Decorin—An Antagonist of TGF-β in Astrocytes of the Optic Nerve
Abstract
:1. Introduction
2. Results
2.1. Expression of Growth Factors Is Increased in the ON of DCN-Deficient Mice
2.2. Astrocytes of the ON and ONH Produce DCN
2.3. Reciprocal Negative Regulation of TGF-β and DCN in Human ONH Astrocytes and Murine ON Astrocytes
2.4. DCN Suppresses TGF-β and CTGF/CCN2 Expression via the pAKT/AKT Signaling Pathway
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Cell Culture
4.3. RNA Analysis
4.4. Western Blot Analysis
4.5. Dot Blot Analysis
4.6. Immunofluorescence
4.7. Number of Experiments and Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Primer | Species | Orientation | Sequence 5′ to 3′ | Position |
|---|---|---|---|---|
| COL IV a2 | Homo sapiens | forward reverse | acaggacagaaaggagacca ggtgtgatgcctgggaac | 4019–4038 4104–4087 |
| CTGF | Homo sapiens | forward reverse | ctcctgcaggctagagaagc gatgcactttttgcccttctt | 878–897 971–951 |
| DCN | Homo sapiens | forward reverse | tcgagtggtccagtgttctg cctttttggtgttgtgtcca | 280–299 384–365 |
| FN | Homo sapiens | forward reverse | ccctgattggaaggaaaaaga atgaagattggggtgtggaa | 6217–6237 6284–6265 |
| RACK1 | Homo sapiens | forward reverse | ctagaatgatctttccctctaaatcc cctaaccgctactggctgtg | 170–188 241–222 |
| TGF-β 1 | Homo sapiens | forward reverse | gcagcacgtggagctgta cagccggttgctgaggta | 1373–1390 1436–1419 |
| TGF-β 2 | Homo sapiens | forward reverse | ccaaagggtacaatgccaac cagatgcttctggatttatggtatt | 2379–2398 2492–2468 |
| COL IV a2 | Mus musculus | forward reverse | ctgggttcccaggattca agagtctcctttattcctttgg | 1917–1934 1990–1968 |
| CTGF | Mus musculus | forward reverse | tgacctggaggaaaacattaaga agccctgtatgtcttcacactg | 1013–1035 1124–1103 |
| DCN | Mus musculus | forward reverse | gagggaactccacttggaca ttgttgttgtgaaggtagacgac | 1039–1058 1112–1134 |
| RACK1 | Mus musculus | forward reverse | tctgcaagtacacggtccag gagacgatgatagggttgctg | 514–533 604–584 |
| FN | Mus musculus | forward reverse | cggagagagtgcccctacta cgatattggtgaatcgcaga | 4327–436 4403–4384 |
| TGF-β 1 | Mus musculus | forward reverse | tggagcaacatgtggaactc gtcagcagccggttacca | 1358–1377 1430–1413 |
| TGF-β 2 | Mus musculus | forward reverse | tcttccgcttgcaaaacc gtgggagatgttaagtctttgga | 5361–5378 5451–5429 |
References
- Quigley, H.A.; Broman, A.T. The number of people with glaucoma worldwide in 2010 and 2020. Br. J. Ophthalmol. 2006, 90, 262–267. [Google Scholar] [CrossRef] [Green Version]
- Resnikoff, S.; Pascolini, D.; Etya’Ale, D.; Kocur, I.; Pararajasegaram, R.; Pokharel, G.P.; Mariotti, S.P. Global data on visual impairment in the year 2002. Bull. World Health Organ. 2004, 82, 844–851. [Google Scholar]
- Gharahkhani, P.; Jorgenson, E.; Hysi, P.; Khawaja, A.P.; Pendergrass, S.; Han, X.; Ong, J.S.; Hewitt, A.W.; Segrè, A.V.; Rouhana, J.M.; et al. Genome-wide meta-analysis identifies 127 open-angle glaucoma loci with consistent effect across ancestries. Nat. Commun. 2021, 12, 1–16. [Google Scholar] [CrossRef]
