Circulating microRNAs as Potential Novel Diagnostic Biomarkers to Predict Drug Resistance in Temporal Lobe Epilepsy: A Pilot Study
Abstract
:1. Introduction
2. Results
2.1. Characterization of Selected Patients
2.2. miR-142, miR-146a, and miR-223 are Possible Diagnostic Circulating Molecules
2.3. miR-142 and miR-223 are Possible Prognostic Molecules for Drug-Resistant Subjects
2.4. Correlation Analysis of miRNA Expression
2.5. Prognostic miR-223 and miR-142 are Involved in the Control of Inflammation and Phagocytosis Processes
3. Discussion
3.1. miR-142, miR-146a, and miR-223 are Diagnostic Circulating Molecules
3.2. miR-142 and miR-223 are Prognostic Molecules for Drug-Resistant Subjects
3.3. miRNA Expression Correlates with Gender and Age of Onset of Epilepsy
3.4. Prognostic miR-223 and miR-142 are Involved in the Control of Inflammation and Phagocytosis Processes
4. Materials and Methods
4.1. Patient Recruitment
4.2. Serum Processing
4.3. RNA Extraction
4.4. RNA Reverse-Transcription
4.5. Real-Time Quantitative PCR (qRT-PCR)
4.6. MicroRNA Quantification Using qRT-PCR
4.7. Statistics
4.8. Bioinformatics Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Bernhardt, B.C.; Bonilha, L.; Gross, D.W. Network analysis for a network disorder: The emerging role of graph theory in the study of epilepsy. Epilepsy Behav. 2015, 50, 162–170. [Google Scholar] [CrossRef]
- Coan, A.C.; Campos, B.M.; Yasuda, C.L.; Kubota, B.Y.; Bergo, F.P.; Guerreiro, C.A.; Cendes, F. Frequent seizures are associated with a network of gray matter atrophy in temporal lobe epilepsy with or without hippocampal sclerosis. PLoS ONE 2014, 9, e85843. [Google Scholar] [CrossRef]
- Gambardella, A.; Labate, A.; Cifelli, P.; Ruffolo, G.; Mumoli, L.; Aronica, E.; Palma, E. Pharmacological modulation in mesial temporal lobe epilepsy: Current status and future perspectives. Pharmacol. Res. 2016, 113, 421–425. [Google Scholar] [CrossRef]
- Labate, A.; Cerasa, A.; Aguglia, U.; Mumoli, L.; Quattrone, A.; Gambardella, A. Neocortical thinning in “benign” mesial temporal lobe epilepsy. Epilepsia 2011, 52, 712–717. [Google Scholar] [CrossRef] [PubMed]
- Vaughan, D.N.; Rayner, G.; Tailby, C.; Jackson, G.D. MRI-negative temporal lobe epilepsy: A network disorder of neocortical connectivity. Neurology 2016, 87, 1934–1942. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Zhang, R.; Zhu, H.; Chen, F.; Yu, N.; Di, Q. Factors influencing the long-term prognosis of patients with temporal lobe epilepsy: A single center study. Ann. Palliat. Med. 2020, 9, 3194–3203. [Google Scholar] [CrossRef] [PubMed]
- Kwan, P.; Arzimanoglou, A.; Berg, A.T.; Brodie, M.J.; Hauser, W.A.; Mathern, G.; Moshé, S.L.; Perucca, E.; Wiebe, S.; French, J. Definition of drug resistant epilepsy: Consensus proposal by the ad hoc Task Force of the ILAE Commission on Therapeutic Strategies. Epilepsia 2010, 51, 1069–1077. [Google Scholar] [CrossRef]
- Pillai, R.S.; Bhattacharyya, S.N.; Artus, C.G.; Zoller, T.; Cougot, N.; Basyuk, E.; Bertrand, E.; Filipowicz, W. Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science 2005, 309, 1573–1576. [Google Scholar] [CrossRef] [Green Version]
