BDNF Expression in Cortical GABAergic Interneurons
Abstract
:1. Introduction
2. Results
2.1. Identification of Cortical Excitatory Principal Cells and GABAergic Interneurons in Transgenic Mice
2.2. Cellular Localization of Mature and Precursor BDNF Proteins in the Mouse Hippocampus
2.2.1. Cytoplasmic Immunoreactivity of the Mature BDNF Protein in Both Principal Cells and Interneurons
2.2.2. Perinuclear Expression of the Precursor BDNF Protein Form in Both Principal Cells and Interneurons
2.3. Expression of BDNF mRNA in Hippocampal Glutamatergic and GABAergic Neurons Revealed by LCM and RT-qPCR
2.4. Expression of BDNF mRNA in Cortical GABAergic and Glutamatergic Neuron Populations Confirmed by FACS and RT-qPCR
3. Discussion
3.1. Technical Considerations
3.2. BDNF Precursor Protein Localized not only to Glutamatergic Principal Cells, but also to GABAergic Hippocampal Interneurons
3.3. BDNF RNA is Expressed in Both Glutamatergic Neurons and GABAergic Interneurons in the Cortical Structures.
3.4. Functional Implications for BDNF Synthetized By Interneurons
4. Materials and Methods
4.1. Animals
4.2. Tissue Preparation for Microscopic Analysis
4.3. Immunofluorescence Labeling
Control Experiments
4.4. Confocal Imaging
4.5. Laser Capture Microdissection, RNA isolation and Reverse Transcription
4.6. Quantitative Real-time PCR
4.6.1. Statistical Analysis
4.7. Purification and Culture of GABAergic and Glutamatergic Neurons Obtained by Cell Sorting
5. Conclusions
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Barde, Y.A.; Edgar, D.; Thoenen, H. Purification of a new neurotrophic factor from mammalian brain. Hoppe. Seylers. Z. Physiol. Chem. 1982, 363, 1295–1296. [Google Scholar] [CrossRef]
- Cohen-Cory, S.; Kidane, A.H.; Shirkey, N.J.; Marshak, S. Brain-derived neurotrophic factor and the development of structural neuronal connectivity. Dev. Neurobiol. 2010, 70, 271–288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoshii, A.; Constantine-Paton, M. Postsynaptic BDNF-TrkB signaling in synapse maturation, plasticity, and disease. Dev. Neurobiol. 2010, 141, NA-NA. [Google Scholar] [CrossRef] [Green Version]
- Singh, B.; Henneberger, C.; Betances, D.; Arevalo, M.A.; Rodriguez-Tebar, A.; Meier, J.C.; Grantyn, R. Altered Balance of Glutamatergic/GABAergic Synaptic Input and Associated Changes in Dendrite Morphology after BDNF Expression in BDNF-Deficient Hippocampal Neurons. J. Neurosci. 2006, 26, 7189–7200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsumoto, T.; Rauskolb, S.; Polack, M.; Klose, J.; Kolbeck, R.; Korte, M.; Barde, Y.-A. Biosynthesis and processing of endogenous BDNF: CNS neurons store and secrete BDNF, not pro-BDNF. Nat. Neurosci. 2008, 11, 131–133. [Google Scholar] [CrossRef] [PubMed]
- Deinhardt, K.; Chao, M.V. Shaping neurons: Long and short range effects of mature and proBDNF signalling upon neuronal structure. Neuropharmacology 2014, 76, 603–609. [Google Scholar] [CrossRef] [Green Version]
- Baj, G.; Leone, E.; Chao, M.V.; Tongiorgi, E. Spatial segregation of BDNF transcripts enables BDNF to differentially shape distinct dendritic compartments. Proc. Natl. Acad. Sci. USA 2011, 108, 16813–16818. [Google Scholar] [CrossRef] [Green Version]
- Aid, T.; Kazantseva, A.; Piirsoo, M.; Palm, K.; Timmusk, T. Mouse and ratBDNF gene structure and expression revisited. J. Neurosci. Res. 2007, 85, 525–535. [Google Scholar] [CrossRef]
- Cattaneo, A.; Cattane, N.; Begni, V.; Pariante, C.M.; Riva, M.A. The human BDNF gene: Peripheral gene expression and protein levels as biomarkers for psychiatric disorders. Transl. Psychiatry 2016, 6, e958. [Google Scholar] [CrossRef]
