Next Article in Journal
Somatostatin Analogs in Clinical Practice: A Review
Next Article in Special Issue
Function and Regulation of Ammonium Transporters in Plants
Previous Article in Journal
Functional Cyclization of Eukaryotic mRNAs
Previous Article in Special Issue
The Molecular Mechanisms Underlying Iron Deficiency Responses in Rice
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of Metal Tolerance Protein Genes in Populus trichocarpa and Their Roles in Response to Various Heavy Metal Stresses

School of Life Science and Engineering, Southwest University of Science and Technology, Mianyang 621010, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2020, 21(5), 1680; https://doi.org/10.3390/ijms21051680
Submission received: 8 February 2020 / Revised: 26 February 2020 / Accepted: 27 February 2020 / Published: 29 February 2020
(This article belongs to the Special Issue Ion Transport and Homeostasis in Plants)

Abstract

Metal tolerance proteins (MTPs) are plant divalent cation transporters that play important roles in plant metal tolerance and homeostasis. Poplar is an ideal candidate for the phytoremediation of heavy metals because of its numerous beneficial attributes. However, the definitive phylogeny and heavy metal transport mechanisms of the MTP family in poplar remain unknown. Here, 22 MTP genes in P. trichocarpa were identified and classified into three major clusters and seven groups according to phylogenetic relationships. An evolutionary analysis suggested that PtrMTP genes had undergone gene expansion through tandem or segmental duplication events. Moreover, all PtrMTPs were predicted to localize in the vacuole and/or cell membrane, and contained typical structural features of the MTP family, cation efflux domain. The temporal and spatial expression pattern analysis results indicated the involvement of PtrMTP genes in poplar developmental control. Under heavy metal stress, most of PtrMTP genes were induced by at least two metal ions in roots, stems or leaves. In addition, PtrMTP8.1, PtrMTP9 and PtrMTP10.4 displayed the ability of Mn transport in yeast cells, and PtrMTP6 could transport Co, Fe and Mn. These findings will provide an important foundation to elucidate the biological functions of PtrMTP genes, and especially their role in regulating heavy metal tolerance in poplar.

1. Introduction

Heavy metal pollution is becoming a more and more serious problem globally. It poses a grave risk for food and environmental safety, as well as human health [1]. For example, Cd and Ni are carcinogenic, teratogenic and mutagenic, while Cu, Hg and Pb can cause neurological diseases [2]. Some plants have hyperaccumulation and/or hypertolerance characteristics for specific heavy metals, and are excellent candidates for phytoremediation to reduce environmental heavy metal pollutant levels. These plants must possess a distinct system that contributes to the high capacity of heavy metal enrichment and tolerance, including metal uptake, efflux, chelation, translocation, intracellular sequestration and storage; among these, the metal transporters play a crucial role [3,4].
Cation diffusion facilitators (CDFs) are divalent cation (Zn2+, Co2+, Fe2+, Cd2+, Ni2+ and Mn2+) transporters which have important functions in maintenance of metal homeostasis. Since the identification of Cupriavidus metallidurans in 1995, increasing numbers of CDF genes have been cloned, functionally investigated and classified into three clusters: Zn-CDF, Fe/Zn-CDF and Mn-CDF [5,6]. Protein sequence analysis revealed three typical structural characteristics of CDFs: approximately six predicted transmembrane domains (TMDs); a modified signature; and a C-terminal cation efflux domain [5,7].
Plant CDF family members are usually named metal tolerance proteins (MTPs), which are further classified into seven groups: group 1, group 5–9 and group 12 [8]. Arabidopsis contains 12 MTP genes; two members from group1, AtMTP1 and AtMTP3 are vacuolar membrane-localized Zn transporters that function in Zn homeostasis [9,10,11]. AtMTP5 and AtMTP12 are members of groups 5 and 12, respectively. Fujiwara et al. found that these two proteins could interact each other at Golgi for Zn transport [12]. Moreover, AtMTP8 and AtMTP11 are two functionally characterized Mn-CDFs. AtMTP8 is a vacuolar Mn transporter that determines the tolerance to iron deficiency and the localization of Mn and Fe in seeds [13,14,15]. AtMTP11 localizes in prevacuolar compartments and/or trans-Golgi, and plays a role in Mn transport and tolerance [16,17].
Poplar is a model and economically important woody plant, and is also a potential candidate for contaminated soil phytoremediation due to its characteristics, such as easy propagation, fast growth, extensive root systems, high above-ground biomass and immense industrial value [18]. In contrast, only three genes encoding the MTP protein have been cloned and functionally characterized in poplar to date. PtdMTP1 is a vacuolar localized Zn transporter in the form of a homo-oligomer, and would confer Zn tolerance when overexpressed in Arabidopsis [19]. PtMTP11.1 and PtMTP11.2, which showed a punctate localization pattern in yeast like their homolog AtMTP11, could complement the sensitivity of the Δpmr mutant to Mn [17]. In 2010, Migeon et al. identified 72 metal transporters including 19 MTP proteins from the Populous genome, and analyzed their phylogenic relationship [20]. However, due to the limit of the integrity of the Populous genome sequence, a few of MTP members were not identified at that time, and the expression patterns, especially those in response to heavy metal stresses, and the metal transport features of PtrMTP genes, are unknown. In this study, we identified 22 PtMTPs from the Populus trichocarpa v3.0 genome sequence, and systematically analyzed their evolution and structural features. Moreover, we also explored the expression profiles of the entire PtrMTP family under various heavy metal stresses in different tissues, and investigated the potential metal substrates by using a yeast assay. The results of this study are expected to provide useful information with which to better understand the biological functions of PtMTP proteins, which might shed some light on the molecular mechanisms of heavy metal transport and homeostasis in poplar.

2. Results

2.1. Identification and Classification of MTP Genes in P. trichocarpa Genome

By using the sequences of 12 AtMTP proteins as queries, we identified a total of 22 MTP genes in P. trichocarpa genome, three more than previous results [20]. The 22 PtrMTP proteins were named PtrMTP1.1 to PtrMTP12, according to the phylogenetic relationship, sequence identity and cover values between PtrMTP and AtMTP proteins (Figure 1, Supplementary Table S3, and Table 1). A phylogenetic tree showed that except for AtMTP2, there was at least one homolog of Arabidopsis MTP proteins in P. trichocarpa (Figure 1).
To further analyze the phylogenetic relationship of PtrMTP proteins to their counterparts from other plants, a total of 118 MTP sequences from eight plant species were used to construct a phylogentic tree. The 22 PtrMTP proteins could be categorized to seven groups (1, 5, 6, 7, 8, 9 and 12). Among them, group 9 is the largest one, containing 7 PtrMTP members; group 1 includes 5 PtrMTP members, while groups 5, 6, 7 and 12 contain only one PtrMTP each. Amazingly, group 8 contains 5 tandem repeat PtrMTP members from PtrMTP8.2 to PtrMTP8.6 and a single PtrMTP8.1 (Figure 2). Further, the seven PtrMTP groups are classified into Zn-CDFs, Zn/Fe-CDFs and Mn-CDFs clusters.

2.2. Structure and Characteristics Analysis of PtrMTP Genes

The genome annotation files of poplar were applied to the TBtools software for an exon-intron organizations analysis of PtrMTP genes. As shown in Figure 3a–b, although the number of introns in the PtrMTP genes of the three clusters ranged from 0 to 12, most of the related members that clustered closely shared similar introns in terms of number and phase. Of the three clusters, Zn-CDFs contained the smallest number of introns (group 1 contained only one, and group 12 contained none), except for group 5, which harbored 9 introns; Mn-CDFs contained 3–6 introns (group 8 contained 3, 5 or 6, and group 9 all contained 5), whereas Zn/Fe-CDFs contained the largest number of introns (group 6 contained 10, group 7 contained 12) (Figure 3a–b). Additionally, all the PtrMTP genes contained phase 0 and phase 2 introns, while only the members of group 5–7 contained phase 1 intron (Figure 3a–b).
Next, the physicochemical parameters of the 22 PtrMTPs were analyzed further. The length of the coding sequence (CDS) of PtrMTP genes ranged from 498 bp (PtrMTP8.6) to 2610 bp (PtrMTP12), with 165 to 869 amino acids, as well as a relative molecular weight (MW) ranging from 18.375 to 97.498 KDa (Table 1). The total average of hydropathicity (GRAVY) of the PtrMTP proteins ranged from –0.235 (PtrMTP10.1) to 0.329 (PtrMTP4) (Table 1). Moreover, PtrMTP7 has the highest isoelectric point (pI), i.e., 7.24, whereas those of other PtrMTPs were below 7 (Table 1). Furthermore, all PtrMTP proteins were expected to localize in the vacuole, and notably, some (PtrMTP9, PtrMTP10.2, PtrMTP10.3 and PtrMTP10.4) were also localized in the cytoplasm membrane (Table 1). In addition, most PtrMTP proteins contained 4–6 typical TMDs, whereas PtrMTP11.2 had only three, and PtrMTP12 harbored 12; none was found in PtrMTP6 and PtrMTP8.6 proteins (Table 1).

2.3. Chromosomal Localization and Gene Duplication Analysis of PtrMTP Genes

To explore the physical locations of the PtrMTP genes, genome annotation files were downloaded from the phytozome12 database and analyzed using the TBtools software. The results showed that the 21 out of the 22 PtrMTP genes were located on nine poplar chromosomes with an uneven distribution pattern (Figure 4). Most PtrMTP genes were assigned to chromosomes 01 and 10, which contained 7 and 6 PtrMTP genes, respectively. Interestingly, some PtrMTP genes were closely located to one another in a chromosome, such as five PtrMTP genes (PtrMTP8.2-PtrMTP8.5) on chromosome 01, and four PtrMTP genes (PtrMTP10.1-PtrMTP10.4) on chromosome 10. PtrMTP9 and PtrMTP11.2 were located on chromosome 08, whereas other PtrMTPs were separately located on chromosomes 02, 03, 05, 11, 14 and 16, with one PtrMTP gene on each chromosome (Figure 4). Nevertheless, the PtrMTP6 gene located on scaffold_36 could not be mapped onto any chromosome based on the current version of P. trichocarpa genome sequence.
The obtained physical locations information of the PtrMTP genes prompted us to check the gene duplication events in PtrMTP gene family. The results showed that five genes pairs (PtrMTP8.2/PtrMTP8.3, PtrMTP8.2/PtrMTP8.4, PtrMTP8.4/PtrMTP8.5, PtrMTP10.1/PtrMTP10.2 and PtrMTP10.3/PtrMTP10.4) from chromosomes 01 and 10 were identified as tandem duplication events in the PtrMTP family (Figure 4). At the same time, five pairs (PtrMTP1.1/PtrMTP1.2, PtrMTP3.1/PtrMTP3.2, PtrMTP8.1/PtrMTP8.6, PtrMTP9/PtrMTP10.4 and PtrMTP11.1/PtrMTP11.2) from six different chromosomes were found as segmental duplication events.
To better understand the selection type of these duplication genes, the ratios of the number of nonsynonymous substitutions per nonsynonymous site (Ka) to the number of synonymous substitutions per synonymous site (Ks) of the 10 gene pairs mentioned above were further calculated. As shown in Table 2, the Ka/Ks ratios of all duplicated pairs of the PtrMTP gene were less than 1, which suggested that all these duplication events were under negative selection, based on the summaries from Hurst [21].

2.4. Conserved Motif and Domain Architectures Analysis of PtrMTP Proteins

Our study found that PtrMTP proteins contained a total of twelve conserved motifs (Figure 3c), among which only three encode functional domains according to the annotation from the Pfam or InterProScan tools (Figure 3c and Supplementary Table S4). Motifs 1 and 7 encode Cation efflux, while motif 2 encodes ZT_dimer. Motif 6 was widely shared by all PtrMTPs, except for PtrMTP5, PtrMTP7 and PtrMTP8.6 (Figure 3c). Motifs 7, 11 and 12 were mainly distributed in the Zn-CDFs cluster, while motifs 1, 2, 3, 4, 5, 8, 9 and 10 were specifically distributed in the Mn-CDFs cluster. It was also found that the members of the same cluster or group had similar motif types and distributions (Figure 3c). Of the three clusters, Zn/Fe-CDFs contained the smallest number of motifs (group 6 only contained two, and group 7 contained none), Zn-CDFs contained 2–6 motifs (group 1 contained 4 or 5, group 5 contained 2, and group 12 contained 6), whereas Mn-CDFs had the largest number and the most similar types (group 8 contained 8 or 9, and group 9 contained 9 or 10), except for PtrMTP8.6, which contained only three (Figure 3c).
A conserved domain analysis showed that all the PtrMTP proteins contained the cation efflux domain (Figure 5), a typical feature of the MTP protein [5], whereas the members of groups 6, 8 (except for PtrMTP8.6) and 9 possessed a ZT dimer, an important zinc transporter dimerization domain.

2.5. Cis-Acting Elements in the Promoter Regions of PtrMTP Genes

A total of 1271 cis-acting regulatory elements were identified, which were classified into nine major classes, i.e., 917 elements for gene transcription, 52 elements for abiotic stress, 1 element for biotic stress, 8 elements for tissue expression, 5 elements for secondary metabolism, 80 elements for phytohormonal response, 168 elements for light response, 5 elements for circadian control and 35 elements for site binding (Table 3 and Supplementary Table S5).
Among these, gene transcription elements including 366 CAAT elements and 551 TATA-box elements, which were the most abundance elements, and light responsiveness elements, such as ACE, ATCT-motif, Box 4 and CATT-motif, were commonly present in all PtrMTPs. Responsive elements of various phytohormones, such as ABRE, P-box, GARE-motif, TATC-box and SARE, were found in all PtrMTP genes, except for the PtrMTP1.1 and PtrMTP1.2 genes. Abiotic stress elements including LTR, MBS, TC-rich repeat, WUN-motif, ARE and GC-motif were distributed in the promoters of all PtrMTP genes except for PtrMTP1.1. In comparison, the AT-rich element involved in biotic stress responsive was detected only in the promoter of the PtrMTP3.2 gene. Additionally, tissue expression elements including CAT-box and GCN4_motif were present in promoters of PtrMTP1.2, PtrMTP3.2, PtrMTP4, PtrMTP6, PtrMTP9, PtrMTP10.1, PtrMTP10.3 and PtrMTP10.4 genes. Moreover, secondary metabolism elements were only detected in the promoters of PtrMTP1.1, PtrMTP3.2, PtrMTP6 and PtrMTP12, including MBSI involved in flavonoid metabolism and O2-site zein involved in zein metabolism. Notably, site-binding elements were found in all PtrMTP genes, except for PtrMTP1.1, PtrMTP7, PtrMTP8.5, PtrMTP6, PtrMTP10.4 and PtrMTP12, whereas circadian control elements were only present in promoters of PtrMTP8.4, PtrMTP8.5 and PtrMTP8.6 (Table 3 and Supplementary Table S5). These results indicated a diverse and complicated control of PtrMTP gene expression at the transcriptional level.

2.6. Potential miRNA Target Sites in PtrMTP Genes

To explore the probable regulatory mechanism of PtrMTP gene expression at the post-transcriptional level, potential miRNAs target sites were predicted using psRNATarget. Finally, we successfully identified a total of 11 miRNAs that targeted 8 PtrMTP genes (Table 4). Among these, PtrMTP12 comprised target sites for three miRNAs (ptc-miR6427-3p, ptc-miR172b-5p and ptc-miR172g-5p), four PtrMTP genes, i.e., PtrMTP7, PtrMTP8.1, PtrMTP11.1 and PtrMTP11.2, contained target sites for two miRNAs, and the remaining three (PtrMTP1.1, PtrMTP3.1 and PtrMTP10.3) possessed target sites for single miRNA. Moreover, most of the identified miRNAs function by cleaving target mRNAs, while ptc-miR6426a, ptc-miR6426b, ptc-miR473b and ptc-miR480 work by translation inhibition. In addition, the value of target accessibility-maximum energy to unpair the target site (UPE) of the miRNA/PtrMTP varied from 13.362 (ptc-miR480/PtrMTP7) to 19.17 (ptc-miR6466-3p/PtrMTP10.3).

2.7. The Temporal and Spatial Expression Patterns of PtrMTP Genes

The tissue expression patterns of PtrMTPs were investigated by using transcriptome data. As shown in Figure 6, all 22 PtrMTP genes were expressed in the 12 tested tissues (log2(FPKM+1) > 0), except for PtrMTP8.6 (which had weak expression only in late dormant bud, root and male catkin) and PtrMTP10.3 (unexpressed in female catkin, fully open bud, root tip and early dormant bud). Among these, seven genes (PtrMTP3.2, PtrMTP12, PtrMTP11.2, PtrMTP6, PtrMTP1.1, PtrMTP5 and PtrMTP7) showed constitutive expression (log2(FPKM+1) > 1 in all tissues), and PtrMTP3.2 had the highest expression levels compared with other PtrMTPs in all detected tissues, except for in late dormant bud, whereas two genes (PtrMTP8.6 and PtrMTP10.2) exhibited the lowest expression levels in all tissues (0 < log2(FPKM+1) < 1). Moreover, some genes exhibited tissue-specific expression. For instance, four genes (PtrMTP8.5, PtrMTP8.2 and PtrMTP8.4) in late dormant bud, three genes (PtrMTP9 and PtrMTP10.3) in root, four genes (PtrMTP3.1, PtrMTP10.1 and PtrMTP11.1) in male catkin, and one gene (PtrMTP10.4) in stem nodes showed the highest transcript abundances.