- Choquet, H.; Paylakhi, S.; Kneeland, S.C.; Thai, K.K.; Hoffmann, T.J.; Yin, J.; Kvale, M.N.; Banda, Y.; Tolman, N.G.; Williams, P.A.; et al. A multiethnic genome-wide association study of primary open-angle glaucoma identifies novel risk loci. Nat. Commun. 2018, 9, 1–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gordon, M.O.; Beiser, J.A.; Brandt, J.D.; Heuer, D.K.; Higginbotham, M.D.; Johnson, C.A.; Keltner, J.L.; Miller, J.P.; Parrish, R.K., II. Ocular Hypertension Treatment Study Group; et al. The Ocular Hypertension Treatment Study: Baseline factors that predict the onset of primary open-angle glaucoma. Arch. Ophthalmol. 2002, 120, 714–720. [Google Scholar] [CrossRef] [PubMed]
- The AGIS Investigators. The advanced glaucoma intervention study (AGIS): 7. The relationship between control of intraocular pressure and visual field deterioration. Am. J. Ophthalmol. 2000, 130, 429–440. [Google Scholar] [CrossRef]
- Collaborative Normal-Tension Glaucoma Study Group. Comparison of glaucomatous progression between untreated patients with normal-tension glaucoma and patients with therapeutically reduced intraocular pressures. Am. J. Ophthalmol. 1998, 12, 487–497. [Google Scholar]
- Collaborative Normal-Tension Glaucoma Study Group. The effectiveness of intraocular pressure reduction in the treatment of normal-tension glaucoma. Am. J. Ophthalmol. 1998, 126, 498–505. [Google Scholar] [CrossRef]
- Leske, M.C.; Heijl, A.; Hussein, M.; Bengtsson, B.; Hyman, L.; Komaroff, E.; Early Manifest Glaucoma Trial Group. Factors for glaucoma progression and the effect of treatment: The early manifest glaucoma trial. Arch. Ophthalmol. 2003, 121, 48–56. [Google Scholar] [CrossRef] [PubMed]
- Quigley, H.A. The contribution of the sclera and lamina cribrosa to the pathogenesis of glaucoma: Diagnostic and treatment implications. Prog. Brain Res. 2015, 220, 59–86. [Google Scholar]
- Ransom, B.; Behar, T.; Nedergaard, M. New roles for astrocytes (stars at last). Trends Neurosci. 2003, 26, 520–522. [Google Scholar] [CrossRef]
- Hernandez, M.R. Ultrastructural immunocytochemical analysis of elastin in the human lamina cribrosa. Changes in elastic fibers in primary open-angle glaucoma. Investig. Ophthalmol. Vis. Sci. 1992, 33, 2891–2903. [Google Scholar]
- Hernandez, M.R.; Agapova, O.A.; Yang, P.; Salvador-Silva, M.; Ricard, C.S.; Aoi, S. Differential gene expression in astrocytes from human normal and glaucomatous optic nerve head analyzed by cDNA microarray. Glia 2002, 38, 45–64. [Google Scholar] [CrossRef]
- Hernandez, M.; Ye, H.; Roy, S. Collagen Type IV Gene Expression in Human Optic Nerve Heads with Primary Open Angle Glaucoma. Exp. Eye Res. 1994, 59, 41–52. [Google Scholar] [CrossRef]
- Schwab, J.M.; Postler, E.; Nguyen, T.D.; Mittelbronn, M.; Meyermann, R.; Schluesener, H.J. Connective tissue growth factor is expressed by a subset of reactive astrocytes in human cerebral infarction. Neuropathol. Appl. Neurobiol. 2000, 26, 434–440. [Google Scholar] [CrossRef]
- Stöckli, K.A.; Lottspeich, F.; Sendtner, M.; Masiakowski, P.; Carroll, P.; Götz, R.; Lindholm, D.; Thoenen, H. Molecular cloning, expression and regional distribution of rat ciliary neurotrophic factor. Nat. Cell Biol. 1989, 342, 920–923. [Google Scholar] [CrossRef] [PubMed]
- Varela, H.J.; Hernandez, M.R. Astrocyte responses in human optic nerve head with primary open-angle glaucoma. J. Glaucoma 1997, 6, 303–313. [Google Scholar] [CrossRef] [PubMed]
- Hernandez, M.R.; Pena, J.D. The optic nerve head in glaucomatous optic neuropathy. Arch. Ophthalmol. 1997, 115, 389–395. [Google Scholar] [CrossRef] [PubMed]
