Mechanisms of the Cytotoxic Effect of Selenium Nanoparticles in Different Human Cancer Cell Lines
Abstract
:1. Introduction
2. Results
2.1. SeNP Concentration-Dependently Decreased Vitality and Proliferative Properties of Various Human Cancer Cell Lines, but Does Not Affect Normal Cells
2.2. SeNP Concentration-Dependently Caused Cancer Cell Apoptosis, but Not Necrosis
2.3. SeNP Enhanced the Expression of Pro-Apoptotic Genes in Almost All Cancer Cell Lines, with the Exception of Caco-2 and Activated Various Pathways of Adaptive and Pro-Apoptotic Signaling Pathways of UPR
2.4. SeNP Had Different Effects on the Expression of ER-Resident Selenoproteins and Selenium-Containing Glutathione Peroxidases and Thioredoxin Reductases, Depending on the Cell Line
2.5. SeNP Triggered Ca2+ Signals in All Investigated Cancer Cell Lines
3. Discussion
4. Materials and Methods
4.1. Preparation and Characterization of SeNP
4.2. Cell Culture and Reagents
4.3. Cell Proliferation and Viability Assay
4.4. Apoptosis/Necrosis Detection Assay
4.5. Total RNA Isolation, Reverse Transcription and Real-Time Quantitative PCR
4.6. Western Blot
4.7. Recording Changes in Intracellular Ca2+
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
ATF4 | activating transcription factor-4 |
ATF6 | activating transcription factor-6 |
BAK-BAX-BIM-BCL-2 | interacting mediator of cell death |
CHOP | CCAAT/enhancer-binding protein-homologous protein |
ER | endoplasmic reticulum |
GADD34 | growth arrest and DNA damage gene-34 |
GPX | glutathione peroxidase |
IRE1 | inositol-requiring enzyme-1 |
MAPK3K5 | mitogen-activated protein kinase kinase kinase 5 |
MAPK-8 | mitogen-activated protein kinase 8 |
PERK | Protein kinase-like ER kinase |
PUMA | p53 up-regulated modulator of apoptosis |
SELENO | selenoprotein; SeNP-selenium nanoparticles |
TXNRD | thioredoxin reductase |
UPR | unfolded protein response |
XBP1 | X-box binding protein-1 |
References
- Vinceti, M.; Filippini, T.; Cilloni, S.; Crespi, C.M. The epidemiology of selenium and human cancer. Adv. Cancer Res. 2017, 136, 1–48. [Google Scholar] [CrossRef] [PubMed]
- Jabłońska, E.; Reszka, E. Selenium and Epigenetics in Cancer: Focus on DNA Methylation. Adv. Cancer Res. 2017, 136, 193–234. [Google Scholar] [CrossRef] [PubMed]
- Goltyaev, M.V.; Mal’tseva, V.N.; Varlamova, E.G. Expression of ER resident selenoproteins and activation of cancer cells apoptosis mechanisms under ER stress conditions caused by methylseleninic acid. Gene 2020, 755, 144884. [Google Scholar] [CrossRef] [PubMed]
- Varlamova, E.G.; Goltyaev, M.V.; Kuznetsova, J.P. Effect of sodium selenite on gene expression of SELF, SELW, and TGR selenoproteins in adenocarcinoma cells of the human prostate. Mol. Biol. 2018, 52, 519–526. [Google Scholar] [CrossRef]
- Kuznetsova, Y.P.; Goltyaev, M.V.; Gorbacheva, O.S.; Novoselov, S.V.; Varlamova, E.G.; Fesenko, E.E. Influence of sodium selenite on the mRNA expression of the mammalian selenocysteine–containing protein genes in testicle and prostate cancer cells. Dokl. Biochem. Biophys. 2018, 480, 131–134. [Google Scholar] [CrossRef] [PubMed]
- Lafin, J.T.; Sarsour, E.H.; Kalen, A.L.; Wagner, B.A.; Buettner, G.R.; Goswami, P.C. Methylseleninic acid induces lipid peroxidation and radiation sensitivity in head and neck cancer cells. Int. J. Mol. Sci. 2019, 20, 225. [Google Scholar] [CrossRef] [Green Version]
- Qiu, C.; Zhang, T.; Zhu, X.; Qiu, J.; Jiang, K.; Zhao, G.; Wu, H.; Deng, G. Methylseleninic Acid suppresses breast cancer growth via the JAK2/STAT3 pathway. Reprod. Sci. 2019, 26, 829–838. [Google Scholar] [CrossRef]
- Collery, P. Strategies for the development of selenium–based anticancer drugs. J. Trace Elem. Med. Biol. 2018, 50, 498–507. [Google Scholar] [CrossRef]
- Hatfield, D.L.; Yoo, M.-H.; Carlson, B.A.; Gladyshev, V.N. Selenoproteins that function in cancer prevention and promotion. Biochim. Biophys. Acta 2009, 1790, 1541–1545. [Google Scholar] [CrossRef] [Green Version]
- Yakubov, E.; Buchfelder, M.; Eyüpoglu, I.Y.; Savaskan, N.E. Selenium action in neuro–oncology. Biol. Trace Elem. Res. 2014, 161, 246–254. [Google Scholar] [CrossRef]
- Sosa, V.; Moliné, T.; Somoza, R.; Paciucci, R.; Kondoh, H.; LLeonart, M.E. Oxidative stress and cancer: An overview. Ageing Res. Rev. 2013, 12, 376–390. [Google Scholar] [CrossRef]
- Gudkov, S.V.; Shafeev, G.A.; Glinushkin, A.P.; Shkirin, A.V.; Barmina, E.V.; Rakov, I.I.; Simakin, A.V.; Kislov, A.V.; Astashev, M.E.; Vodeneev, V.A.; et al. Production and use of selenium nanoparticles as fertilizers. ACS Omega 2020, 5, 17767–17774. [Google Scholar] [CrossRef] [PubMed]
- Maiyo, F.; Singh, M. Selenium nanoparticles: Potential in cancer gene and drug delivery. Nanomedicine 2017, 12, 1075–1089. [Google Scholar] [CrossRef] [PubMed]
- Xuan, G.; Zhang, M.; Chen, Y.; Huang, S.; Lee, I. Design and characterization of a cancER targeted drug co–delivery system composed of liposomes and selenium nanoparticles. J. Nanosci. Nanotechnol. 2020, 20, 5295–5304. [Google Scholar] [CrossRef]
- Xia, Y.; Tang, G.; Wang, C.; Zhong, J.; Chen, Y.; Hua, L.; Li, Y.; Liu, H.; Zhu, B. Functionalized selenium nanoparticles for targeted siRNA delivery silence Derlin1 and promote antitumor efficacy against cervical cancer. Drug Deliv. 2020, 27, 15–25. [Google Scholar] [CrossRef] [Green Version]
- Shahverdi, A.R.; Shahverdi, F.; Faghfuri, E.; Khoshayand, M.R.; Mavandadnejad, F.; Yazdi, M.H.; Amini, M. Characterization of folic acid surface–coated selenium nanoparticles and corresponding in vitro and in vivo effects against breast cancer. Arch. Med. Res. 2018, 49, 10–17. [Google Scholar] [CrossRef]
- Huang, Y.; He, L.; Liu, W.; Fan, C.; Zheng, W.; Wong, Y.-S.; Chen, T. Selective cellular uptake and induction of apoptosis of cancER targeted selenium nanoparticles. Biomaterials 2013, 34, 7106–7116. [Google Scholar] [CrossRef]
- Kumar, G.S.; Kulkarni, A.; Khurana, A.; Kaur, J.; Tikoo, K. Selenium nanoparticles involve HSP–70 and SIRT1 in preventing the progression of type 1 diabetic nephropathy. Chem. Biol. Interact. 2014, 223, 125–133. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Wei, W.; Zhang, S.Y.; Shen, Y.X.; Yue, L.; Wang, N.P.; Xu, S.Y. Melatonin-selenium nanoparticles inhibit oxidative stress and protect against hepatic injury induced by Bacillus Calmette–Guérin/lipopolysaccharide in mice. J. Pineal Res. 2005, 39, 156–163. [Google Scholar] [CrossRef] [PubMed]