- Henshall, D.C. MicroRNAs in the pathophysiology and treatment of status epilepticus. Front. Mol. Neurosci. 2013, 6, 37. [Google Scholar] [CrossRef] [Green Version]
- Yihong, M. The Challenge of microRNA as a Biomarker of Epilepsy. Curr. Neuropharmacol. 2018, 16, 37–42. [Google Scholar]
- Cava, C.; Manna, I.; Gambardella, A.; Bertoli, G.; Castiglioni, I. Potential Role of miRNAs as Theranostic Biomarkers of Epilepsy. Mol. Ther. Nucleic Acids 2018, 13, 275–290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rukov, J.L.; Shomron, N. MicroRNA pharmacogenomics: Post-transcriptional regulation of drug response. Trends Mol. Med. 2011, 17, 412–423. [Google Scholar] [CrossRef] [PubMed]
- Raoof, R.; Bauer, S.; Naggar, H.E.I.; Connolly, N.M.C.; Brennan, G.P.; Brindley, E.; Hill, T.; McArdle, H.; Spain, E.; Forster, R.J. Dual-center, dual-platform microRNA profiling identifies potential plasma biomarkers of adult temporal lobe epilepsy. EBioMedicine 2018, 38, 127–141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Korotkov, A.; Mills, J.D.; Gorter, J.A.; van Vliet, E.A.; Aronica, E. Systematic review and meta-analysis of differentially expressed miRNAs in experimental and human temporal lobe epilepsy. Sci. Rep. 2017, 7, 11592. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.Z.; Tian, Y.; Ander, B.P.; Xu, H.; Stamova, B.S.; Zhan, X.; Turner, R.J.; Jickling, G.; Sharp, F.R. Brain and blood microRNA expression profiling of ischemic stroke, intracerebral hemorrhage, and kainite seizures. J. Cereb. Blood Flow Metab. 2010, 30, 92–101. [Google Scholar] [CrossRef]
- Enright, N.; Simonato, M.; Henshall, D.C. Discovery and validation of blood microRNAs as molecular biomarkers of epilepsy: Ways to close current knowledge gaps. Epilepsia Open 2018, 3, 427–436. [Google Scholar] [CrossRef]
- Labate, A.; Aguglia, U.; Tripepi, G.; Mumoli, L.; Ferlazzo, E.; Baggetta, R.; Quattrone, A.; Gambardella, A. Long-term outcome of mild mesial temporal lobe epilepsy: A prospective longitudinal cohort study. Neurology 2016, 86, 1904–1910. [Google Scholar] [CrossRef]
- Aguglia, U.; Beghi, E.; Labate, A.; Condino, F.; Cianci, V.; Mumoli, L.; Gasparini, S.; Quattrone, A.; Gambardella, A. Age at onset predicts good seizure outcome in sporadic non-lesional and mesial temporal sclerosis based temporal lobe epilepsy. J. Neurol. Neurosurg. Psychiatry 2011, 82, 555–559. [Google Scholar] [CrossRef]
- Kretschmann, A.; Danis, B.; Andonovic, L.; Abnaof, K.; van Rikxoort, M.; Siegel, F.; Mazzuferi, M.; Godard, P.; Hanon, E.; Fröhlich, H.; et al. Different microRNA profiles in chronic epilepsy versus acute seizure mouse models. J. Mol. Neurosci. 2015, 55, 466–479. [Google Scholar] [CrossRef] [Green Version]
- Aronica, E.; Fluiter, K.; Iyer, A.; Zurolo, E.; Vreijling, J.; van Vliet, E.A.; Baayen, J.C.; Gorter, J.A. Expression pattern of miR-146a, an inflammation-associated microRNA, in experimental and human temporal lobe epilepsy. Eur. J. Neurosci. 2010, 31, 1100–1107. [Google Scholar] [CrossRef]