2.8. Expression Profiles of PtrMTPs under Different Heavy Metal Treatments

To gain more insight into the gene expression regulatory mechanism of PtrMTPs, four-week-old tested tube plantlets of P. trichocarpa were subjected to seven different metal treatments. The relative expression levels of PtrMTPs in roots, stems and leaves were investigated.
Under normal conditions, the expression levels of PtrMTP4, PtrMTP8.3, PtrMTP8.4, PtrMTP8.5, PtrMTP10.2 and PtrMTP10.4 were higher in roots, whereas those of the PtrMTP1.1, PtrMTP7, PtrMTP9, PtrMTP10.1, PtrMTP10.3, PtrMTP11.1 and PtrMTP12 genes displayed higher expression levels in stems, and PtrMTP3.1, PtrMTP3.2, PtrMTP11.2 genes displayed higher expression levels in leaves. However, the PtrMTP1.2, PtrMTP5 and PtrMTP8.2 genes showed similar expression levels in roots and stems, which were higher than those in the leaves. PtrMTP6, PtrMTP8.1 and PtrMTP8.6 have similar expression levels in stems and leaves, which were higher than those in roots (Figure 7).
We present an overview of the expression levels of all the PtrMTP genes under heavy metal toxicity relative to these under normal conditions in Table 5. In detail, we summarized the PtrMTP genes in each tissue with expression changes over four times: In root, Cd enhanced the expression of PtrMTP11.1; Cu increased the expression levels of PtrMTP8.1 and PtrMTP10.3, but decreased the expression levels of PtrMTP9; Mn repressed the expression levels of PtrMTP9 and PtrMTP10.3; Ni also repressed the expression levels of PtrMTP10.3, but Zn enhanced its expression. In stem, Cd repressed the expression levels of PtrMTP12; Co increased the expression levels of PtrMTP8.6 but decreased the expression levels of PtrMTP10.3; Cu increased the expression levels of PtrMTP8.3; Mn increased the expression levels of PtrMTP8.1, PtrMTP8.3, PtrMTP8.4, PtrMTP8.5, PtrMTP10.4 and PtrMTP11.2; Ni repressed the expression levels of PtrMTP10.3. In leaf, Cu enhanced the expression of PtrMTP5, PtrMTP8.2, PtrMTP8.3, PtrMTP8.4, PtrMTP8.5, PtrMTP10.1, PtrMTP10.2, PtrMTP10.3, PtrMTP10.4, and PtrMTP11.1; Fe increased the expression levels of PtrMTP9, PtrMTP10.1, and PtrMTP10.3; Mn increased the expression levels of PtrMTP10.3; Zn increased the expression levels of PtrMTP8.4, PtrMTP10.1, PtrMTP10.3, and PtrMTP10.4 (Figure 7 and Table 5). However, the expression levels of the PtrMTP3.1, PtrMTP3.2 and PtrMTP6 genes nearly did not change in each tissue under heavy metal toxicity (Figure 7 and Table 5).

2.9. Effect of PtrMTP Genes on Yeast Growth

According to the expression analysis results and the categories of PtrMTP genes, we selected six representative PtrMTP genes (PtrMTP4, PtrMTP6, PtrMTP8.1, PtrMTP8.4, PtrMTP9, and PtrMTP10.4) as the objects for a yeast metal sensitivity testing assay. These genes were expressed in the parental strain BY4741 and five yeast mutants that are highly sensitive to Cd (Δycf1), Co (Δcot1), Fe (Δccc1), Mn (Δpmr1) and Zn (Δzrc1), respectively. As shown in Figure 8, the expression of PtrMTP6 could rescue the sensitivities of Δcot1, Δccc1 and Δpmr1 to Co, Fe and Mn, respectively. Moreover, the expressions of PtrMTP8.1, PtrMTP9 and PtrMTP10.4 alleviated the sensitivity of Δpmr1 to Mn. However, the expression of PtrMTP4 and PtrMTP8.4 could not alter any sensitive phenotypes of the mutants tested. These results suggested that PtrMTP8.1, PtrMTP9 and PtrMTP10.4 could transport Mn2+, while PtrMTP6 could transport Mn2+, Co2+ and Fe2+ in yeast cells.

3. Discussion

3.1. Evolution and Differentiation of PtrMTP Genes as well as Their Proteins Architectures

Here, a total of 22 PtrMTPs were identified and named by bioinformatics methods. Compared with that of previous report, three new MTP genesn were found in P. trichocarpa [20]. The number of MTPs in P. trichocarpa was only second to N. tabacum among the plant species in which the MTPs have been identified [5,8,22,23,24,25,26,27,28]. However, despite the large number of PtrMTPs, the homolog of AtMTP2 in P. trichocarpa was not detected. These results indicated that gene expansion and/or gene loss may have occurred in the history of PtrMTP gene family evolution. This hypothesis was later supported by the gene duplication analysis, which revealed that ten duplication events existed in the PtrMTP gene family, among which five were segmental and another five were tandem duplications (Figure 4, Table 2). Gene duplication in the genome may lead to the production of new genes with novel functions [29]. Thus, it would be of great interest to investigate the relationship between MTP gene family differentiation and heavy metal tolerance in different plant species in future studies.
As the most typical structural features of MTP proteins, the cation efflux domain and the modified signature sequence were detected in all of the PtrMTPs, although some other motifs/domains were not present in certain PtrMTP members. Interestingly, PtrMTP6 and PtrMTP8.6 did not possess any TMDs (Table 1), a common structure of membrane proteins [30], which suggested that these two proteins might play novel roles, i.e., other than transporters. In addition, it is notable that unlike other PtrMTP members, PtrMTP12 had the largest protein size (869 amino acids), MW (97.50 kD) and TMD number (12 TMDs) (Table 1). This result was consistent with the characteristics of other plants MTP12 [23,25,26], indicating the distinctive biological functions and evolutionary processes of MTP12. Moreover, ZT_dimer has been recognized as the dimerization region of metal ion transporters, through which the homodimers or heterodimers of MTPs can form [31]. In this study, the ZT_dimer was detected in members of groups 6, 8 (except for PtrMTP8.6) and 9, but the question of whether this domain is correlated with their functions requires further investigation (Figure 5).

3.2. Regulation of PtrMTP Gene Expression in P. trichocarpae

Gene expression control happens at two different levels: one is transcriptional regulation, and the other is post-transcriptional regulation. For the former, cis-acting regulatory elements (CRE) play essential roles by interacting with RNA polymerase and specific transcription factors. In this study, the CAAT-box and TATA-box, which are involved in regulating the expression frequency and initiation of transcription respectively [32], were detected in the upstream region of PtrMTP genes at a high frequency (Table 3 and Supplementary Table S5). In addition, light-responsive elements, phytohormonal responsive elements and abiotic stress and site-binding elements were also widely distributed in most of PtrMTP genes (Table 3 and Supplementary Table S5), implying that PtrMTP genes could be transcriptionally regulated by multiple stimuli.
Previous studies have shown that miRNAs play versatile roles in plant growth and development control and stresses responses [33]. Most of the 11 miRNAs identified in this study perform their functions by cleaving target mRNA, like ptc-miR2111a/b, ptc-miR172b-5p, ptc-miR172g-5p, ptc-miR6427-3p, ptc-miR6464 and ptc-miR6466-3p, while others, e.g., ptc-miR6426a, ptc-miR6426b, ptc-miR473b and ptc-miR480, carry out their functions by translation inhibition. Most of these miroRNAs have been demonstrated to play important roles against environmental stress responses. miR473 was reported only in tree species, and participates in the response to mycorrhizal symbiosis and drought in Poncirus trifoliate and populus, respectively [34,35,36]. miR2111 could be induced by Pi starvation in Arabidopsis, but it could also fulfill shoot-to-root translocation to control rhizobial infection in legume roots [37,38]. Moreover, the miR6426 are involved in the response to nutrient deficiencies and contribute to Mg-deficiency tolerance in Citrus sinensis [39]. miR172b is a key controller of the autotrophic development transition in Arabidopsis [40]. These findings imply the possible involvement of PtrMTP in abiotic and biotic stress response through post-transcriptional regulation mediated by miRNAs.

3.3. The Diverse Expression Patterns of PtrMTP Genes

Of 22 PtrMTPs, 15 exhibited organ/tissue specificity of gene expression during growth and development of poplar, and most PtrMTP genes could respond to at least two metal ions in poplar roots, stems or leaves under heavy metal stresses. The abundant cis-acting regulatory elements and different expression pattern of the PtrMTP gene imply that PtrMTP members play an important role in plant development and stress responses.
Notably, some paralogous genes from the same group, especially some tandem and segmental duplication gene pairs, showed different expression patterns when analyzed by transcriptome data and quantitative RealTime-PCR (qRT-PCR) under various metal ions stresses in different tissues and developmental stages (Figure 6, Figure 7), such as PtrMPT1.1/PtrMPT1.2 and PtrMPT3.1 /PtrMPT3.2 gene pairs. This may due to the long-term evolution of PtrMPT genes, and resulted in the precise and specific regulation mechanism of metal homeostasis in poplar species. Notably, although the majority of tissue expression patterns of PtrMPT genes, including groups 1, 3, 4, 5, 6, 7 and 8, were consistent with the result of transcriptome data, some genes belonging to groups 9, 10, 11 and 12 showed some contradictions between the qRT-PCR results and transcriptome data (Figure 7). This inconsistency was also mentioned in our previous literature [26].
Furthermore, the expression of most PtrMTP genes could be induced by multiple metals, although some were not putative heavy metal substrates (Figure 7, Table 5). For instance, excess Cu, which is not a potential substrate for the MTP family, could induce the transcription levels of PtrMTP genes (Figure 7, Table 5). Similar findings were also made in sweet orange and turnip [24,25]. Other than Mn, the expression of the Mn-CDFs, PtrMTP9 and PtrMTP10.3 were sharply upregulated by excess Fe and Zn, respectively (Figure 7, Table 5). On the other hand, MTP genes may not response to their transport substrates. For example, PtrMTP1.2, PtrMTP3.1, PtrMTP3.2, PtrMTP4 and PtrMTP12, which are Zn-CDF genes, underwent no large changes under excess Zn treatment. We speculate that this may be due to the Zn treatment concentrations used in our experiment. In other words, the response of these genes may require higher or lower concentrations of Zn treatment. Certainly, gene response may also happen at the post-transcriptional level, rather than the transcription level. For example, the abundance of the Zn transporter CsMTP1 was increased four-fold in excess Zn treated cucumber roots, whereas the mRNA level of the CsMTP1 gene was not significantly changed [41]. Other studies have shown that the response of heavy metal transport happened at the post-translational level through changing protein levels, localization and the turnover of transporters [42,43,44,45]. In addition, some MTPs even displayed no response to Zn treatment at both the transcriptional and post-transcriptional levels, though it functioned in maintaining intracellular Zn homeostasis by Zn transport, such as AtMTP1 in Arabidopsis [9]. Interestingly, although the accumulation of AtMTP12 was not dependent on Zn concentration, but it could form a functional complex with another MTP, AtMTP5, to transport Zn [12]. These results indicate a complicated and multilayered regulatory mechanism underlying the response of MTPs to heavy metal substrates. Thus, it is necessary to investigate protein level changes under excess heavy metal treatment, and to identify the protein complex of PtrMTPs in future studies.

