrial biogenesis. Exp. Gerontol. 2014, 56, 182–188. [Google Scholar] [CrossRef] [Scilit]
- Patti, M.E.; Butte, A.J.; Crunkhorn, S.; Cusi, K.; Berria, R.; Kashyap, S.; Miyazaki, Y.; Kohane, I.; Costello, M.; Saccone, R.; et al. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1. Proc. Natl. Acad. Sci. USA 2003, 100, 8466–8471. [Google Scholar] [CrossRef] [Scilit]
- Goyal, S.; Tiwari, S.; Seth, B.; Tandon, A.; Shankar, J.; Sinha, M.; Singh, S.J.; Priya, S.; Chaturvedi, R.K. Bisphenol-A inhibits mitochondrial biogenesis via impairment of GFER mediated mitochondrial protein import in the rat brain hippocampus. Neurotoxicology 2021, 85, 18–32. [Google Scholar] [CrossRef] [Scilit]
- Santoro, A.; Scafuro, M.; Troisi, J.; Piegari, G.; Di Pietro, P.; Mele, E.; Cappetta, D.; Marino, M.; De Angelis, A.; Vecchione, C.; et al. Multi-Systemic Alterations by Chronic Exposure to a Low Dose of Bisphenol A in Drinking Water: Effects on Inflammation and NAD (+)-Dependent Deacetylase Sirtuin1 in Lactating and Weaned Rats. Int. J. Mol. Sci. 2021, 22, 9666. [Google Scholar] [CrossRef] [Scilit]
- Liao, J.; Chen, Y.; Shih, M.; Tain, Y.; Yeh, Y.; Chiu, M.; Chang, S.K.C.; Hou, C. Resveratrol butyrate esters inhibit BPA-induced liver damage in male offspring rats by modulating antioxidant capacity and gut microbiota. Int. J. Mol. Sci. 2021, 22, 5273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohtani, N.; Hara, E. Gut-liver axis-mediated mechanism of liver cancer: A special focus on the role of gut microbiota. Cancer Sci. 2021, 112, 4433–4443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Fan, S.; Huang, D.; Xiong, T.; Nie, S.; Xie, M. Polysaccharides from fermented Asparagus officinalis with Lactobacillus plantarum NCU116 alleviated liver injury via modulation of glutathione homeostasis, bile acid metabolism, and SCFA production. Food Funct. 2020, 11, 7681–7695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vasco, M.; Paolillo, R.; Schiano, C.; Sommese, L.; Cuomo, O.; Napoli, C. Compromised nutritional status in patients with end-stage liver disease: Role of gut microbiota. Hepatob. Pancreat. Dis. 2018, 17, 290–300. [Google Scholar] [CrossRef] [Scilit]
- Fechner, A.; Kiehntopf, M.; Jahreis, G. The formation of short-chain fatty acids is positively associated with the blood lipid-lowering effect of lupin kernel fiber in moderately hypercholesterolemic adults. J. Nutr. 2014, 144, 599–607. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Fang, Q.; Nie, Q.; Hu, J.; Yang, C.; Huang, T.; Li, H.; Nie, S. Hypoglycemic and hypolipidemic mechanism of tea polysaccharides on Type 2 diabetic rats via gut microbiota and metabolism alteration. J. Agric. Food Chem. 2020, 68, 10015–10028. [Google Scholar] [CrossRef] [Scilit]
- Lai, K.P.; Chung, Y.T.; Li, R.; Wan, H.T.; Wong, C.K. Bisphenol A alters gut microbiome: Comparative metagenomics analysis. Environ. Pollut. 2016, 218, 923–930. [Google Scholar] [CrossRef] [Scilit]
- Feng, D.; Zhang, H.; Jiang, X.; Zou, J.; Li, Q.; Mai, H.; Su, D.; Ling, W.; Feng, X. Bisphenol A exposure induces gut microbiota dysbiosis and consequent activation of gut-liver axis leading to hepatic steatosis in CD-1 mice. Environ. Pollut. 2020, 265, 114880. [Google Scholar] [CrossRef] [Scilit]
- Tulkens, J.; Vergauwen, G.; Van Deun, J.; Geeurickx, E.; Dhondt, B.; Lippens, L.; De Scheerder, M.A.; Miinalainen, I.; Rappu, P.; De Geest, B.G.; et al. Increased levels of systemic LPS-positive bacterial extracellular vesicles in patients with intestinal barrier dysfunction. Gut 2020, 69, 191–193. [Google Scholar] [CrossRef] [Scilit]