- Martins-Ferreira, R.; Chaves, J.; Carvalho, C.; Bettencourt, A.; Chorão, R.; Freitas, J.; Samões, R.; Boleixa, D.; Lopes, J.; Ramalheira, J.; et al. Circulating microRNAs as potential biomarkers for genetic generalized epilepsies: A three microRNA panel. Eur. J. Neurol. 2020, 27, 660–666. [Google Scholar] [CrossRef] [PubMed]
- Li, T.R.; Jia, Y.J.; Ma, C.; Qiu, W.J.; Wang, Q.; Shao, X.Q.; Lv, R.J. The role of the microRNA-146a/complement factor H/interleukin-1beta-mediated inflammatory loop circuit in the perpetuate inflammation of chronic temporal lobe epilepsy. Dis. Models Mech. 2018, 1, dmm031708. [Google Scholar] [CrossRef] [Green Version]
- Elnady, H.G.; Abdelmoneam, N.; Eissa, E.; Abdel Hamid, E.R.; Abu Zeid, D.; Abo-Shanab, A.M.; Atta, H.; Kholoussi, N.M. MicroRNAs as Potential Biomarkers for Childhood Epilepsy. Open Access Maced. J. Med. Sci. 2019, 7, 3965–3969. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dombkowski, A.A.; Cukovic, D.; Bagla, S.; McKenzie, J.; Caruso, J.A.; Chugani, H.T.; Chugani, D.C. TLR7 activation in epilepsy of tuberous sclerosis complex. Inflamm. Res. 2019, 68, 993–998. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moon, J.; Lee, S.T.; Choi, J.; Jung, K.H.; Yang, H.; Khalid, A.; Kim, J.M.; Park, K.I.; Shin, J.W.; Ban, J.J.; et al. Unique behavioral characteristics and microRNA signatures in a drug resistant epilepsy model. PLoS ONE 2014, 9, e85617. [Google Scholar] [CrossRef] [PubMed]
- Iori, V.; Aronica, E.; Vezzani, A. Epigenetic control of epileptogenesis by miR-146a. Oncotarget 2017, 8, 45040–45041. [Google Scholar] [CrossRef]
- Sun, W.; Shen, W.; Yang, S.; Hu, F.; Li, H.; Zhu, T.H. miR-223 and miR-142 attenuate hematopoietic cell proliferation, and miR-223 positively regulates miR-142 through LMO2 isoforms and CEBP-beta. Cell Res. 2010, 20, 1158–1169. [Google Scholar] [CrossRef] [Green Version]
- Singh, A.; Patro, P.S.; Aggarwal, A. MicroRNA-132, miR-146a, and miR-155 as potential biomarkers of methotrexate response in patients with rheumatoid arthritis. Clin. Rheumatol. 2019, 38, 877–884. [Google Scholar] [CrossRef]
- Wyatt-Johnson, S.K.; Brewster, A.L. Emerging Roles for Microglial Phagocytic Signaling in Epilepsy. Epilepsy Curr. 2020, 20, 33–38. [Google Scholar] [CrossRef] [Green Version]
- Lamar, K.J.; Carvill, G.L. Chromatin Remodeling Proteins in Epilepsy: Lessons from CHD2-Associated Epilepsy. Front. Mol. Neurosci. 2018, 11, 208. [Google Scholar] [CrossRef] [Green Version]
- Das, A.; Balan, S.; Banerjee, M. Drug resistance in epilepsy and the ABCB1 gene: The clinical perspective. Indian J. Hum. Genet. 2011, 17 (Suppl. 1), S12–S21. [Google Scholar] [PubMed] [Green Version]
- Brandt, C.; Bethmann, K.; Gastens, A.M.; Löscher, W. The multidrug transporter hypothesis of drug resistance in epilepsy: Proof-of-principle in a rat model of temporal lobe epilepsy. Neurobiol. Dis. 2006, 24, 202–211. [Google Scholar] [CrossRef] [PubMed]
- Riganti, C.; Salaroglio, I.C.; Pinzon-Daza, M.L.; Caldera, V.; Campia, I.; Kopecka, J.; Mellai, M.; Annovazzi, L.; Couraud, P.O.; Bosia, A.; et al. Temozolomide down-regulates P-glycoprotein in human blood-brain barrier cells by disrupting Wnt3 signaling. Cell Mol. Life Sci. 2014, 71, 499–516. [Google Scholar] [CrossRef] [PubMed]