- Netland, P.A.; Ye, H.; Streeten, B.W.; Hernandez, M.R. Elastosis of the lamina cribrosa in pseudoexfoliation syndrome with glaucoma. Ophthalmology 1995, 102, 878–886. [Google Scholar] [CrossRef]
- Pena, J.D.; Netland, P.A.; Vidal, I.; Dorr, D.A.; Rasky, A.; Hernandez, M. Elastosis of the Lamina Cribrosa in Glaucomatous Optic Neuropathy. Exp. Eye Res. 1998, 67, 517–524. [Google Scholar] [CrossRef] [PubMed]
- Quigley, H.A.; Brown, A.; Dorman-Pease, M.E. Alterations in elastin of the optic nerve head in human and experimental glaucoma. Br. J. Ophthalmol. 1991, 75, 552–557. [Google Scholar] [CrossRef] [Green Version]
- Quigley, H.A.; Pease, M.; Brown, A.E. Quantitative study of collagen and elastin of the optic nerve head and sclera in human and experimental monkey glaucoma. Curr. Eye Res. 1991, 10, 877–888. [Google Scholar] [CrossRef] [PubMed]
- Hernandez, M.R.; Wang, N.; Hanley, N.M.; Neufeld, A.H.; Hernandez, M.R.; Wang, N.; Hanley, N.M.; Neufeld, A.H. Localization of collagen types I and IV mRNAs in human optic nerve head by in situ hybridization. Investig. Ophthalmol. Vis. Sci. 1991, 32, 2169–2177. [Google Scholar]
- Lukas, T.J.; Miao, H.; Chen, L.; Riordan, S.M.; Li, W.; Crabb, A.M.; Wise, A.; Du, P.; Lin, S.M.; Hernandez, M.R. Susceptibility to glaucoma: Differential comparison of the astrocyte transcriptome from glaucomatous African American and Caucasian American donors. Genome Biol. 2008, 9, R111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Howell, G.R.; Macalinao, D.; Sousa, G.; Walden, M.; Soto, I.; Kneeland, S.C.; Barbay, J.M.; King, B.; Marchant, J.K.; Hibbs, M.; et al. Molecular clustering identifies complement and endothelin induction as early events in a mouse model of glaucoma. J. Clin. Investig. 2011, 121, 1429–1444. [Google Scholar] [CrossRef] [PubMed]
- Johnson, E.C.; Jia, L.; Cepurna, W.O.; Doser, T.A.; Morrison, J.C. Global Changes in Optic Nerve Head Gene Expression after Exposure to Elevated Intraocular Pressure in a Rat Glaucoma Model. Investig. Ophthalmol. Vis. Sci. 2007, 48, 3161–3177. [Google Scholar] [CrossRef]
- Nikolskaya, T.; Nikolsky, Y.; Serebryiskaya, T.; Zvereva, S.; Sviridov, E.; Dezso, Z.; Rahkmatulin, E.; Brennan, R.J.; Yankovsky, N.; Bhattacharya, S.K.; et al. Network analysis of human glaucomatous optic nerve head astrocytes. BMC Med. Genom. 2009, 2, 24. [Google Scholar] [CrossRef] [Green Version]
- Pena, J.D.; Taylor, A.W.; Ricard, C.S.; Vidal, I.; Hernandez, M.R. Transforming growth factor beta isoforms in human optic nerve heads. Br. J. Ophthalmol. 1999, 83, 209–218. [Google Scholar] [CrossRef] [Green Version]
- Zode, G.S.; Sethi, A.; Brun-Zinkernagel, A.M.; Chang, I.F.; Clark, A.F.; Wordinger, R.J. Transforming growth factor-beta2 increases extracellular matrix proteins in optic nerve head cells via activation of the Smad signaling pathway. Mol. Vis. 2011, 17, 1745–1758. [Google Scholar]
- Fuchshofer, R.; Birke, M.; Welge-Lussen, U.; Kook, D.; Lutjen-Drecoll, E. Transforming growth factor-beta 2 modulated extracellular matrix component expression in cultured human optic nerve head astrocytes. Invest. Ophthalmol. Vis. Sci. 2005, 46, 568–578. [Google Scholar] [CrossRef] [Green Version]