- Kang, D.W.; Park, J.G.; Ilhan, Z.E.; Wallstrom, G.; Labaer, J.; Adams, J.B.; Krajmalnik-Brown, R. Reduced incidence of Prevotella and other fermenters in intestinal microflora of autistic children. PLoS ONE 2013, 8, e68322. [Google Scholar] [CrossRef] [Scilit]
- Adegoke, E.O.; Rahman, M.S.; Amjad, S.; Pang, W.K.; Ryu, D.Y.; Park, Y.J.; Pang, M.G. Bisphenol A damages testicular junctional proteins transgenerationally in mice. Environ. Pollut. 2022, 302, 119067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peretz, J.; Vrooman, L.; Ricke, W.A.; Hunt, P.A.; Ehrlich, S.; Hauser, R.; Padmanabhan, V.; Taylor, H.S.; Swan, S.H.; Van de Voort, C.A.; et al. Bisphenol a and reproductive health: Update of experimental and human evidence, 2007–2013. Environ. Health Perspect. 2014, 122, 775–786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Indumathi, D.; Jayashree, S.; Selvaraj, J.; Sathish, S.; Mayilvanan, C.; Akilavalli, N.; Balasubramanian, K. Effect of bisphenol-A on insulin signal transduction and glucose oxidation in skeletal muscle of adult male albino rat. Hum. Exp. Toxicol. 2013, 32, 960–971. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, L.; Scholte, J.; Borewicz, K.; Van den Bogert, B.; Smidt, H.; Scheurink, A.J.; Gruppen, H.; Schols, H.A. Effects of pectin supplementation on the fermentation patterns of different structural carbohydrates in rats. Mol. Nutr. Food Res. 2016, 60, 2256–2266. [Google Scholar] [CrossRef] [Scilit]








| Gene Name | Primers Sequences (5′-3′) | Product Size (bp) | Annealing Temperature | Accession Number |
|---|---|---|---|---|
| SIRT1 | Forward: GCTCGCCTTGCTGTGGACTTCC Reverse: GTGACACAGAGATGGCTGGAACTG | 141 | 60 °C | NM_001372090.1 |
| PGC-1α | Forward: CATTCAGGAGCTGGATGGCT Reverse: AGATCTGGGCAAAGAGGCTG | 106 | 60 °C | NM_031347.1 |
| Nrf1 | Forward: GGCGCAGCACCTTTGGAGAATGTG Reverse: CATCGATGGTGAGAGGGGGCAGTTC | 133 | 60 °C | NM_001100708.1 |
| Nrf2 | Forward: GAGACGGCCATGACTGA Reverse: GTGAGGGGATCGATGAGTAA | 196 | 60 °C | NM_031789.2 |
| TNF-α | Forward: CCACGCTCTTCTGTCTACTG Reverse: GCTACGGGCTTGTCACTC | 145 | 60 °C | NM_012675.3 |
| IL-1β | Forward: TCTGTGACTCGTGGGATGAT Reverse: CTTCTTTGGGTATTGTTTGG | 181 | 60 °C | NM_031512.2 |
| β-actin | Reverse: CCCAGGCATTGCTGACAGGATG Forward: TGCTGGAAGGTGGACAGTGAGG | 144 | 60 °C | NM_031144.3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, R.; Liu, B.; Tian, L.; Jiang, X.; Li, X.; Cai, D.; Sun, J.; Bai, W.; Jin, Y. Exposure to Bisphenol A Caused Hepatoxicity and Intestinal Flora Disorder in Rats. Int. J. Mol. Sci. 2022, 23, 8042. https://doi.org/10.3390/ijms23148042
Liu R, Liu B, Tian L, Jiang X, Li X, Cai D, Sun J, Bai W, Jin Y. Exposure to Bisphenol A Caused Hepatoxicity and Intestinal Flora Disorder in Rats. International Journal of Molecular Sciences. 2022; 23(14):8042. https://doi.org/10.3390/ijms23148042
Chicago/Turabian StyleLiu, Ruijing, Boping Liu, Lingmin Tian, Xinwei Jiang, Xusheng Li, Dongbao Cai, Jianxia Sun, Weibin Bai, and Yulong Jin. 2022. "Exposure to Bisphenol A Caused Hepatoxicity and Intestinal Flora Disorder in Rats" International Journal of Molecular Sciences 23, no. 14: 8042. https://doi.org/10.3390/ijms23148042
APA StyleLiu, R., Liu, B., Tian, L., Jiang, X., Li, X., Cai, D., Sun, J., Bai, W., & Jin, Y. (2022). Exposure to Bisphenol A Caused Hepatoxicity and Intestinal Flora Disorder in Rats. International Journal of Molecular Sciences, 23(14), 8042. https://doi.org/10.3390/ijms23148042