- Huang, B.; Zhang, J.; Hou, J.; Chen, C. Free radical scavenging efficiency of Nano–Se in vitro. Free Radic. Biol. Med. 2003, 35, 805–813. [Google Scholar] [CrossRef]
- Khurana, A.; Tekula, S.; Saifi, M.A.; Venkatesh, P.; Godugu, C. Therapeutic applications of selenium nanoparticles. Biomed. Pharmacother. 2019, 111, 802–812. [Google Scholar] [CrossRef]
- He, L.; Zeng, L.; Mai, X.; Shi, C.; Luo, L.; Chen, T. Nucleolin–targeted selenium nanocomposites with enhanced theranostic efficacy to antagonize glioblastoma. J. Mater. Chem. B 2017, 5, 3024–3034. [Google Scholar] [CrossRef]
- Ferreir, L.M.; Azambuja, J.H.; da Silveira, E.F.; Marcondes Sari, M.H.; da Cruz Weber Fulco, B.; Costa Prado, V.; Gelsleichter, N.E.; Beckenkamp, L.R.; da Cruz Fernandes, M.; Spanevello, R.M.; et al. Antitumor action of diphenyl diselenide nanocapsules: In vitro assessments and preclinical evidence in an animal model of glioblastoma multiforme. J. Trace Elem. Med. Biol. 2019, 55, 180–189. [Google Scholar] [CrossRef]
- Bowen, A.R.; Hanks, A.N.; Murphy, K.J.; Florell, S.R.; Grossman, D. Proliferation, apoptosis, and surviving expression in keratinocytic neoplasms and hyperplasia. Am. J. Dermatopathol. 2004, 26, 177–181. [Google Scholar] [CrossRef] [Green Version]
- Wong, R.S. Apoptosis in cancer: From pathogenesis to treatment. J. Exp. Clin. Cancer Res. 2011, 30, 87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, L.; Liu, C.; Lu, Y.; Liu, L.; Jiang, Y. ER stress related factor ATF6 and caspase–12 trigger apoptosis in neonatal hypoxic–ischemic encephalopathy. Int. J. Clin. Exp. Pathol. 2015, 8, 6960–6966. [Google Scholar] [PubMed]
- Logue, S.E.; Cleary, P.; Saveljeva, S.; Samali, A. New directions in ER stress–induced cell death. Apoptosis 2013, 18, 537–546. [Google Scholar] [CrossRef]
- Sano, R.; Reed, J.C. ER stress–induced cell death mechanisms. Biochim. Biophys. Acta 2013, 1833, 3460–3470. [Google Scholar] [CrossRef] [Green Version]
- Urra, H.; Dufey, E.; Lisbona, F.; Rojas–Rivera, D.; Hetz, C. When ER stress reaches a dead end. Biochim. Biophys. Acta 2013, 1833, 3507–3517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murata, T.; Shinozuka, Y.; Obata, Y.; Yokoyama, K.K. Phosphorylation of two eukaryotic transcription factors, Jun dimerization protein 2 and activation transcription factor 2, in Escherichia coli by Jun N–terminal kinase 1. Anal. Biochem. 2008, 115–121. [Google Scholar] [CrossRef]
- Harding, H.P.; Zhang, Y.; Ron, D. Protein translation and folding are coupled by an endoplasmic–reticulum–resident kinase. Nature 1999, 397, 271–274. [Google Scholar] [CrossRef]
- Schroder, M.; Kaufman, R.J. The mammalian unfolded protein response. Ann. Rev. Biochem. 2005, 74, 739–789. [Google Scholar] [CrossRef] [PubMed]
- Szegezdi, E.; Loguem, S.E.; Gorman, A.M.; Samali, A. Mediators of endoplasmic reticulum stress–induced apoptosis. EMBO Rep. 2006, 7, 880–885. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ni, M.; Lee, A.S. ER chaperones in mammalian development and human diseases. FEBS Lett. 2007, 581, 3641–3651. [Google Scholar] [CrossRef] [Green Version]