- Neumann, C.; Yu, A.; Welge-Lüssen, U.; Lutjen-Drecoll, E.; Birke, M. The Effect of TGF- 2 on Elastin, Type VI Collagen, and Components of the Proteolytic Degradation System in Human Optic Nerve Astrocytes. Investig. Opthalmol. Vis. Sci. 2008, 49, 1464–1472. [Google Scholar] [CrossRef]
- Schneider, M.; Pawlak, R.; Weber, G.R.; Dillinger, A.E.; Kuespert, S.; Iozzo, R.V.; Quigley, A.A.; Ohlmann, A.; Tamm, E.R.; Fuchshofer, R. A novel ocular function for decorin in the aqueous humor outflow. Matrix Biol. 2021, 97, 1–19. [Google Scholar] [CrossRef]
- Reed, C.C.; Iozzo, R.V. The role of decorin in collagen fibrillogenesis and skin homeostasis. Glycoconj. J. 2002, 19, 249–255. [Google Scholar] [CrossRef]
- Robinson, K.A.; Sun, M.; Barnum, C.E.; Weiss, S.N.; Huegel, J.; Shetye, S.S.; Lin, L.; Saez, D.; Adams, S.M.; Iozzo, R.V.; et al. Decorin and biglycan are necessary for maintaining collagen fibril structure, fiber realignment, and mechanical properties of mature tendons. Matrix Biol. 2017, 64, 81–93. [Google Scholar] [CrossRef]
- Iozzo, R.V.; Buraschi, S.; Genua, M.; Xu, S.-Q.; Solomides, C.C.; Peiper, S.C.; Gomella, L.G.; Owens, R.C.; Morrione, A. Decorin Antagonizes IGF Receptor I (IGF-IR) Function by Interfering with IGF-IR Activity and Attenuating Downstream Signaling*. J. Biol. Chem. 2011, 286, 34712–34721. [Google Scholar] [CrossRef] [Green Version]
- Iozzo, R.V.; Chakrani, F.; Perrotti, D.; McQuillan, D.J.; Skorski, T.; Calabretta, B.; Eichstetter, I. Cooperative action of germ-line mutations in decorin and p53 accelerates lymphoma tumorigenesis. Proc. Natl. Acad. Sci. USA 1999, 96, 3092–3097. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iozzo, R.V.; Moscatello, D.K.; McQuillan, D.J.; Eichstetter, I. Decorin Is a Biological Ligand for the Epidermal Growth Factor Receptor. J. Biol. Chem. 1999, 274, 4489–4492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vial, C.; Gutiérrez, J.; Santander, C.; Cabrera, D.; Brandan, E. Decorin Interacts with Connective Tissue Growth Factor (CTGF)/CCN2 by LRR12 Inhibiting Its Biological Activity. J. Biol. Chem. 2011, 286, 24242–24252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bredrup, C.; Knappskog, P.M.; Majewski, J.; Rødahl, E.; Boman, H. Congenital Stromal Dystrophy of the Cornea Caused by a Mutation in the Decorin Gene. Investig. Opthalmol. Vis. Sci. 2005, 46, 420–426. [Google Scholar] [CrossRef]
- Rødahl, E.; Van Ginderdeuren, R.; Knappskog, P.M.; Bredrup, C.; Boman, H. A Second Decorin Frame Shift Mutation in a Family With Congenital Stromal Corneal Dystrophy. Am. J. Ophthalmol. 2006, 142, 520–521. [Google Scholar] [CrossRef] [PubMed]
- Nikhalashree, S.; Karthikkeyan, G.; George, R.; Shantha, B.; Vijaya, L.; Ratra, V.; Sulochana, K.N.; Coral, K. Lowered Decorin With Aberrant Extracellular Matrix Remodeling in Aqueous Humor and Tenon’s Tissue From Primary Glaucoma Patients. Investig. Opthalmol. Vis. Sci. 2019, 60, 4661–4669. [Google Scholar] [CrossRef] [Green Version]
- Overby, D.; Zhou, E.H.; Vargas-Pinto, R.; Pedrigi, R.M.; Fuchshofer, R.; Braakman, S.; Gupta, R.; Perkumas, K.M.; Sherwood, J.M.; Vahabikashi, A.; et al. Altered mechanobiology of Schlemm’s canal endothelial cells in glaucoma. Proc. Natl. Acad. Sci. USA 2014, 111, 13876–13881. [Google Scholar] [CrossRef] [Green Version]
- Sun, D.; Lye-Barthel, M.; Masland, R.H.; Jakobs, T.C. The morphology and spatial arrangement of astrocytes in the optic nerve head of the mouse. J. Comp. Neurol. 2009, 516, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Simpson, J.E.; Ince, P.G.; Shaw, P.J.; Heath, P.R.; Raman, R.; Garwood, C.J.; Gelsthorpe, C.; Baxter, L.; Forster, G.; Ageing Neuropathology Study Group; et al. Microarray analysis of the astrocyte transcriptome in the aging brain: Relationship to Alzheimer’s pathology and APOE genotype. Neurobiol. Aging 2011, 32, 1795–1807. [Google Scholar] [CrossRef]
- Schneider, M. The Role of Decorin in the Pathogenesis of Primary Open Angle Glaucoma; University of Regensburg: Regensburg, Germany, 2017. [Google Scholar]
- Schönherr, E.; Sunderkötter, C.; Iozzo, R.; Schaefer, L. Decorin, a Novel Player in the Insulin-like Growth Factor System. J. Biol. Chem. 2005, 280, 15767–15772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fukuchi, T.; Ueda, J.; Hanyu, T.; Abe, H.; Sawaguchi, S. Distribution and expression of transforming growth factor-beta and platelet-derived growth factor in the normal and glaucomatous monkey optic nerve heads. Jpn. J. Ophthalmol. 2001, 45, 592–599. [Google Scholar] [CrossRef]
- Kompass, K.S.; A Agapova, O.; Li, W.; Kaufman, P.L.; A Rasmussen, C.; Hernandez, M.R. Bioinformatic and statistical analysis of the optic nerve head in a primate model of ocular hypertension. BMC Neurosci. 2008, 9, 93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quigley, H.A.; Pitha, I.F.; Welsbie, D.S.; Nguyen, C.; Steinhart, M.; Nguyen, T.D.; Pease, M.; Oglesby, E.N.; Berlinicke, C.A.; Mitchell, K.L.; et al. Losartan Treatment Protects Retinal Ganglion Cells and Alters Scleral Remodeling in Experimental Glaucoma. PLoS ONE 2015, 10, e0141137. [Google Scholar] [CrossRef] [Green Version]
- Rogers, R.S.; Dharsee, M.; Ackloo, S.; Sivak, J.; Flanagan, J.G. Proteomics Analyses of Human Optic Nerve Head Astrocytes Following Biomechanical Strain. Mol. Cell. Proteom. 2012, 11, 111 012302. [Google Scholar] [CrossRef] [Green Version]
- Kirwan, R.P.; Wordinger, R.; Clark, A.F.; O’Brien, C.J. Differential global and extra-cellular matrix focused gene expression patterns between normal and glaucomatous human lamina cribrosa cells. Mol. Vis. 2009, 15, 76–88. [Google Scholar]
- Kahari, V.M.; Larjava, H.; Uitto, J. Differential regulation of extracellular matrix proteoglycan (PG) gene expression. Transforming growth factor-beta 1 up-regulates biglycan (PGI), and versican (large fibroblast PG) but down-regulates decorin (PGII) mRNA levels in human fibroblasts in culture. J. Biol. Chem. 1991, 266, 1060810615. [Google Scholar]
- Roughley, P.J.; Melching, L.I.; Recklies, A.D. Changes in the expression of decorin and biglycan in human articular cartilage with age and regulation by TGF-beta. Matrix Biol. 1994, 14, 51–59. [Google Scholar] [CrossRef]
- Takeuchi, Y.; Matsumoto, T.; Ogata, E.; Shishiba, Y. Effects of transforming growth factor beta 1 and L-ascorbate on synthesis and distribution of proteoglycans in murine osteoblast-like cells. J. Bone Miner. Res. 1993, 8, 823–830. [Google Scholar] [CrossRef]