- De Vincenti, A.P.; Ríos, A.S.; Paratcha, G.; Ledda, F. Mechanisms that modulate and diversify BDNF functions: Implications for hippocampal synaptic plasticity. Front. Cell. Neurosci. 2019, 13, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Orefice, L.L.; Waterhouse, E.G.; Partridge, J.G.; Lalchandani, R.R.; Vicini, S.; Xu, B. Distinct roles for somatically and dendritically synthesized brain-derived neurotrophic factor in morphogenesis of dendritic spines. J. Neurosci. 2013, 33, 11618–11632. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leal, G.; Afonso, P.M.; Salazar, I.L.; Duarte, C.B. Regulation of hippocampal synaptic plasticity by BDNF. Brain Res. 2015, 1621, 82–101. [Google Scholar] [CrossRef] [PubMed]
- Agerman, K. BDNF gene replacement reveals multiple mechanisms for establishing neurotrophin specificity during sensory nervous system development. Development 2003, 130, 1479–1491. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kowiański, P.; Lietzau, G.; Czuba, E.; Waśkow, M.; Steliga, A.; Moryś, J. BDNF: A Key Factor with Multipotent Impact on Brain Signaling and Synaptic Plasticity. Cell. Mol. Neurobiol. 2018, 38, 579–593. [Google Scholar] [CrossRef] [PubMed]
- Jones, K.R.; Fariñas, I.; Backus, C.; Reichardt, L.F. Targeted disruption of the BDNF gene perturbs brain and sensory neuron development but not motor neuron development. Cell 1994, 76, 989–999. [Google Scholar] [CrossRef] [Green Version]
- Kohara, K.; Kitamura, A.; Adachi, N.; Nishida, M.; Itami, C.; Nakamura, S.; Tsumoto, T. Inhibitory but not excitatory cortical neurons require presynaptic brain-derived neurotrophic factor for dendritic development, as revealed by chimera cell culture. J. Neurosci. 2003, 23, 6123–6131. [Google Scholar] [CrossRef]
- Canals, J.M.; Checa, N.; Marco, S.; Åkerud, P.; Michels, A.; Pérez-Navarro, E.; Tolosa, E.; Arenas, E.; Alberch, J. Expression of brain-derived neurotrophic factor in cortical neurons is regulated by striatal target area. J. Neurosci. 2001, 21, 117–124. [Google Scholar] [CrossRef] [Green Version]
- Palizvan, M.; Sohya, K.; Kohara, K.; Maruyama, A.; Yasuda, H.; Kimura, F.; Tsumoto, T. Brain-derived neurotrophic factor increases inhibitory synapses, revealed in solitary neurons cultured from rat visual cortex. Neuroscience 2004, 126, 955–966. [Google Scholar] [CrossRef]
- Kim, J.K.; Jeon, S.M.; Lee, K.M.; Park, E.S.; Cho, H.J. Expression of brain-derived neurotrophic factor in the rat forebrain and upper brain stem during postnatal development: An immunohistochemical study. Neuroscience 2007, 146, 1128–1136. [Google Scholar] [CrossRef]
- Maisonpierre, P.C.; Belluscio, L.; Friedman, B.; Alderson, R.F.; Wiegand, S.J.; Furth, M.E.; Lindsay, R.M.; Yancopoulos, G.D. NT-3, BDNF, and NGF in the developing rat nervous system: Parallel as well as reciprocal patterns of expression. Neuron 1990, 5, 501–509. [Google Scholar] [CrossRef]
- Katoh-Semba, R.; Takeuchi, I.K.; Semba, R.; Kato, K. Distribution of Brain-Derived Neurotrophic Factor in Rats and Its Changes with Development in the Brain. J. Neurochem. 2002, 69, 34–42. [Google Scholar] [CrossRef] [PubMed]
- Andreska, T.; Aufmkolk, S.; Sauer, M.; Blum, R. High abundance of BDNF within glutamatergic presynapses of cultured hippocampal neurons. Front. Cell. Neurosci. 2014, 8, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Will, T.J.; Tushev, G.; Kochen, L.; Nassim-Assir, B.; Cajigas, I.J.; Tom Dieck, S.; Schuman, E.M. