Burst, Short, and Sustained Vitamin D3 Applications Differentially Affect Osteogenic Differentiation of Human Adipose Stem Cells
Abstract
:1. Introduction
2. Results
2.1. hASCs Attached to BCP Particles and Survived, in the Presence and Absence of Vitamin D3
2.2. Vitamin D3 Did not Affect Proliferation of hASCS on BCP Particles
2.3. Regime Mimicking Sustained Release of Vitamin D3 Affects ALP and RUNX2
2.4. Sustained Application of Vitamin D3 Highly Upregulates CYP24a1 Expression
3. Discussion
4. Materials and Methods
4.1. Calcium Phosphate Particles
4.2. Isolation of hASCs
4.3. Platelet Lysate
4.4. Culture and Treatment of hASCs
4.5. Attachment and Viability
4.6. Metabolic Activity
4.7. Alkaline Phosphatase (ALP)
4.8. Quantitative Polymerase CHAIN reaction (qPCR)
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
vitD3 | 1,25(OH)2 vitamin D3 |
MSCs | mesenchymal stem cells |
hASCs | human adipose stem cells |
ALP | alkaline phosphatase |
OPN | osteopontin |
BCP | biphasic calcium phosphate |
BMP-2 | bone morphogenetic protein-2 |
VEGF | vascular endothelial growth factor |
BMSCs | bone marrow-derived mesenchymal stem cells |
CYP24a1 | Cytochrome P450 family 24 subfamily A member 1 |
BAX | B-cell lymphoma protein 2 associated X |
BCL-2 | B-cell lymphoma 2 |
RUNX2 | Runt-related transcription factor 2 |
COL1a | collagen type 1a |
PPAR-γ VDR | Peroxisome proliferator-activated receptor gammavitamin D receptor |
qPCR | Quantitative polymerase chain reaction |
HPRT | hypoxanthine phosphoribosyl transferase |
References
- Azi, M.L.; Aprato, A.; Santi, I.; Kfuri Jr., M.; Masse, A.; Joeris, A. Autologous bone graft in the treatment of post-traumatic bone defects: A systematic review and meta-analysis. BMC Musculoskelet. Disord. 2016, 17, 465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Myeroff, C.; Archdeacon, M. Autogenous Bone Graft: Donor Sites and Techniques. J. Bone Jt. Surgery- 2011, 93, 2227–2236. [Google Scholar]
- Lin, H.; Tang, Y.; Lozito, T.P.; Oyster, N.; Kang, R.B.; Fritch, M.R.; Wang, B.; Tuan, R.S. Projection Stereolithographic Fabrication of BMP-2 Gene-activated Matrix for Bone Tissue Engineering. Sci. Rep. 2017, 7, 11327. [Google Scholar] [CrossRef]
- Amini, A.R.; Laurencin, C.T.; Nukavarapu, S.P. Bone tissue engineering: Recent advances and challenges. Crit. Rev. Biomed. Eng. 2012, 40, 363–408. [Google Scholar] [CrossRef] [Green Version]
- Kim, B.S.; Choi, M.K.; Yoon, J.H.; Lee, J. Evaluation of bone regeneration with biphasic calcium phosphate substitute implanted with bone morphogenetic protein 2 and mesenchymal stem cells in a rabbit calvarial defect model. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. 2015, 120, 2–9. [Google Scholar] [CrossRef]
- Des Rieux, A.; Ucakar, B.; Mupendwa, B.P.K.; Colau, D.; Feron, O.; Carmeliet, P.; Préat, V. 3D systems delivering VEGF to promote angiogenesis for tissue engineering. J. Control. Release 2011, 150, 272–278. [Google Scholar] [CrossRef]
- Song, I.; Kim, B.-S.; Kim, C.-S.; Im, G.-I. Effects of BMP-2 and vitamin D3 on the osteogenic differentiation of adipose stem cells. Biochem. Biophys. Res. Commun. 2011, 408, 126–131. [Google Scholar]