3.4. Some PtrMTPs were Co, Fe and Mn Transporters in Yeast Cells

A yeast–metal sensitivity test assay was performed to clarify the heavy metal substrates of selected PtrMTP transporters. Our results indicated that PtrMTP6, an MTP member with no predictable TMD domain, could transport three different heavy metals: Co, Fe and Mn ions (Figure 8). Similar findings were recently reported by Migocka et al., who found that CsMTP6 could affect iron and manganese homeostasis in cucumber mitochondria [46]. In addition, three PtrMTP members, PtrMTP8.1, PtrMTP9, and PtrMTP10.4, showed specific transport abilities for Mn in yeast cells (Figure 8). These results were in agreement with previous studies. CsMTP8 and OsMTP8.1 are tonoplast-localized Mn transporters which are responsible for Mn tolerance in cucumber and rice, respectively [22,47,48]. Cucumber MTP9 homologue was proved to be a plasma membrane antiporter that functions in Mn2+ and Cd2+ efflux from root cells [49]. Erbasol et al. found that the Golgi apparatus localized sea beet BmMTP10 was specific to Mn2+ transport, with a role in reducing excess cellular Mn2+ levels in yeast [50]. Nevertheless, PtrMTP8.4, unlike its paralog PtrMTP8.1, did not show any metal transport abilities in the present study, indicating a functional diversity of PtrMTP within the same group (Figure 8). CsMTP4 from cucumber is the only MTP4 homolog that has been functionally characterized to date. This protein is localized in the vacuolar membranes to sequestrate Zn and Cd into vacuole [42]. However, in our investigation, PtrMTP4 could not transport Zn and Cd as well as other heavy metals in yeast cells (Figure 8). These results suggest that homologs of MTP across plant species may have different biological functions.

4. Materials and Methods

4.1. Identification and Phylogenetic Analysis of the MTPs in P. Trichocarpa

Twelve MTP genes in A. thaliana were downloaded from the TAIR database (https://www.arabidopsis.org/), and were used as queries to perform in TBLASTP searches against the P. trichocarpa genome [51]. After analysis with InterProScan (http://www.ebi.ac.uk/interpro/search/sequence-search), the remaining 22 nonredundant candidates were recognized as PtrMTP proteins. Sequence similarity analysis was performed at NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi) as described previously [26]. For phylogenetic analysis, sequences of MTP proteins from P. trichocarpa and other plant species were first aligned by the Clustal X2.1 [52]; then, phylogenetic trees were established with the Maximum Likelihood method by the MEGA6.06 software [53]. Sequences of MTPs from B. diastychon, C. sativus, N. tabacum, O. sativa, Sorghum bicolor, V. vinifera, and Z. mays were obtained from the databases, as described by Liu et al. [26].

4.2. Analysis of Genomic Structure, Chromosomal Localization, Gene Duplication and Ka/Ks of MTPs in P. trichocarpa

The TBtools software (https://github.com/CJ-Chen/TBtools) was used to determine the exon-intron organization and chromosomal localization of PtrMTP genes using the genome annotation files downloaded from phytozome12 database (https://phytozome.jgi.doe.gov/pz/ portal.html) [54]. The gene duplication events of PtrMTP genes were determined by Multiple Collinearity Scan toolkit (MCScanX) [55]. DnaSP v6 software was used to compute the Ka and Ks substitution rates, as described by Rozas et al. [56].

4.3. Amino Acid Properties and Structure Characteristics of PtrMTP Proteins

For amino acid properties, the ProParam tool (https://web.expasy.org/protparam/), Plant-mPLoc server (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/) and the TMHMM Server V.2.0 (http://www.cbs.dtu.dk/services/TMHMM/) were used to predict theMW, pI, GRAVY, subcellular localizations and the putative transmembrane regions of PtrMTP proteins, respectively.
For protein structure characteristics, the MEME program (http://alternate.meme-suite.org/tools/meme) and the Pfam tool (http://pfam.xfam.org/search#tabview=tab1) were used to identify the conserved motifs and domains of PtrMTP proteins, respectively.

4.4. Prediction of Cis-Acting Regulatory Elements and MicroRNA (miRNA) Target Sites of PtrMTP Genes

Promoter sequences located 1.0 kb upstream of PtrMTP genes were searched using the phytozome12 database, and related cis-acting regulatory elements were analyzed using the PlantCare database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/). The miRNA target sites of PtrMTPs were predicted using a small RNA target analysis server (psRNATarget server: http://plantgrn.noble.org/psRNATarget/).

4.5. Tissue Expression Pattern Based on RNA-seq Data

The fragments per kilobase of exon model per million mapped reads (FPKM) of PtrMTP genes in 12 different tissues in varying developmental stages were downloaded from the Phytozome12 database. Subsequently, the normalized data (log2(FPKM+1)) were used to estimate the expression levels, and a heatmap was created by TBtools software.

4.6. Growth Condictions and Heavy Metal Treatments

Tube plantlets of P. trichocarpa were grown in a greenhouse with 16 h/8 h photoperiod (24 °C/18 °C). Thirty-day-old plants were then placed in 1/2 Hoagland solutions (pH 6.0) supplemented with different heavy metal, with concentrations of 0.1 mM CdCl2, 0.1 mM CoCl2, 0.1 mM CuSO4, 0.5 mM FeSO4, 1 mM MnSO4, 0.1 mM NiSO4 and 0.5 mM ZnSO4, respectively, and normal 1/2 Hoagland solutions were used as the control (CK). Then, 24 h later, the roots, stems and leaves of tube plantlets were collected, and used as materials for RNA extraction.

4.7. RNA Extraction and qRT-PCR Analysis

RNA extraction, cDNA preparation and qRT-PCR were performed as suggested by Liu et al. with minor modifications [26]. Each experiment was performed with three technical replicates. Two house-keeping genes, UBQ (GenBank accession LOC7455401) and EF1α (GenBank accession LOC18100225), were used as internal reference. The primers used for qRT-PCR are listed in Supplementary Table S1. The qRT-PCR programs were as described by Gao et al. [57]. The relative expression values were calculated using the 2–ΔΔ Ct method [58].

4.8. Yeast Transformation and Growth Assay

The full coding regions of six PtrMTP genes were amplified from the cDNAs that was reverse-transcribed from the total RNA of plant leaves. The specific primers used for yeast expression vector construction are presented in Supplementary Table S2. The PCR products were then inserted into Kpn I + Xba I or Hind III + Xba I sites of the pYES2.0 vector.
In this study, the following wild-type and mutants of yeast (Saccharomyces cerevisiae) strains obtained from the Euroscarf (http://www.euroscarf.de/index.php?name=News) were used: Y00000 (BY4741), Y00829 (Δzrc1), Y04534 (Δpmr1), Y01613 (Δcot1), Y04069 (Δycf1), and Y04169 (Δccc1). Yeast transformations were performed by LiOAc/PEG method [59]. The solid synthetic drop-out (SD) uracil medium with glucose (SD-Ura/Glu) was used for the selection of yeast transformants. Subsequently, overnight yeast cultures were applied in drop assays, which were performed as described by Liu et al. [26].

5. Conclusions

In this study, 22 MTP members in P. trichocarpa were identified, and a systematic and comprehensive analysis of PtrMTP genes was performed. The 22 PtrMTPs were divided into three major substrate-specific clusters and seven groups. The MTP gene family in poplar underwent expansions in MTP1, MTP3, MTP8, MTP10, and MTP11 compared with those of Arabidopsis, although MTP2 might have been lost to evolutionary history. The structural characteristics of PtrMTP were similar within groups, but were diverse among different groups. The temporal and spatial expression patterns of PtrMTP genes were either similar or varied within the same group. In response to different heavy metal stresses, most PtrMTP genes were induced by at least two metal ions in roots, stems or leaves. Additionally, PtrMTP8.1, PtrMTP9 and PtrMTP10.4 were found to function as Mn transporters, and PtrMTP6 could transport three different heavy metal ions, i.e., Co, Fe and Mn in yeast cells, indicating that these proteins might play important roles in heavy metal homeostasis, detoxification and tolerance in poplar. These results will provide an important foundation for better understanding the mechanism of heavy metal transport mediated by PtrMTP proteins. In addition, our study will also provide important gene resources for the genetic modification of the heavy metal accumulation abilities of plants which can be widely used in phytoremediation.