- Quillen, S.; Schaub, J.; Quigley, H.; Pease, M.; Korneva, A.; Kimball, E. Astrocyte responses to experimental glaucoma in mouse optic nerve head. PLoS ONE 2020, 15, e0238104. [Google Scholar] [CrossRef] [PubMed]
- Johnson, E.C.; Morrisonab, J.C.; Farrell, S.; Deppmeier, L.; Moore, C.; McGinty, M. The Effect of Chronically Elevated Intraocular Pressure on the Rat Optic Nerve Head Extracellular Matrix. Exp. Eye Res. 1996, 62, 663–674. [Google Scholar] [CrossRef]
- Sawaguchi, S.; Yue, B.Y.; Fukuchi, T.; Abe, H.; Suda, K.; Kaiya, T.; Iwata, K. Collagen fibrillar network in the optic nerve head of normal monkey eyes and monkey eyes with laser-induced glaucoma–A scanning electron microscopic study. Curr. Eye Res. 1999, 18, 143–149. [Google Scholar] [CrossRef]
- Pijanka, J.K.; Markov, P.P.; Midgett, D.; Paterson, N.; White, N.; Blain, E.J.; Nguyen, T.D.; Quigley, H.A.; Boote, C. Quantification of collagen fiber structure using second harmonic generation imaging and two-dimensional discrete Fourier transform analysis: Application to the human optic nerve head. J. Biophotonics 2019, 12, e201800376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, Y.; Pappas, A.C.; Wang, R.; Seifert, P.; Sun, D.; Jakobs, T.C. Ultrastructural Morphology of the Optic Nerve Head in Aged and Glaucomatous Mice. Investig. Opthalmol. Vis. Sci. 2018, 59, 3984–3996. [Google Scholar] [CrossRef] [Green Version]
- Scott, J.E. Proteodermatan and Proteokeratan Sulfate (Decorin, Lumican/Fibromodulin) Proteins Are Horseshoe Shaped. Implications for Their Interactions with Collagen†. Biochemistry 1996, 35, 8795–8799. [Google Scholar] [CrossRef]
- Weber, I.T.; Harrison, R.; Iozzo, R.V. Model Structure of Decorin and Implications for Collagen Fibrillogenesis. J. Biol. Chem. 1996, 271, 31767–31770. [Google Scholar] [CrossRef] [Green Version]
- Ling, Y.T.T.; Pease, M.E.; Jefferys, J.L.; Kimball, E.C.; Quigley, H.A.; Nguyen, T.D. Pressure-Induced Changes in Astrocyte GFAP, Actin, and Nuclear Morphology in Mouse Optic Nerve. Investig. Opthalmol. Vis. Sci. 2020, 61, 14. [Google Scholar] [CrossRef]
- Lu, Y.; Iandiev, I.; Hollborn, M.; Körber, N.; Ulbricht, E.; Hirrlinger, P.G.; Pannicke, T.; Wei, E.; Bringmann, A.; Wolburg, H.; et al. Reactive glial cells: Increased stiffness correlates with increased intermediate filament expression. FASEB J. 2011, 25, 624–631. [Google Scholar] [CrossRef]
- Yamaguchi, Y.; Mann, D.M.; Ruoslahti, E. Negative regulation of transforming growth factor-beta by the proteoglycan decorin. Nature 1990, 346, 281–284. [Google Scholar] [CrossRef]
- Garwood, C.; Ratcliffe, L.E.; Morgan, S.V.; Simpson, J.E.; Owens, H.; Vazquez-Villaseñor, I.; Heath, P.R.; Romero, I.; Ince, P.G.; Wharton, S.B. Insulin and IGF1 signalling pathways in human astrocytes in vitro and in vivo; characterisation, subcellular localisation and modulation of the receptors. Mol. Brain 2015, 8, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Schaefer, L.; Tsalastra, W.; Babelova, A.; Baliova, M.; Minnerup, J.; Sorokin, L.; Gröne, H.-J.; Reinhardt, D.; Pfeilschifter, J.; Iozzo, R.; et al. Decorin-Mediated Regulation of Fibrillin-1 in the Kidney Involves the Insulin-Like Growth Factor-I Receptor and Mammalian Target of Rapamycin. Am. J. Pathol. 2007, 170, 301–315. [Google Scholar] [CrossRef] [Green Version]