- Okada, T.; Yoshida, H.; Akazawa, R.; Negishi, M.; Mori, K. Distinct roles of activating transcription factor 6 (ATF6) and double stranded RNA–activated protein kinase–like endoplasmic reticulum kinase (PERK) in transcription during the mammalian unfolded protein response. Biochem. J. 2002, 366, 585–594. [Google Scholar] [CrossRef]
- Lee, K.; Tirasophon, W.; Shen, X.; Michalak, M.; Prywes, R.; Okada, T.; Yoshida, H.; Mori, K.; Kaufman, R.J. IRE1–mediated unconventional mRNA splicing and S2P–mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response. Genes Dev. 2002, 16, 452–466. [Google Scholar] [CrossRef] [Green Version]
- Dikiy, A.; Novoselov, S.V.; Fomenko, D.E.; Sengupta, A.; Carlson, B.A.; Cerny, R.L.; Ginalski, K.; Grishin, N.V.; Hatfield, D.L.; Gladyshev, V.N. SelT, SelW, SelH, and Rdx12: Genomics and molecular insights into the functions of selenoproteins of a novel Trx–like family. J. Biochem. 2007, 4, 6871–6882. [Google Scholar] [CrossRef]
- Huang, J.Q.; Ren, F.Z.; Jiang, Y.Y.; Lei, X. Characterization of Selenoprotein M and Its Response to Selenium Deficiency in Chicken Brain. Biol. Trace Elem. Res. 2016, 170, 449–458. [Google Scholar] [CrossRef]
- Reeves, M.A.; Bellinger, F.P.; Berry, M.J. The neuroprotective functions of selenoprotein M and its role in cytosolic calcium regulation. Antioxid. Redox. Signal. 2010, 12, 809–818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hwang, C.; Sinskey, A.J.; Lodish, H.F. Oxidized redox state of glutathione in the endoplasmic reticulum. Science 1992, 257, 1496–1502. [Google Scholar] [CrossRef] [PubMed]
- Shchedrina, V.A.; Everley, R.A.; Zhang, Y.; Gygi, S.P.; Hatfield, D.L.; Gladyshev, V.N. Selenoprotein K binds multiprotein complexes and is involved in the regulation of endoplasmic reticulum homeostasis. J. Biol. Chem. 2011, 286, 42937–42948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ye, Y.; Shibata, Y.; Kikkert, M.; van Voorden, S.; Wiertz, E.; Rapoport, T.A. Recruitment of the p97 ATPase and ubiquitin ligases to the site of retrotranslocation at the endoplasmic reticulum membrane. Proc. Natl. Acad. Sci. USA 2005, 102, 14132–14138. [Google Scholar] [CrossRef] [Green Version]
- Ballar, P.; Shen, Y.; Yang, H.; Fang, S. The role of a novel p97/valosin–containing protein–interacting motif of gp78 in endoplasmic reticulum–associated degradation. J. Biol. Chem. 2006, 281, 35359–35368. [Google Scholar] [CrossRef] [Green Version]
- Doroudgar, S.; Vlkers, M.; Thuerauf, D.J.; Khan, M.; Mohsin, S.; Respress, J.L.; Wang, W.; Gude, N.; Meller, O.J.; Wehrens, X.H.; et al. Hrd1 and ER associated protein degradation, ERAD, are critical elements of the adaptive ER stress response in cardiac myocytes. Circ. Res. 2015, 117, 536–546. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.H.; Kwon, J.H.; Jeon, Y.H.; Ko, K.Y.; Lee, S.-R.; Kim, I.Y. Pro–178 and Pro–183 of selenoprotein S are essential residues for interaction with p97 (VCP) during endoplasmic reticulum–associated degradation. J. Biol. Chem. 2014, 289, 13758–13768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferguson, A.D.; Labunskyy, V.M.; Fomenko, D.E.; Araç, D.; Chelliah, Y.; Amezcua, C.A.; Rizo, J.; Gladyshev, V.N.; Deisenhofer, J. NMR structures of the selenoproteins Sep15 and SelM reveal redox activity of a new Trx–like family. J. Biol. Chem. 2006, 281, 3536–3543. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toby, G.G.; Gherraby, W.; Coleman, T.R.; Golemis, E.A. A novel RING finger protein, human enhancer of invasion 10, alters mitotic progression through regulation of cyclin B levels. Mol. Cell. Biol. 2003, 23, 2109–2122. [Google Scholar] [CrossRef] [Green Version]
- Singh, M.K.; Nicolas, E.; Gherraby, W.; Dadke, D.; Lessin, S.; Golemis, E.A. He110 negatively regulates cell invasion by inhibiting cyclin B/cdk1 and other promotility proteins. Oncogene 2007, 26, 4825–4832. [Google Scholar] [CrossRef] [Green Version]
- Hamieh, A.; Cartier, D.; Abid, H.; Calas, A.; Burel, C.; Bucharles, C.; Jehan, C.; Grumolato, L.; Landry, M.; Lerouge, P.; et al. Selenoprotein T is a novel OST subunit that regulates UPR signaling and hormone secretion. EMBO Rep. 2017, 18, 1935–1946. [Google Scholar] [CrossRef]
- Grumolato, L.; Ghzili, H.; Montero–Hadjadje, M.; Gasman, S.; Lesage, J.; Tanguy, Y.; Galas, L.; Ait–Ali, D.; Leprince, J.; Guérineau, N.C.; et al. Selenoprotein T is a PACAP–regulated gene involved in intracellular Ca2+ mobilization and neuroendocrine secretion. FASEB J. 2008, 22, 1756–1768. [Google Scholar] [CrossRef] [PubMed]
- Gereben, B.; Zavacki, A.M.; Ribich, S.; Kim, B.W.; Huang, S.A.; Simonides, W.S.; Zeöld, A.; Bianco, A.C. Cellular and molecular basis of deiodinase–regulated thyroid hormone signaling. Endocr. Rev. 2008, 29, 898–938. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kahaly, G.J.; Dillmann, W.H. Thyroid hormone action in the heart. Endocr. Rev. 2005, 26, 704–728. [Google Scholar] [CrossRef] [Green Version]
- Ekoue, D.N.; He, C.; Diamond, A.M.; Bonini, M.G. Manganese superoxide dismutase and glutathione peroxidase–1 contribute to the rise and fall of mitochondrial reactive oxygen species which drive oncogenesis. Biochim. Biophys. Acta Bioenerg. 2017, 1858, 628–632. [Google Scholar] [CrossRef] [PubMed]
- DeBernardi, M.A.; Brooker, G. High–content kinetic calcium imaging in drug–sensitive and drug–resistant human breast cancer cells. Methods Enzymol. 2006, 414, 317–335. [Google Scholar] [CrossRef]
- Anderson, J.M.; Van Itallie, C.M. Physiology and function of the tight junction. Cold Spring Harb. Perspect. Biol. 2009, 1, a002584. [Google Scholar] [CrossRef]
- Shen, L.; Weber, C.R.; Raleigh, D.R.; Yu, D.; Turner, J.R. Tight junction pore and leak pathways: A dynamic duo. Annu. Rev. Physiol. 2011, 73, 283–309. [Google Scholar] [CrossRef] [Green Version]
- Van Itallie, C.M.; Anderson, J.M. Claudin interactions in and out of the tight junction. Tissue Barriers 2013, 1, e25247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Samak, G.; Gangwar, R.; Meena, A. Calcium Channels and Oxidative Stress Mediate a Synergistic Disruption of Tight Junctions by Ethanol and Acetaldehyde in Caco-2 Cell Monolayers. Sci. Rep. 2016, 6, 38899. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pitts, M.W.; Hoffmann, P.R. Endoplasmic reticulum–resident selenoproteins as regulators of calcium signaling and homeostasis. Cell Calcium 2018, 70, 76–86. [Google Scholar] [CrossRef] [PubMed]