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/21/5/1680/s1.

Author Contributions

Conceptualization, Y.G.; Formal analysis, Y.G., F.Y. and J.L.; Funding acquisition, Y.Y.; Investigation, Y.G., F.Y., J.L., W.X., L.Z., Z.C., Z.P. and Y.O.; Methodology, Y.G.; Project administration, Y.G.; Supervision, Y.Y.; Writing—original draft, Y.G. and F.Y.; Writing—review & editing, J.L., Y.O. and Y.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (81703656), the Foreign Cooperation Fund of Sichuan Provincial Science and Technology Department (2017HM0076), the Scientific Research Fund of Sichuan Provincial Education Department (17ZB0456), the Doctoral Fund Project of Southwest University of Science and the Technology (14zx7157) and Longshan Academic Talent Research Supporting Program of Southwest University of Science and Technology (18LZX626 and LSZ326).

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

Abbreviations

MTPMetal tolerance protein
CDFsCation diffusion facilitators
TMDsTransmembrane domains
MWMolecular weight
UTRUntranslated regions
CDSCoding sequence
pIIsoelectric point
GRAVYGrand average of hydropathicity
ChrChromosomes
KaThe number of nonsynonymous substitutions per nonsynonymous site
KsThe number of synonymous substitutions per synonymous site
FPKMFragments Per Kilobase of exon model per Million mapped reads
qRT-PCRquantitative RealTime-PCR
SDSynthetic drop-out