- Ma, A.; Wang, C.; Chen, Y.; Yuan, W. P-glycoprotein alters blood-brain barrier penetration of antiepileptic drugs in rats with medically intractable epilepsy. Drug Des. Devel. Ther. 2013, 7, 1447–1454. [Google Scholar] [PubMed] [Green Version]
- Labate, A.; Cerasa, A.; Aguglia, U.; Mumoli, L.; Quattrone, A.; Gambardella, A. Voxel-based morphometry of sporadic epileptic patients with mesiotemporal sclerosis. Epilepsia 2010, 51, 506–510. [Google Scholar] [CrossRef] [PubMed]
- Engel, J., Jr. The etiologic classification of epilepsy. Epilepsia 2011, 52, 1195–1197. [Google Scholar] [CrossRef]
- Jenkinson, M.; Beckmann, C.F.; Behrens, T.E.; Woolrich, M.W.; Smith, S.M. FSL. Neuroimage 2012, 62, 782–790. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patenaude, B.; Smith, S.M.; Kennedy, D.N.; Jenkinson, M. A Bayesian model of shape and appearance for subcortical brain segmentation. Neuroimage 2011, 56, 907–922. [Google Scholar] [CrossRef] [Green Version]
- Schwarzenbach, H.; da Silva, A.M.; Calin, G.; Pantel, K. Data Normalization Strategies for MicroRNA Quantification. Clin. Chem. 2015, 61, 1333–1342. [Google Scholar] [CrossRef]
- Kroh, E.M.; Parkin, R.K.; Mitchell, P.S.; Tewari, M. Analysis of circulating microRNA biomarkers in plasma and serum using quantitative reverse transcription-PCR (qRT-PCR). Methods 2010, 50, 298–301. [Google Scholar] [CrossRef] [Green Version]
- Wei, T.; Simko, V. R Package “Corrplot”: Visualization of a Correlation Matrix; Version 0.84; 2017; Available online: https://github.com/taiyun/corrplot (accessed on 1 January 2021).
- Cava, C.; Colaprico, A.; Bertoli, G.; Graudenzi, A.; Silva, T.C.; Olsen, C.; Noushmehr, H.; Bontempi, G.; Mauri, G.; Castiglioni, I. SpidermiR: An R/Bioconductor Package for Integrative Analysis with miRNA Data. Int. J. Mol. Sci. 2017, 18, 274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bastian, M.; Heymann, S.; Jacomy, M. Gephi: An open source software for exploring and manipulating networks. In Proceedings of the Third International ICWSM Conference, San Jose, CA, USA, 17–20 May 2009; Volume 8, pp. 361–362. [Google Scholar]
- Sing, T.; Sander, O.; Beerenwinkel, N.; Lengauer, T. ROCR: Visualizing classifier performance in R. Bioinformatics 2005, 21, 3940–3941. [Google Scholar] [CrossRef] [PubMed]
Sample Name | Gender | Age (Years) | Age of Onset (Years) | Disease Duration (Years) | Pharmaco-Resistant | Vol Hipp Right mm3 | Vol Hipp Left mm3 |
---|---|---|---|---|---|---|---|
Epy 615 | M | 37 | 3 | 34 | Yes | 3200.31 | 3909.27 |
Epy 652 | F | 63 | 1 | 62 | Yes | 3455.74 | 3403.25 |
Epy 654 | M | 67 | 8 | 59 | Yes | nd | nd |
Epy 655 | M | 58 | 57 | 1 | No | 3547.00 | 3279.00 |
Epy 656 | F | 21 | 1 | 20 | No | 4349.42 | 4153.40 |
Epy 661 | F | 43 | 9 | 34 | Yes | 2644.52 | 3018.02 |
Epy 677 | M | 47 | 1 | 46 | Yes | 4035.11 | 3983.11 |
Epy 678 | F | 40 | 38 | 2 | Yes | 4701.02 | 3761.01 |
Epy 684 | F | 80 | 75 | 5 | No | 3799.00 | 3260.00 |
Epy 686 | F | 55 | 53 | 2 | No | 3101.64 | 3581.09 |