- Liu, P.; Oyajobi, B.O.; Russell, R.G.G.; Scutt, A. Regulation of Osteogenic Differentiation of Human Bone Marrow Stromal Cells: Interaction Between Transforming Growth Factor-β and 1,25(OH)2 Vitamin D3In Vitro. Calcif. Tissue Int. 1999, 65, 173–180. [Google Scholar] [CrossRef]
- Lou, Y.-R.; Toh, T.C.; Tee, Y.H.; Yu, H. 25-Hydroxyvitamin D3 induces osteogenic differentiation of human mesenchymal stem cells. Sci. Rep. 2017, 7, 42816. [Google Scholar]
- Suliman, S.; Xing, Z.; Wu, X.; Xue, Y.; Pedersen, T.O.; Sun, Y.; Døskeland, A.P.; Nickel, J.; Waag, T.; Lygre, H.; et al. Release and bioactivity of bone morphogenetic protein-2 are affected by scaffold binding techniques in vitro and in vivo. J. Control. Release 2015, 197, 148–157. [Google Scholar] [CrossRef]
- Kawa, S.; Nikaido, T.; Aoki, Y.; Zhai, Y.; Kumagai, T.; Furihata, K.; Fujii, S.; Kiyosawa, K. Vitamin D analogues up-regulate p21 and p27 during growth inhibition of pancreatic cancer cell lines. Br. J. Cancer 1997, 76, 884–889. [Google Scholar] [CrossRef] [Green Version]
- Skjødt, H.; Gallagher, J.A.; Beresford, J.N.; Couch, M.; Poser, J.W.; Russell, R.G.G. Vitamin D metabolites regulate osteocalcin synthesis and proliferation of human bone cells in vitro. 1985, 105, 391. J. Endocrinol. 1985, 105, 391. [Google Scholar]
- Tannoury, C.A.; An, H.S. Complications with the use of bone morphogenetic protein 2 (BMP-2) in spine surgery. Spine J. 2014, 14, 552–559. [Google Scholar] [CrossRef]
- Sukul, M.; Nguyen, T.B.L.; Min, Y.-K.; Lee, S.-Y.; Lee, B.-T. Effect of Local Sustainable Release of BMP2-VEGF from Nano-Cellulose Loaded in Sponge Biphasic Calcium Phosphate on Bone Regeneration. Tissue Eng. Part A 2015, 21, 1822–1836. [Google Scholar] [CrossRef] [Green Version]
- Poldervaart, M.T.; Wang, H.; van der Stok, J.; Weinans, H.; Leeuwenburgh, S.C.G.; Öner, F.C.; Dhert, W.J.A.; Alblas, J. Sustained Release of BMP-2 in Bioprinted Alginate for Osteogenicity in Mice and Rats. PLoS ONE 2013, 8, e72610. [Google Scholar]
- Rahman, C.V.; Ben-David, D.; Dhillon, A.; Kuhn, G.; Gould, T.W.A.; Müller, R.; Rose, F.R.A.J.; Shakesheff, K.M.; Livne, E. Controlled release of BMP-2 from a sintered polymer scaffold enhances bone repair in a mouse calvarial defect model. J. Tissue Eng. Regen. Med. 2014, 8, 59–66. [Google Scholar]
- Gazzerro, E.; Gangji, V.; Canalis, E. Bone morphogenetic proteins induce the expression of noggin, which limits their activity in cultured rat osteoblasts. J. Clin. Investig. 1998, 102, 2106–2114. [Google Scholar]
- Zhu, W.; Kim, J.; Cheng, C.; Rawlins, B.A.; Boachie-Adjei, O.; Crystal, R.G.; Hidaka, C. Noggin regulation of bone morphogenetic protein (BMP) 2/7 heterodimer activity in vitro. Bone 2006, 39, 61–71. [Google Scholar] [CrossRef] [Green Version]
- Armbrecht, H.J.; Hodam, T.L.; Boltz, M.A.; Partridge, N.C.; Brown, A.J.; Kumar, V.B. Induction of the Vitamin D 24-Hydroxylase (CYP24) by 1,25-Dihydroxyvitamin D 3 Is Regulated by Parathyroid Hormone in UMR106 Osteoblastic Cells 1. Endocrinology 1998, 139, 3375–3381. [Google Scholar]
- Omdahl, J.L.; Morris, H.A.; May, B.K. Hydroxylase enzymes of The vitamin D pathway: Expression, function, and regulation. Annu. Rev. Nutr. 2002, 22, 139–166. [Google Scholar]
- Bahney, C.S.; Zondervan, R.L.; Allison, P.; Theologis, A.; Ashley, J.W.; Ahn, J.; Miclau, T.; Marcucio, R.S.; Hankenson, K.D. Cellular biology of fracture healing. J. Orthop. Res. 2019, 37, 35–50. [Google Scholar] [CrossRef] [Green Version]
- Tchetina, E.; Mwale, F.; Poole, A.R. Distinct Phases of Coordinated Early and Late Gene Expression in Growth Plate Chondrocytes in Relationship to Cell Proliferation, Matrix Assembly, Remodeling, and Cell Differentiation. J. Bone Miner. Res. 2003, 18, 844–851. [Google Scholar] [CrossRef]
- Lu, Z.; Wang, G.; Dunstan, C.R.; Zreiqat, H. Short-term exposure to tumor necrosis factor-alpha enables human osteoblasts to direct adipose tissue-derived mesenchymal stem cells into osteogenic differentiation. Stem Cells Dev. 2012, 21, 2420–2429. [Google Scholar] [CrossRef]
- Overman, J.R.; Farré-Guasch, E.; Helder, M.N.; Ten Bruggenkate, C.M.; Schulten, E.A.J.M.; Klein-Nulend, J. Short (15 minutes) bone morphogenetic protein-2 treatment stimulates osteogenic differentiation of human adipose stem cells seeded on calcium phosphate scaffolds in vitro. Tissue Eng.–Part A 2013, 19, 571–581. [Google Scholar] [CrossRef] [Green Version]
- Mokhtari-Jafari, F.; Amoabediny, G.; Dehghan, M.M.; Helder, M.N.; Zandieh-Doulabi, B.; Klein-Nulend, J. Short pretreatment with calcitriol is far superior to continuous treatment in stimulating proliferation and osteogenic differentiation of human adipose stem cells. Cell J. 2020, 22, 293–301. [Google Scholar]
- Jones, G.; Prosser, D.E.; Kaufmann, M. Cytochrome P450-mediated metabolism of vitamin D. J. Lipid Res. 2014, 55, 13–31. [Google Scholar] [CrossRef] [Green Version]
- Ji, Y.; Zhang, P.; Xing, Y.; Jia, L.; Zhang, Y.; Jia, T.; Wu, X.; Zhao, B.; Xu, X. Effect of 1α, 25-dihydroxyvitamin D3 on the osteogenic differentiation of human periodontal ligament stem cells and the underlying regulatory mechanism. Int. J. Mol. Med. 2019, 43, 167–176. [Google Scholar] [CrossRef] [Green Version]
- Van der Meijden, K.; Lips, P.; van Driel, M.; Heijboer, A.C.; Schulten, E.A.J.M.; den Heijer, M.; Bravenboer, N. Primary Human Osteoblasts in Response to 25-Hydroxyvitamin D3, 1,25-Dihydroxyvitamin D3 and 24R,25-Dihydroxyvitamin D3. PLoS ONE 2014, 9, e110283. [Google Scholar] [CrossRef] [Green Version]
- Girgis, C.M.; Clifton-Bligh, R.J.; Mokbel, N.; Cheng, K.; Gunton, J.E. Vitamin D Signaling Regulates Proliferation, Differentiation, and Myotube Size in C2C12 Skeletal Muscle Cells. Endocrinology 2014, 155, 347–357. [Google Scholar] [CrossRef] [Green Version]
- Sergeev, I.N. 1,25-Dihydroxyvitamin D3 induces Ca2+-mediated apoptosis in adipocytes via activation of calpain and caspase-12. Biochem. Biophys. Res. Commun. 2009, 384, 18–21. [Google Scholar] [CrossRef]
- Sergeev, I.N. Calcium as a mediator of 1,25-dihydroxyvitamin D3-induced apoptosis. J. Steroid Biochem. Mol. Biol. 2004, 89–90, 419–425. [Google Scholar] [CrossRef]
- Montecino, M.A.; Lian, J.B.; Stein, J.L.; Stein, G.S.; van Wijnen, A.J.; Cruzat, F. Biological and Molecular Effects of Vitamin D on Bone. In Vitamin D.; Springer: Berlin, Germany, 2010; pp. 189–209. [Google Scholar]
- Duque, G.; El Abdaimi, K.; Henderson, J.E.; Lomri, A.; Kremer, R. Vitamin D inhibits Fas ligand-induced apoptosis in human osteoblasts by regulating components of both the mitochondrial and Fas-related pathways. Bone 2004, 35, 57–64. [Google Scholar] [CrossRef]
- Müller, P.; Bulnheim, U.; Diener, A.; Lüthen, F.; Teller, M.; Klinkenberg, E.-D.; Neumann, H.-G.; Nebe, B.; Liebold, A.; Steinhoff, G.; et al. Calcium phosphate surfaces promote osteogenic differentiation of mesenchymal stem cells. J. Cell. Mol. Med. 2007, 12, 281–291. [Google Scholar] [CrossRef] [Green Version]
- Chai, Y.C.; Carlier, A.; Bolander, J.; Roberts, S.J.; Geris, L.; Schrooten, J.; Van Oosterwyck, H.; Luyten, F.P. Current views on calcium phosphate osteogenicity and the translation into effective bone regeneration strategies. Acta Biomater. 2012, 8, 3876–3887. [Google Scholar] [CrossRef]
- Haussler, M.R.; Whitfield, G.K.; Kaneko, I.; Haussler, C.A.; Hsieh, D.; Hsieh, J.-C.; Jurutka, P.W. Molecular Mechanisms of Vitamin D Action. Calcif. Tissue Int. 2013, 92, 77–98. [Google Scholar]
- Drissi, H.; Pouliot, A.; Koolloos, C.; Stein, J.L.; Lian, J.B.; Stein, G.S.; Van Wijnen, A.J. 1,25-(OH)2-vitamin D3 suppresses the bone-related Runx2/Cbfa1 gene promoter. Exp. Cell Res. 2002, 274, 323–333. [Google Scholar] [CrossRef]
- Garimella, R.; Tadikonda, P.; Tawfik, O.; Gunewardena, S.; Rowe, P.; Van Veldhuizen, P. Vitamin D impacts the expression of Runx2 target genes and modulates inflammation, oxidative stress and membrane vesicle biogenesis gene networks in 143B osteosarcoma cells. Int. J. Mol. Sci. 2017, 18, 642. [Google Scholar] [CrossRef] [Green Version]
- Yu, O.B.; Arnold, L.A. Calcitroic Acid–A Review. ACS Chem. Biol. 2016, 11, 2665–2672. [Google Scholar] [CrossRef] [Green Version]
- Gurumurthy, B.; Bierdeman, P.C.; Janorkar, A.V. Spheroid model for functional osteogenic evaluation of human adipose derived stem cells. J. Biomed. Mater. Res.–Part A 2017, 105, 1230–1236. [Google Scholar] [CrossRef]
- Castrén, E.; Sillat, T.; Oja, S.; Noro, A.; Laitinen, A.; Konttinen, Y.T.; Lehenkari, P.; Hukkanen, M.; Korhonen, M. Osteogenic differentiation of mesenchymal stromal cells in two-dimensional and three-dimensional cultures without animal serum. Stem Cell Res. Ther. 2015, 6, 167. [Google Scholar] [CrossRef] [Green Version]
- He, J.; Genetos, D.C.; Yellowley, C.E.; Leach, J.K. Oxygen tension differentially influences osteogenic differentiation of human adipose stem cells in 2D and 3D cultures. J. Cell. Biochem. 2010, 110. [Google Scholar] [CrossRef]
- Faßbender, M.; Minkwitz, S.; Strobel, C.; Schmidmaier, G.; Wildemann, B. Stimulation of bone healing by sustained bone morphogenetic protein 2 (BMP-2) delivery. Int. J. Mol. Sci. 2014, 15, 8539–8552. [Google Scholar] [CrossRef] [Green Version]
- Gu, J.; Tong, X.S.; Chen, G.H.; Wang, D.; Chen, Y.; Yuan, Y.; Liu, X.Z.; Bian, J.C.; Liu, Z.P. Effects of 1α,25-(OH)2D3 on the formation and activity of osteoclasts in RAW264.7 cells. J. Steroid Biochem. Mol. Biol. 2015, 152, 25–33. [Google Scholar] [CrossRef]
- Vogenberg, F.R.; Barash, C.I.; Pursel, M. Personalized medicine -Part 1: Evolution and development into theranostics. Pharm. Ther. 2010, 35, 560. [Google Scholar]
- Powe, C.E.; Evans, M.K.; Wenger, J.; Zonderman, A.B.; Berg, A.H.; Nalls, M.; Tamez, H.; Zhang, D.; Bhan, I.; Karumanchi, S.A.; et al. Vitamin D-binding protein and vitamin D status of black Americans and white Americans. N. Engl. J. Med. 2013, 369, 1991–2000. [Google Scholar] [CrossRef] [Green Version]
- Prins, H.-J.; Rozemuller, H.; Vonk-Griffioen, S.; Verweij, V.G.M.; Dhert, W.J.A.; Slaper-Cortenbach, I.C.M.; Martens, A.C.M. Bone-forming capacity of mesenchymal stromal cells when cultured in the presence of human platelet lysate as substitute for fetal bovine serum. Tissue Eng. Part A 2009, 15, 3741–3751. [Google Scholar] [CrossRef]
- Bastidas-Coral, A.P.; Hogervorst, J.M.A.; Forouzanfar, T.; Kleverlaan, C.J.; Koolwijk, P.; Klein-Nulend, J.; Bakker, A.D. IL-6 counteracts the inhibitory effect of IL-4 on osteogenic differentiation of human adipose stem cells. J. Cell. Physiol. 2019, 234, 20520–20532. [Google Scholar] [CrossRef] [Green Version]
- Lowry, H.O. Micromethods for the assay of enzyme II. Specofic procedures. Alkaline phosphatase. Methods Enzymol. 1955, 4, 371–372. [Google Scholar]
Gene (Human) | Forward Sequence | Reverse Sequence |
---|---|---|
KI67 | 5′ CGAGACGCCTGGTTACTATCAA 3′ | 5′ GGATACGGATGTCACATTCAATACC 3′ |
RUNX2 | 5′ CCAGAAGGCACAGACAGAAGCT 3′ | 5′ AGGAATGCGCCCTAAATCACT 3′ |
COL1 | 5′ GCATGGGCAGAGGTATAATG 3′ | 5′ GGTCCTTTGGGTCCTACAA 3′ |
BAX | 5′ TGTCGCCCTTTTCTACTTTGC 3′ | 5′ CTGATCAGTTCCGGCACCTT 3′ |
BCL-2 | 5′ AGAGCCTTGGATCCAGGAGAA 3′ | 5′ GCTGCATTGTTCCCATAGAGTTC 3′ |
VDR | 5′ GACACAGCCTGGAGCTGAT 3′ | 5′ CAGGTCGGCTAGCTTCTGGA 3′ |
CYP24a1 | 5′ CAAACCGTGGAAGGCCTATC 3′ | 5′ AGTCTTCCCCTTCCAGGATCA 3′ |
HPRT | 5′ GCTGACCTGCTGGATTACAT 3′ | 5′ CTTGCGACCTTGACCATCT 3′ |
OPN | 5′ TTCCAAGTAAGTCCAACGAAAG 3′ | 5′ GTGACCAGTTCATCAGATTCAT 3′ |
PPAR- γ | 5′ CGACCAGCTGAATCCAGAGT 3′ | 5′ GATGCGGATGGCCACCTCTT 3′ |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kelder, C.; Hogervorst, J.M.A.; Wismeijer, D.; Kleverlaan, C.J.; de Vries, T.J.; Bakker, A.D. Burst, Short, and Sustained Vitamin D3 Applications Differentially Affect Osteogenic Differentiation of Human Adipose Stem Cells. Int. J. Mol. Sci. 2020, 21, 3202. https://doi.org/10.3390/ijms21093202
Kelder C, Hogervorst JMA, Wismeijer D, Kleverlaan CJ, de Vries TJ, Bakker AD. Burst, Short, and Sustained Vitamin D3 Applications Differentially Affect Osteogenic Differentiation of Human Adipose Stem Cells. International Journal of Molecular Sciences. 2020; 21(9):3202. https://doi.org/10.3390/ijms21093202
Chicago/Turabian StyleKelder, Cindy, Jolanda M.A. Hogervorst, Daniël Wismeijer, Cornelis J. Kleverlaan, Teun J. de Vries, and Astrid D. Bakker. 2020. "Burst, Short, and Sustained Vitamin D3 Applications Differentially Affect Osteogenic Differentiation of Human Adipose Stem Cells" International Journal of Molecular Sciences 21, no. 9: 3202. https://doi.org/10.3390/ijms21093202