References

  1. Vareda, J.P.; Valente, A.J.M.; Duraes, L. Assessment of heavy metal pollution from anthropogenic activities and remediation strategies: A review. J. Environ. Manag. 2019, 246, 101–118. [Google Scholar] [CrossRef] [Scilit]
  2. Ali, H.; Khan, E.; Sajad, M.A. Phytoremediation of heavy metals—Concepts and applications. Chemosphere 2013, 91, 869–881. [Google Scholar] [CrossRef] [Scilit]
  3. Clemens, S. Molecular mechanisms of plant metal tolerance and homeostasis. Planta 2000, 212, 475–486. [Google Scholar] [CrossRef] [Scilit]
  4. Hall, J.L.; Williams, L.E. Transition metal transporters in plants. J. Exp. Bot. 2003, 54, 2601–2613. [Google Scholar] [CrossRef] [Scilit]
  5. Montanini, B.; Blaudez, D.; Jeandroz, S.; Sanders, D.; Chalot, M. Phylogenetic and functional analysis of the Cation Diffusion Facilitator (CDF) family: Improved signature and prediction of substrate specificity. BMC Genom. 2007, 8, 107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Nies, D.H.; Silver, S. Ion efflux system involved in bacterial metal resistances. J. Ind. Microbiol. 1995, 14, 186–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Paulsen, I.T.; Saier, M.H. A novel family of ubiquitous heavy metal ion transport proteins. J. Membr. Biol. 1997, 156, 99–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Gustin, J.L.; Zanis, M.J.; Salt, D.E. Structure and evolution of the plant cation diffusion facilitator family of ion transporters. BMC Evol. Biol. 2011, 11, 76. [Google Scholar] [CrossRef] [Scilit]
  9. Kobae, Y.; Uemura, T.; Sato, M.H.; Ohnishi, M.; Mimura, T.; Nakagawa, T.; Maeshima, M. Zinc transporter of Arabidopsis thaliana AtMTP1 is localized to vacuolar membranes and implicated in zinc homeostasis. Plant Cell Physiol. 2004, 45, 1749–1758. [Google Scholar] [CrossRef] [Scilit]
  10. Desbrosses-Fonrouge, A.G.; Voigt, K.; Schröder, A.; Arrivault, S.; Thomine, S.; Krämer, U. Arabidopsis thaliana MTP1 is a Zn transporter in the vacuolar membrane which mediates Zn detoxification and drives leaf Zn accumulation. FEBS Lett. 2005, 579, 4165–4174. [Google Scholar] [CrossRef] [Scilit]
  11. Arrivault, S.; Senger, T.; Kramer, U. The Arabidopsis metal tolerance protein AtMTP3 maintains metal homeostasis by mediating Zn exclusion from the shoot under Fe deficiency and Zn oversupply. Plant J. 2006, 46, 861–879. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Fujiwara, T.; Kawachi, M.; Sato, Y.; Mori, H.; Kutsuna, N.; Hasezawa, S.; Maeshima, M. A high molecular mass zinc transporter MTP12 forms a functional heteromeric complex with MTP5 in the Golgi in Arabidopsis thaliana. FEBS J. 2015, 282, 965–1979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Eroglu, S.; Meier, B.; vonWirén, N.; Peiter, E. The vacuolar manganese transporter MTP8 determines tolerance to iron deficiency-induced chlorosis in Arabidopsis. Plant Physiol. 2016, 170, 1030–1045. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Chu, H.H.; Car, S.; Socha, A.L.; Hindt, M.N.; Punshon, T.; Guerinot, M.L. The Arabidopsis MTP8 transporter determines the localization of manganese and iron in seeds. Sci. Rep. 2017, 7, 11024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Eroglu, S.; Giehl, R.F.H.; Meier, B.; Takahashi, M.; Terada, Y.; Ignatyev, K.; Andresen, E.; Küpper, H.; Peiter, E.; von Wirén, N. Metal tolerance protein 8 mediates manganese homeostasis and iron reallocation during seed development and germination. Plant Physiol. 2017, 174, 1633–1647. [Google Scholar] [CrossRef] [Scilit]
  16. Delhaize, E.; Gruber, B.D.; Pittman, J.K.; White, R.G.; Leung, H.; Miao, Y.; Jiang, L.; Ryan, P.R.; Richardson, A.E. A role for the AtMTP11 gene of Arabidopsis in manganese transport and tolerance. Plant J. 2007, 51, 198–210. [Google Scholar] [CrossRef] [Scilit]
  17. Peiter, E.; Montanini, B.; Gobert, A.; Pedas, P.; Husted, S.; Maathuis, F.J.; Blaudez, D.; Chalot, M.; Sanders, D. A secretory pathway-localized cation diffusion facilitator confers plant manganese tolerance. Proc. Natl. Acad. Sci. USA 2007, 104, 8532–8537. [Google Scholar] [CrossRef] [Scilit]
  18. Yadav, R.; Arora, P.; Kumar, S.; Chaudhury, A. Perspectives for genetic engineering of poplars for enhanced phytoremediation abilities. Ecotoxicology 2010, 19, 1574–1588. [Google Scholar] [CrossRef] [Scilit]
  19. Blaudez, D.; Kohler, A.; Martin, F.; Sanders, D.; Chalot, M. Poplar metal tolerance protein 1 confers zinc tolerance and is an oligomeric vacuolar zinc transporter with an essential leucine zipper motif. Plant Cell 2003, 15, 2911–2928. [Google Scholar] [CrossRef] [Scilit]
  20. Migeon, A.; Blaudez, D.; Wilkins, O.; Montanini, B.; Campbell, M.M.; Richaud, P.; Thomine, S.; Chalot, M. Genome-wide analysis of plant metal transporters, with an emphasis on poplar. Cell. Mol. Life Sci. 2010, 67, 3763–3784. [Google Scholar] [CrossRef] [Scilit]
  21. Hurst, L.D. The Ka/Ks ratio: Diagnosing the form of sequence evolution. Trends Genet. 2002, 18, 486. [Google Scholar] [CrossRef] [Scilit]
  22. Migocka, M.; Papierniak, A.; Maciaszczyk-Dziubi’nska, E.; Po’zdzik, P.; Posyniak, E.; Garbiec, A.; Filleur, S. Cucumber metal transport protein MTP8 confers increased tolerance to manganese when expressed in yeast and Arabidopsis thaliana. J. Exp. Bot. 2014, 65, 5367–5384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Vatansever, R.; Filiz, E.; Froglu, S. Genome-wide exploration of metaltolerance protein (MTP) genes in common wheat (Triticum aestivum): Insightsinto metal homeostasis and biofortification. Biometals 2017, 30, 217–235. [Google Scholar] [CrossRef] [Scilit]
  24. Fu, X.; Tong, Y.; Zhou, X.; Ling, L.; Chun, C.; Cao, L.; Zeng, M.; Peng, L.Z. Genome-wide identification of sweet orange (Citrus sinensis) metal tolerance proteins and analysis of their expression patterns under zinc, manganese, copper, and cadmium toxicity. Gene 2017, 629, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Li, X.; Wu, Y.; Li, B.; He, W.; Yang, Y.; Yang, Y. Genome-wide identification and expression analysis of the cation diffusion facilitator gene family in Turnip under diverse metal ion stresses. Front. Genet. 2018, 9, 103. [Google Scholar] [CrossRef] [Scilit]
  26. Liu, J.; Gao, Y.; Tang, Y.; Wang, D.; Chen, X.; Yao, Y.; Guo, Y. Genome-wide identification, comprehensive gene feature, evolution, and expression analysis of plant metal tolerance proteins in tobacco under heavy metal toxicity. Front. Genet. 2019, 24, 345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Shirazi, Z.; Abedi, A.; Kordrostami, M.; Burritt, D.J.; Hossain, M.A. Genome-wide identification and characterization of the metal tolerance protein (MTP) family in grape (Vitis vinifera L.). 3 Biotech 2019, 9, 199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Ram, H.; Kaur, A.; Gandass, N.; Singh, S.; Deshmukh, R.; Sonah, H.; Sharma, T.R. Molecular characterization and expression dynamics of MTP genes under various spatio-temporal stages and metal stress conditions in rice. PLoS ONE 2019, 14, e0217360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Hittinger, C.T.; Carroll, S.B. Gene duplication and the adaptive evolution of a classic genetic switch. Nature 2007, 449, 677–681. [Google Scholar] [CrossRef] [Scilit]
  30. Hofmann, K.; Stoffel, W. TMbase-A database of membrane spanning proteins segments. Biol. Chem. Hoppe Seyler 1993, 374, 166–170. [Google Scholar]
  31. Lu, M.; Fu, D. Structure of the zinc transporter YiiP. Science 2007, 317, 1746–1748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Laloum, T.; De Mita, S.; Gamas, P.; Baudin, M.; Niebel, A. CCAAT box binding transcription factors in plants: Y so many? Trends Plant. Sci. 2013, 18, 157–166. [Google Scholar] [CrossRef] [Scilit]
  33. Gielen, H.; Remans, T.; Vangronsveld, J.; Cuypers, A. MicroRNAs in metal stress: Specific roles or secondary responses? Int. J. Mol. Sci. 2012, 13, 15826–15847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Barakat, A.; Sriram, A.; Park, J.; Zhebentyayeva, T.; Main, D.; Abbott, A. Genome wide identification of chilling responsive microRNAs in Prunus persica. BMC Genom. 2012, 13, 481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Song, F.; He, C.; Yan, X.; Bai, F.; Pan, Z.; Deng, X.; Xiao, S. Small RNA profiling reveals involvement of microRNA-mediated gene regulation in response to mycorrhizal symbiosis in Poncirus trifoliata L. Raf. Tree Genet. Genomes 2018, 14, 42. [Google Scholar] [CrossRef] [Scilit]
  36. Shuai, P.; Liang, D.; Zhang, Z.; Yin, W.; Xia, X. Identification of drought-responsive and novel Populus trichocarpa microRNAs by high-throughput sequencing and their targets using degradome analysis. BMC Genom. 2013, 14, 233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Hsieh, L.C.; Lin, S.I.; Shih, A.C.; Chen, J.; Lin, W.; Tseng, C.Y.; Li, W.H.; Chiou, T.J. Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing. Plant Physiol. 2009, 15, 2120–2132. [Google Scholar] [CrossRef] [Scilit]
  38. Tsikou, D.; Yan, Z.; Holt, D.B.; Abel, N.B.; Reid, D.E.; Madsen, L.H.; Bhasin, H.; Sexauer, M.; Stougaard, J.; Markmann, K. Systemic control of legume susceptibility to rhizobial infection by a mobile microRNA. Science 2018, 362, 233–235. [Google Scholar] [CrossRef] [Scilit]
  39. Ma, C.; Qi, Y.; Liang, W.; Yang, L.; Lu, Y.; Guo, P.; Ye, X.; Chen, L.S. MicroRNA Regulatory Mechanisms on Citrus sinensis leaves to Magnesium-Deficiency. Front. Plant. Sci. 2016, 7, 207. [Google Scholar] [CrossRef] [Scilit]
  40. Zou, Y.; Wang, Y.; Wang, L.; Yang, L.; Wang, R.; Li, X. miR172b Controls the Transition to Autotrophic Development Inhibited by ABA in Arabidopsis. PLoS ONE 2013, 8, e64770. [Google Scholar] [CrossRef] [Scilit]
  41. Migocka, M.; Kosieradzka, A.; Papierniak, A.; Maciaszczyk-Dziubinska, E.; Posyniak, E.; Garbiec, A.; Filleur, S. Two metal-tolerance proteins, MTP1 and MTP4, are involved in Zn homeostasis and Cd sequestration in cucumber cells. J. Exp. Bot. 2015, 66, 1001–1015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Migocka, M.; Małas, K.; Maciaszczyk-Dziubinska, E.; Posyniak, E.; Migdal, I.; Szczech, P. Cucumber Golgi protein CsMTP5 forms a Zn-transporting heterodimer with high molecular mass protein CsMTP12. Plant. Sci. 2018, 277, 196–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Liu, X.; Culotta, V.C. Post-translation control of Nramp metal transport in yeast: Role of metal ions and the bsd2 gene. J. Biol. Chem. 1999, 274, 4863–4868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Rutherford, J.C.; Bird, A.J. Metal-Responsive Transcription Factors That Regulate Iron, Zinc, and Copper Homeostasis in Eukaryotic Cells. Eukaryot. Cell 2004, 3, 1–13. [Google Scholar] [CrossRef] [Scilit]
  45. Culotta, V.C.; Yang, M.; Hall, M.D. Manganese transport and trafficking: Lessons learned from Saccharomyces cerevisiae. Eukaryot. Cell 2005, 4, 1159–1165. [Google Scholar] [CrossRef] [Scilit]
  46. Migocka, M.; Maciaszczyk-Dziubinska, E.; Małas, K.; Posyniak, E.; Garbiec, A. Metal tolerance protein MTP6 affects mitochondrial iron and manganese homeostasis in cucumber. J. Exp. Bot. 2019, 70, 285–300. [Google Scholar] [CrossRef] [Scilit]
  47. Chen, Z.; Fujii, Y.; Yamaji, N.; Masuda, S.; Takemoto, Y.; Kamiya, T.; Yusuyin, Y.; Iwasaki, K.; Kato, S.; Maeshima, M.; et al. Mn tolerance in rice is mediated by MTP8.1, a member of the cation diffusion facilitator family. J. Exp. Bot. 2013, 64, 4375–4387. [Google Scholar] [CrossRef] [Scilit]
  48. Chen, X.; Li, J.; Wang, L.; Ma, G.; Zhang, W. A mutagenic study identifying critical residues for the structure and function of rice manganese transporter OsMTP8.1. Sci. Rep. 2016, 6, 32073. [Google Scholar] [CrossRef] [Scilit]
  49. Migocka, M.; Papierniak, A.; Kosieradzka, A.; Posyniak, E.; Maciaszczyk-Dziubinska, E.; Biskup, R.; Garbiec, A.; Marchewka, T. Cucumber metal tolerance protein CsMTP9 is a plasma membrane H+-coupled antiporter involved in the Mn2+ and Cd2+ efflux from root cells. Plant. J. 2015, 84, 1045–1058. [Google Scholar] [CrossRef] [Scilit]
  50. Erbasol, I.; Bozdag, G.O.; Koc, A.; Pedas, P.; Karakaya, H. C Characterization of two genes encoding metal tolerance proteins from Beta vulgarissubspeciesmaritimathat confers manganese tolerance in yeast. Biometals 2013, 26, 795–804. [Google Scholar] [CrossRef] [Scilit]
  51. Tuskan, G.A.; Difazio, S.; Jansson, S.; Bohlmann, J.; Grigoriev, I.; Hellsten, U.; Putnam, N.; Ralph, S.; Rombauts, S.; Salamov, A.; et al. The genome of Black Cottonwood, Populus trichocarpa (Torr. & Gray). Science 2006, 313, 1596–1604. [Google Scholar] [PubMed]
  52. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; Mcgettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal Wand Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Chen, C.; Xia, R.; Chen, H.; He, Y. TBtools, a toolkit for biologists integrating various HTS-data handling tools with a user-friendly interface. BioRxiv 2018. [Google Scholar] [CrossRef] [Scilit]
  55. Wang, Y.; Tang, H.; Debarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [Scilit]
  56. Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef] [Scilit]
  57. Gao, Y.; Liu, J.; Yang, F.; Zhang, G.; Wang, D.; Zhang, L.; Ou, Y.B.; Yao, Y.A. The WRKY transcription factor WRKY8 promotes resistance to pathogen infection and mediates drought and salt stress tolerance in Solanum lycopersicum. Physiol. Plant. 2019, 168, 98–117. [Google Scholar] [CrossRef] [Scilit]
  58. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
  59. Gietz, R.D.; Schiestl, R.H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2007, 2, 31–34. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Phylogenetic relationship of MTP proteins in P. trichocarpae and Arabidopsis. The PtrMTP proteins were named according to the sequence identity and cover values, as well as the orthologous relationship compared with AtMTPs. The black solid circles represent the MTP proteins from P. trichocarpae.