Epy 701 | M | 31 | 5 | 26 | Yes | 3615.99 | 3897.99 |
Epy 711 | F | 45 | 39 | 6 | No | 3441.01 | 2986.01 |
Epy 712 | M | 24 | 22 | 2 | No | 4028.64 | 3289.11 |
Epy 715 | F | 53 | 11 | 42 | No | 4040.45 | 4017.45 |
Epy 722 | M | 73 | nd | nd | No | 4825.33 | 3986.12 |
Epy 725 | M | 68 | 62 | 6 | No | 4411.59 | 4242.06 |
Epy 732 | F | 43 | 23 | 20 | No | 3034.62 | 3958.66 |
Epy 744 | F | 27 | 26 | 1 | Yes | 3351.00 | 3760.00 |
Epy 746 | M | 57 | 20 | 37 | No | 5673.10 | 5768.69 |
Epy 748 | M | 56 | 45 | 11 | No | 4231.99 | 4470.99 |
Epy 758 | F | 47 | 40 | 7 | Yes | 4540.00 | 4200.00 |
Epy 768 | F | 24 | 20 | 4 | No | 3615.99 | 3897.99 |
Epy 777 | M | 23 | 19 | 4 | No | 3724.39 | 3687.90 |
Epy 779 | M | 31 | 19 | 12 | No | 4094.99 | 3811.99 |
Epy 781 | F | 27 | 9 | 18 | No | 3442.62 | 3449.62 |
Epy 782 | F | 49 | 46 | 3 | No | nd | nd |
Epy 785 | F | 31 | 18 | 13 | Yes | 4070.56 | 4136.06 |
Serum Samples | Control (n = 20) | TLE (n = 27) | p-Value |
---|---|---|---|
Age, mean ± SD (years) | 47.5 ± 9.1 | 43.65 ± 17.07 | p > 0.05 |
Male, n (%) | 9 (45.0%) | 13 (48.1%) | p > 0.05 |
Age of onset, mean ± SD (years) | na | 24.39 ± 20.76 | |
Disease duration, mean ± SD (years) | na | 18.21 ± 17.86 | |
Etiology | |||
Drug-responsive, n (%) | 17 (62.97%) | ||
Drug-resistant, n (%) | 10 (37.03%) |
miR Base ID | NCBI Accession Number Gender | TaqMan Advanced miRNA Assay (ID) | Sequence of the Mature miRNA 5′------------------------3′ |
---|---|---|---|
Hsa-miR-146a-5p (miR-146a) | MI0000477 | 478399_mir | UGAGAACUGAAUUCCAUGGGUU |
Hsa-miR-142-5p (miR-142) | MI0000458 | 477911_mir | CAUAAAGUAGAAAGCACUACU |
Hsa-miR-223-3p (miR-223) | MI0000300 | 477983_mir | UGUCAGUUUGUCAAAUACCCCA |
Hsa-miR-132-3p (miR-132) | MI0000449 | 477900_mir | UAACAGUCUACAGCCAUGGUCG |
Hsa-miR-138-5p (miR-138) | MI0000476 | 477905_mir | AGCUGGUGUUGUGAAUCAGGCCG |
Hsa-miR-298 (miR-298) | MI0005523 | 478430_mir | AGCAGAAGCAGGGAGGUUCUCCCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Benedittis, S.; Fortunato, F.; Cava, C.; Gallivanone, F.; Iaccino, E.; Caligiuri, M.E.; Castiglioni, I.; Bertoli, G.; Manna, I.; Labate, A.; et al. Circulating microRNAs as Potential Novel Diagnostic Biomarkers to Predict Drug Resistance in Temporal Lobe Epilepsy: A Pilot Study. Int. J. Mol. Sci. 2021, 22, 702. https://doi.org/10.3390/ijms22020702
De Benedittis S, Fortunato F, Cava C, Gallivanone F, Iaccino E, Caligiuri ME, Castiglioni I, Bertoli G, Manna I, Labate A, et al. Circulating microRNAs as Potential Novel Diagnostic Biomarkers to Predict Drug Resistance in Temporal Lobe Epilepsy: A Pilot Study. International Journal of Molecular Sciences. 2021; 22(2):702. https://doi.org/10.3390/ijms22020702
Chicago/Turabian StyleDe Benedittis, Selene, Francesco Fortunato, Claudia Cava, Francesca Gallivanone, Enrico Iaccino, Maria Eugenia Caligiuri, Isabella Castiglioni, Gloria Bertoli, Ida Manna, Angelo Labate, and et al. 2021. "Circulating microRNAs as Potential Novel Diagnostic Biomarkers to Predict Drug Resistance in Temporal Lobe Epilepsy: A Pilot Study" International Journal of Molecular Sciences 22, no. 2: 702. https://doi.org/10.3390/ijms22020702