- Annes, J.P.; Munger, J.S.; Rifkin, D.B. Making sense of latent TGFbeta activation. J. Cell Sci. 2003, 116, 217–224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Flügel-Koch, C.; Ohlmann, A.; Fuchshofer, R.; Welge-Lüssen, U.; Tamm, E.R. Thrombospondin-1 in the trabecular meshwork: Localization in normal and glaucomatous eyes, and induction by TGF-β1 and dexamethasone in vitro. Exp. Eye Res. 2004, 79, 649–663. [Google Scholar] [CrossRef]
- Dietz, H.C.; Cutting, C.R.; Pyeritz, R.E.; Maslen, C.L.; Sakai, L.Y.; Corson, G.M.; Puffenberger, E.; Hamosh, A.; Nanthakumar, E.J.; Curristin, S.M.; et al. Marfan syndrome caused by a recurrent de novo missense mutation in the fibrillin gene. Nat. Cell Biol. 1991, 352, 337–339. [Google Scholar] [CrossRef] [PubMed]
- Dietz, H.C.; Pyeritz, R.E.; Hall, B.D.; Cadle, R.G.; Hamosh, A.; Schwartz, J.; Meyers, D.A.; Francomano, C.A. The Marfan syndrome locus: Confirmation of assignment to chromosome 15 and identification of tightly linked markers at 15q15-q21.3. Genomics 1991, 9, 355–361. [Google Scholar] [CrossRef]
- Faivre, L.; Collod-Beroud, G.; Loeys, B.; Child, A.; Binquet, C.; Gautier, E.; Callewaert, B.; Arbustini, E.; Mayer, K.; Arslan-Kirchner, M.; et al. Effect of Mutation Type and Location on Clinical Outcome in 1,013 Probands with Marfan Syndrome or Related Phenotypes and FBN1 Mutations: An International Study. Am. J. Hum. Genet. 2007, 81, 454–466. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Conery, A.R.; Cao, Y.; Thompson, E.A.; Townsend, C.M., Jr.; Ko, T.C.; Luo, K. Akt interacts directly with Smad3 to regulate the sensitivity to TGF-beta induced apoptosis. Nat. Cell. Biol. 2004, 6, 366–372. [Google Scholar] [CrossRef] [PubMed]
- Danielson, K.G.; Baribault, H.; Holmes, D.F.; Graham, H.; Kadler, K.; Iozzo, R.V. Targeted Disruption of Decorin Leads to Abnormal Collagen Fibril Morphology and Skin Fragility. J. Cell Biol. 1997, 136, 729–743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fuchshofer, R.; Yu, A.H.L.; Welge-Lu¨ssen, U.; Tamm, E.R. Bone Morphogenetic Protein-7 Is an Antagonist of Transforming Growth Factor-β2 in Human Trabecular Meshwork Cells. Investig. Opthalmol. Vis. Sci. 2007, 48, 715–726. [Google Scholar] [CrossRef] [PubMed] [Green Version]







Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schneider, M.; Dillinger, A.E.; Ohlmann, A.; Iozzo, R.V.; Fuchshofer, R. Decorin—An Antagonist of TGF-β in Astrocytes of the Optic Nerve. Int. J. Mol. Sci. 2021, 22, 7660. https://doi.org/10.3390/ijms22147660
Schneider M, Dillinger AE, Ohlmann A, Iozzo RV, Fuchshofer R. Decorin—An Antagonist of TGF-β in Astrocytes of the Optic Nerve. International Journal of Molecular Sciences. 2021; 22(14):7660. https://doi.org/10.3390/ijms22147660
Chicago/Turabian StyleSchneider, Magdalena, Andrea E. Dillinger, Andreas Ohlmann, Renato V. Iozzo, and Rudolf Fuchshofer. 2021. "Decorin—An Antagonist of TGF-β in Astrocytes of the Optic Nerve" International Journal of Molecular Sciences 22, no. 14: 7660. https://doi.org/10.3390/ijms22147660
APA StyleSchneider, M., Dillinger, A. E., Ohlmann, A., Iozzo, R. V., & Fuchshofer, R. (2021). Decorin—An Antagonist of TGF-β in Astrocytes of the Optic Nerve. International Journal of Molecular Sciences, 22(14), 7660. https://doi.org/10.3390/ijms22147660