Figure 1. Phylogenetic relationship of MTP proteins in P. trichocarpae and Arabidopsis. The PtrMTP proteins were named according to the sequence identity and cover values, as well as the orthologous relationship compared with AtMTPs. The black solid circles represent the MTP proteins from P. trichocarpae.
Ijms 21 01680 g001
Figure 2. Phylogenetic relationships of MTP proteins in P. trichocarpae and other plant species. One hundred and eighteen MTP proteins are clustered into three major substrate-specific groups and seven primary groups, which are highlight in different colors. The different symbols represent the MTP proteins of different species as follows. Solid triangles: Arabidopsis thaliana; hollow triangles: Brachypodium diastychon; reverse hollow triangles: Zea mays; solid diamonds: Cucumis sativus; hollow diamonds: Vitis vinifera; solid circles: Populus trichocarpae; hollow circles: Nicotiana tabacum; solid squares: Sorghum bicolor; hollow squares: Oryza sativa.
Figure 2. Phylogenetic relationships of MTP proteins in P. trichocarpae and other plant species. One hundred and eighteen MTP proteins are clustered into three major substrate-specific groups and seven primary groups, which are highlight in different colors. The different symbols represent the MTP proteins of different species as follows. Solid triangles: Arabidopsis thaliana; hollow triangles: Brachypodium diastychon; reverse hollow triangles: Zea mays; solid diamonds: Cucumis sativus; hollow diamonds: Vitis vinifera; solid circles: Populus trichocarpae; hollow circles: Nicotiana tabacum; solid squares: Sorghum bicolor; hollow squares: Oryza sativa.
Ijms 21 01680 g002
Figure 3. Phylogenetic relationships, gene structure and conserved motifs in MTP genes from P. trichocarpae. (a) A phylogenetic tree was constructed using the MEGA 6.0 software based on the full-length sequences of poplar MTP proteins. Seven primary groups are shown in different colors. (b) Exon-intron structure of poplar MTP genes. Yellow boxes indicate untranslated 5′- and 3′-regions (UTR); green boxes indicate exons; gray lines indicate introns. The number indicates the phases of corresponding introns. (c) Conserved motifs were identified by MEME and are displayed in different colored boxes.
Figure 3. Phylogenetic relationships, gene structure and conserved motifs in MTP genes from P. trichocarpae. (a) A phylogenetic tree was constructed using the MEGA 6.0 software based on the full-length sequences of poplar MTP proteins. Seven primary groups are shown in different colors. (b) Exon-intron structure of poplar MTP genes. Yellow boxes indicate untranslated 5′- and 3′-regions (UTR); green boxes indicate exons; gray lines indicate introns. The number indicates the phases of corresponding introns. (c) Conserved motifs were identified by MEME and are displayed in different colored boxes.
Ijms 21 01680 g003
Figure 4. Distribution of the PtrMTP genes on P. trichocarpae chromosomes. The chromosome number is indicated on the left side of each chromosome, and the size is labeled on the left of the figure. Tandem duplicated genes are outlined with red; tandem and segmental duplicated gene pairs are linked with blue and gray lines, respectively.
Figure 4. Distribution of the PtrMTP genes on P. trichocarpae chromosomes. The chromosome number is indicated on the left side of each chromosome, and the size is labeled on the left of the figure. Tandem duplicated genes are outlined with red; tandem and segmental duplicated gene pairs are linked with blue and gray lines, respectively.
Ijms 21 01680 g004
Figure 5. Distributions of the conserved domains in PtrMTP proteins. Blue boxes indicate cation_efflux domains; Green boxes indicate ZT_dimers.
Figure 5. Distributions of the conserved domains in PtrMTP proteins. Blue boxes indicate cation_efflux domains; Green boxes indicate ZT_dimers.
Ijms 21 01680 g005
Figure 6. Heatmap analysis of the abundance of PtrMTP transcripts in different poplar tissues at different developmental stages. Normalized gene expression (FPKM+1) is expressed in log2 ratio.
Figure 6. Heatmap analysis of the abundance of PtrMTP transcripts in different poplar tissues at different developmental stages. Normalized gene expression (FPKM+1) is expressed in log2 ratio.
Ijms 21 01680 g006
Figure 7. Relative expression levels of PtrMTP genes under various metal ion stresses in roots, stems or leaves. Data represent means ± SD of three biological replicates. CK represent control samples. Different letters (a, b and c) indicate significant differences among roots, stems and leaves under normal condition (n = 9, p < 0.05, Student’s t-test). Asterisks indicate significant differences between the treatment samples and the corresponding control samples in roots, stems or leaves. (n = 9, p < 0.05, Student’s t-test). (av) stands for the PtrMTP1.1-PtrMTP12, respectively.
Figure 7. Relative expression levels of PtrMTP genes under various metal ion stresses in roots, stems or leaves. Data represent means ± SD of three biological replicates. CK represent control samples. Different letters (a, b and c) indicate significant differences among roots, stems and leaves under normal condition (n = 9, p < 0.05, Student’s t-test). Asterisks indicate significant differences between the treatment samples and the corresponding control samples in roots, stems or leaves. (n = 9, p < 0.05, Student’s t-test). (av) stands for the PtrMTP1.1-PtrMTP12, respectively.
Ijms 21 01680 g007
Figure 8. Complementation of yeast mutants on solid medium containing heavy metals. S. cerevisiae wild-type strain BY4741 was transformed with the empty vector pYES2, and mutants strains were transformed with the empty vector pYES2 or with the vectors carrying the PtrMTP gene, respectively. Yeast cultures were adjusted to OD600 = 0.2, and 2 μL of serial dilutions (10-fold, from left to right in each panel) were spotted on SD-Ura/Gal medium supplemented with 60 μM CdCl2 (a), 1 mM CoCl2 (b), 10 mM FeSO4 (c), 10 mM MnSO4 (d), or 20 mM ZnSO4 (e) or on the SD-Ura/Glu medium (control) without supplementation. The plates were incubated for 2–4 days at 30 °C. The images are representative for three independent experiments.
Figure 8. Complementation of yeast mutants on solid medium containing heavy metals. S. cerevisiae wild-type strain BY4741 was transformed with the empty vector pYES2, and mutants strains were transformed with the empty vector pYES2 or with the vectors carrying the PtrMTP gene, respectively. Yeast cultures were adjusted to OD600 = 0.2, and 2 μL of serial dilutions (10-fold, from left to right in each panel) were spotted on SD-Ura/Gal medium supplemented with 60 μM CdCl2 (a), 1 mM CoCl2 (b), 10 mM FeSO4 (c), 10 mM MnSO4 (d), or 20 mM ZnSO4 (e) or on the SD-Ura/Glu medium (control) without supplementation. The plates were incubated for 2–4 days at 30 °C. The images are representative for three independent experiments.
Ijms 21 01680 g008
Table 1. Detail information of 22 PtrMTP genes identified in current study.
Table 1. Detail information of 22 PtrMTP genes identified in current study.
Gene Name.Gene IDChromosome LocationStrandCDS (bp)Protein Size(aa)MW (KDa)PIGRAVYSub-Cellular LocalizationTMD Number
PtrMTP1.1Potri.014G106200Chr14:8357551..8361095 +118239343.475.810.074Vacuole6/In-In
PtrMTP1.2Potri.002G180100Chr02:13987567..13990838 +118239343.555.90.07Vacuole6/In-In
PtrMTP3.1Potri.011G150600Chr11:16906810..16909370 124241345.246.020.064Vacuole6/In-In
PtrMTP3.2Potri.001G450900Chr01:48519109..48521426 +134744848.945.85−0.174Vacuole6/In-In
PtrMTP4Potri.001G245800Chr01:25633268..25635016 +112237341.435.470.329Vacuole6/Out-Out
PtrMTP5Potri.016G045200Chr16:2844025..2847434 116138643.2460.173Vacuole6/In-In
PtrMTP6Potri.T034500scaffold_36:109770..116219 +154251355.866.58−0.012Vacuole0
PtrMTP7Potri.010G251300Chr10:22330375..22335229 138045950.517.24−0.017Vacuole4/In-In
PtrMTP8.1Potri.003G215600Chr03:21264228..21267534 +120640145.085.240.038Vacuole5/In-Out
PtrMTP8.2Potri.001G010200Chr01:654690..657190 121240345.316.04−0.033Vacuole5/In-Out
PtrMTP8.3Potri.001G010300Chr01:657997..661070 121240345.625.2−0.034Vacuole4/Out-Out
PtrMTP8.4Potri.001G010100Chr01:651043..652778 98432736.955.510.205Vacuole5/In-Out
PtrMTP8.5Potri.001G010000Chr01:647003..649031 98432737.115.780.149Vacuole5/In-Out
PtrMTP8.6Potri.001G009900Chr01:643504..644577 49816518.385.480.048Vacuole0
PtrMTP9Potri.008G083600Chr08:5257637..5260169 121540446.526.68−0.165Cell membrane/Vacuole5/In-Out
PtrMTP10.1Potri.010G172800Chr10:17367355..17374280 +121240346.526.77−0.235Vacuole 6/In-In
PtrMTP10.2Potri.010G172900Chr10:17376155..17384476 +130543450.176.8−0.198Cell membrane/Vacuole4/Out-Out
PtrMTP10.3Potri.010G172700Chr10:17359356..17361845+131743849.896.24−0.064Cell membrane/Vacuole5/In-Out
PtrMTP10.4Potri.010G172600Chr10:17355982..17358522+122440746.736.88−0.076Cell membrane/Vacuole5/In-Out
PtrMTP11.1Potri.010G211300Chr10:19986602..19990567+118539444.875.05−0.053Vacuole4/Out-Out
PtrMTP11.2Potri.008G049600Chr08:2924867..2928439118539444.744.88−0.055Vacuole3/Out-In
PtrMTP12Potri.005G110300Chr05:8489679..8492954261086997.56.95−0.026Vacuole12/In-In
Table 2. Ka/Ks analysis and duplicated date calculation for PtrMTP genes.
Table 2. Ka/Ks analysis and duplicated date calculation for PtrMTP genes.
DuplicatedpairDuplicate TypeKaKsKa/KsPositive Selection
PtrMTP1.1/PtrMTP1.2Segmental0.07520.20060.374875No
PtrMTP3.1/PtrMTP3.2Segmental0.05910.32080.184227No
PtrMTP8.1/PtrMTP8.6Segmental0.06830.26240.26029No
PtrMTP9/PtrMTP10.4Segmental0.06270.20970.298999No
PtrMTP11.1/PtrMTP11.2Segmental0.03880.28490.136188No
PtrMTP8.2/PtrMTP8.3Tandem0.16521.11240.148508No
PtrMTP8.2/PtrMTP8.4Tandem0.00270.00440.613636No
PtrMTP8.4/PtrMTP8.5Tandem0.0160.03130.511182No
PtrMTP10.1/PtrMTP10.2Tandem0.01520.02570.59144No
PtrMTP10.3/PtrMTP10.4Tandem0.14090.70690.199321No
Notes: Ka/Ks < 1 means negative selection, Ka/Ks = 1 means neutral selection, and Ka/Ks > 1 means positive selection.
Table 3. Summary of the cis-acting regulatory elements identified in the promoter regions of PtrMTP genes.
Table 3. Summary of the cis-acting regulatory elements identified in the promoter regions of PtrMTP genes.
Gene NameGene TranscriptionAbiotic StressBiotic StressTissue ExpressionSecondary MetabolismPhytohormonal ResponsiveLight ResponseCircadian ControlSite-Binding
PtrMTP1.14300020200
PtrMTP1.26340100501
PtrMTP3.13330001301
PtrMTP3.27341111703
PtrMTP441301051201
PtrMTP53010004201
PtrMTP65810113501
PtrMTP73440002400
PtrMTP8.157100061204
PtrMTP8.22030002501
PtrMTP8.332300071303
PtrMTP8.42020003712
PtrMTP8.53920002920
PtrMTP8.62030003622
PtrMTP92010101500
PtrMTP10.133201071504
PtrMTP10.233200071402
PtrMTP10.32710105401
PtrMTP10.44510101600
PtrMTP11.1255000111205
PtrMTP11.260100031103
PtrMTP1211150016900
Table 4. The potential miRNA target sites in PtrMTP genes.
Table 4. The potential miRNA target sites in PtrMTP genes.
miRNA Acc.Target Acc.ExpectationUPEmiRNA LengthTarget Start-EndmiRNA Aligned FragmentTarget Aligned FragmentInhibition
ptc-miR473bPtrMTP1.12.515.47120932–951GCUCUCCCUCAGGGCUUCCAUUGAAGUCCUGAUGGAGAGCCleavage
ptc-miR2111aPtrMTP11.2316.04621550–571UAAUCUGC-AUCCUGAGGUUUGGCAACUUUAGGAUUGCAGAUUACleavage
ptc-miR2111aPtrMTP11.1313.91921550–571UAAUCUGC-AUCCUGAGGUUUGGCAACUUUAGGAUUGCAGAUUACleavage
ptc-miR2111bPtrMTP11.2316.04621550–571UAAUCUGC-AUCCUGAGGUUUGGCAACUUUAGGAUUGCAGAUUACleavage
ptc-miR2111bPtrMTP11.1313.91921550–571UAAUCUGC-AUCCUGAGGUUUGGCAACUUUAGGAUUGCAGAUUACleavage
ptc-miR6426aPtrMTP8.1319.0121162–182GUGGAGACAUGGAAGUGAAGAUUUUCACUUUAAUGUCUCUAATranslation
ptc-miR6426bPtrMTP8.1319.0121162–182GUGGAGACAUGGAAGUGAAGAUUUUCACUUUAAUGUCUCUAATranslation
ptc-miR6427-3pPtrMTP12315.60221900–920GUGGGAAUGAACAUUAUGAGAAAUUAUACUGUUUAUUCCUGCCleavage
ptc-miR172b-5pPtrMTP123.516.256211705–1725GGAGCAUCAUCAAGAUUCACAGGUGGCUCUGGAUCAUGCUCCCleavage
ptc-miR172g-5pPtrMTP123.516.256211705–1725GGAGCAUCAUCAAGAUUCACAGGUGGCUCUGGAUCAUGCUCCCleavage
ptc-miR473bPtrMTP3.13.518.7620989–1008GCUCUCCCUCAGGGCUUCCAUGGAGGUUCUCAUGGAGAGCTranslation
ptc-miR480PtrMTP73.513.362241122–1145ACUACUACAUCAUUGACGUUGAACAAUAGAUUUCAAUGGAGUAGUGGUTranslation
ptc-miR6464PtrMTP73.514.68421344–364UGAUUGCUUGUUGGAUAUUAUAACAUAGUCAACGAGCAGUCACleavage
ptc-miR6466-3pPtrMTP10.33.519.17211009–1029UAUCAAUCAUCAAAUGUUCGUGAGAACGUUUGGUCGUUGAUCCleavage
Table 5. Overview of PtrMTP genes in response to different heavy metal stresses.
Table 5. Overview of PtrMTP genes in response to different heavy metal stresses.
Gene NameIn RootsIn StemsIn Leaves
CdCoCuFeMnNiZnCdCoCuFeMnNiZnCdCoCuFeMnNiZn
PtrMTP1.1NoNoNoNoNo-No-NoNoNoNo-NoNoNo++NoNo+
PtrMTP1.2NoNoNoNo-NoNoNoNoNoNoNoNoNoNoNo+NoNoNoNo
PtrMTP3.1NoNoNoNoNoNoNoNoNoNoNo+NoNoNoNoNoNoNoNoNo
PtrMTP3.2NoNoNoNoNoNoNoNoNo-NoNoNoNoNoNoNoNoNoNoNo
PtrMTP4No+NoNoNoNoNoNoNoNoNoNoNoNoNo++NoNoNoNo
PtrMTP5++NoNoNoNoNo-NoNoNo+NoNo+No++++No+
PtrMTP6NoNoNoNo-NoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNo
PtrMTP7++NoNoNoNoNoNoNoNoNoNo-No++++NoNo+
PtrMTP8.1+No++NoNoNo+--No-++-NoNoNo++NoNo+
PtrMTP8.2NoNo+NoNoNoNoNoNoNoNo+NoNoNoNo+++NoNo+
PtrMTP8.3No+NoNo-NoNoNo+++No+++No+NoNo+++NoNo+
PtrMTP8.4NoNo+NoNoNo+NoNoNoNo++NoNoNoNo+++NoNo++
PtrMTP8.5NoNo+NoNoNoNoNoNoNoNo++NoNoNoNo+++NoNo+
PtrMTP8.6++NoNo+NoNo+++NoNoNoNoNoNoNoNoNoNoNoNo
PtrMTP9NoNo--No---NoNo-No-+NoNoNo-NoNo+++NoNoNo
PtrMTP10.1++NoNoNo-+-NoNoNoNo-No++++++++No++
PtrMTP10.2No++NoNoNo+NoNoNoNo+NoNoNoNo++++No+
PtrMTP10.3NoNo+++NoNo--+++No---+-+--++No+++++++No+++
PtrMTP10.4NoNoNoNo-NoNoNoNo+-+++No++++++++++++
PtrMTP11.1+++NoNoNoNoNoNoNoNoNo+-No+No++++NoNo+
PtrMTP11.2NoNo+NoNoNoNoNoNoNoNo++No+No++NoNoNo+
PtrMTP12No+NoNo----NoNo--No-NoNoNoNoNoNoNoNoNoNoNo
Notes: “+” and “-” indicate 2 < change fold < 4; “+ +” and “- -” indicate 4 < change fold < 8; “+ + +” and “- - -” indicate 8 < change fold < 16; “- - - -” indicates 16 < change fold. “No” indicates that the transcript underwent no change (change fold<2).