- Sharapov, M.G.; Novoselov, V.I.; Penkov, N.V.; Fesenko, E.E.; Vedunova, M.V.; Bruskov, V.I.; Gudkov, S.V. Protective and adaptogenic role of peroxiredoxin 2 (Prx2) in neutralization of oxidative stress induced by ionizing radiation. Free Radic. Biol. Med. 2019, 134, 76–86. [Google Scholar] [CrossRef]
Gene Name | Forward Primer 5′->3′ | Reverse Primer 5′->3′ |
---|---|---|
GAPDH | ACATCGCTCAGACACCATG | GCCAGTGAGCTTCCCGTT |
SELENOT | TCTCCTAGTGGCGGCGTC | GTCTATATATTGGTTGAGGGAGG |
SELENOM | AGCCTCCTGTTGCCTCCGC | AGGTCAGCGTGGTCCGAAG |
SELENOF | TACGGTTGTTGTTGGCGAC | CAAATTGTGCTTCCTCCTGAC |
SELENOK | TTTACATCTCGAACGGACAAG | CAGCCTTCCACTTCTTGATG |
SELENOS | TGGGACAGCATGCAAGAAG | GCGTCCAGGTCTCCAGG |
SELENON | TGATCTGCCTGCCCAATG | TCAGGAACTGCATGTAGGTGG |
DIO2 | AGCTTCCTCCTCGATGCC | AAAGGAGGTCAAGTGGCTG |
CHOP | GCTCTGATTGACCGAATGG | TCTGGGAAAGGTGGGTAGTG |
GADD34 | CTCCGAGAAGGTCACTGTCC | GACGAGCGGGAAGGTGTGG |
PUMA | CAGATATGCGCCCAGAGAT | CCATTCGTGGGTGGTCTTC |
BIM | GGACGACCTCAACGCACAGTACGAG | GTAAGGGCAGGAGTCCCA |
ATF-4 | GTGTTCTCTGTGGGTCTGCC | GACCCTTTTCTTCCCCCTTG |
ATF-6 | AACCCTAGTGTGAGCCCTGC | GTTCAGAGCACCCTGAAGA |
XBPu | ACTCAGACTACGTGCACCTC | GTCAATACCGCCAGAATCC |
XBPs | CTGAGTCCGCAGCGGTGCAGG | GGTCCAAGTTGTCCAGAATG |
CAS-3 | GCATTGAGACAGACAGTGGTG | AATAGAGTTCTTTTGTGAGCATG |
CAS-4 | CACGCCTGGCTCTCATCATA | TAGCAAATGCCCTCAGCG |
MAP3K5 | AACACCTGAAGCTTAAGTCCC | TCAATGATAGCCTTCCACAGTG |
MAPK-8 | AAAGGGAACACACAATAGAAGAG | GCTGCTGCTTCTAGACTG |
BAX | GGGCTGGACATTGGACTTC | AACACAGTCCAAGGCAGCTG |
BAK | GAGAGTGGCATCAATTGGGG | CAGCCACCCCTCTGTGCAATCCA |
GPX1 | CTACTTATCGAGAATGTGGCG | CGAAGAGCATGAAGTTGGG |
GPX2 | CCCTTCCGACGCTACAGCCG | GGAGCCCAAGTTGAATCACC |
GPX3 | CCCCCACTCCTACTTCCTG | CCGAAGGAGCAGGGGTGG |
GPX4 | CCATGCACGAGTTTTCCG | AATTTGACGTTGTAGCCCG |
TXNRD1 | GGTCTGGCAGCTGCTAAGG | TAGCCCCAATTCAAAGAGC |
TXNRD2 | TGGGTGTGGCAGTGGGAGAC | TCCCCTGAGCCATCCCTGTG |
TXNRD3 | CCTTTGCTTTGTTGTTTCTGTG | TAGTGAGTGTGAGGGTGAAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Varlamova, E.G.; Goltyaev, M.V.; Mal’tseva, V.N.; Turovsky, E.A.; Sarimov, R.M.; Simakin, A.V.; Gudkov, S.V. Mechanisms of the Cytotoxic Effect of Selenium Nanoparticles in Different Human Cancer Cell Lines. Int. J. Mol. Sci. 2021, 22, 7798. https://doi.org/10.3390/ijms22157798
Varlamova EG, Goltyaev MV, Mal’tseva VN, Turovsky EA, Sarimov RM, Simakin AV, Gudkov SV. Mechanisms of the Cytotoxic Effect of Selenium Nanoparticles in Different Human Cancer Cell Lines. International Journal of Molecular Sciences. 2021; 22(15):7798. https://doi.org/10.3390/ijms22157798
Chicago/Turabian StyleVarlamova, Elena G., Mikhail V. Goltyaev, Valentina N. Mal’tseva, Egor A. Turovsky, Ruslan M. Sarimov, Alexander V. Simakin, and Sergey V. Gudkov. 2021. "Mechanisms of the Cytotoxic Effect of Selenium Nanoparticles in Different Human Cancer Cell Lines" International Journal of Molecular Sciences 22, no. 15: 7798. https://doi.org/10.3390/ijms22157798
APA StyleVarlamova, E. G., Goltyaev, M. V., Mal’tseva, V. N., Turovsky, E. A., Sarimov, R. M., Simakin, A. V., & Gudkov, S. V. (2021). Mechanisms of the Cytotoxic Effect of Selenium Nanoparticles in Different Human Cancer Cell Lines. International Journal of Molecular Sciences, 22(15), 7798. https://doi.org/10.3390/ijms22157798