Share and Cite

MDPI and ACS Style

Gao, Y.; Yang, F.; Liu, J.; Xie, W.; Zhang, L.; Chen, Z.; Peng, Z.; Ou, Y.; Yao, Y. Genome-Wide Identification of Metal Tolerance Protein Genes in Populus trichocarpa and Their Roles in Response to Various Heavy Metal Stresses. Int. J. Mol. Sci. 2020, 21, 1680. https://doi.org/10.3390/ijms21051680

AMA Style

Gao Y, Yang F, Liu J, Xie W, Zhang L, Chen Z, Peng Z, Ou Y, Yao Y. Genome-Wide Identification of Metal Tolerance Protein Genes in Populus trichocarpa and Their Roles in Response to Various Heavy Metal Stresses. International Journal of Molecular Sciences. 2020; 21(5):1680. https://doi.org/10.3390/ijms21051680

Chicago/Turabian Style

Gao, Yongfeng, Fengming Yang, Jikai Liu, Wang Xie, Lin Zhang, Zihao Chen, Zhuoxi Peng, Yongbin Ou, and Yinan Yao. 2020. "Genome-Wide Identification of Metal Tolerance Protein Genes in Populus trichocarpa and Their Roles in Response to Various Heavy Metal Stresses" International Journal of Molecular Sciences 21, no. 5: 1680. https://doi.org/10.3390/ijms21051680

APA Style

Gao, Y., Yang, F., Liu, J., Xie, W., Zhang, L., Chen, Z., Peng, Z., Ou, Y., & Yao, Y. (2020). Genome-Wide Identification of Metal Tolerance Protein Genes in Populus trichocarpa and Their Roles in Response to Various Heavy Metal Stresses. International Journal of Molecular Sciences, 21(5), 1680. https://doi.org/10.3390/ijms21051680

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop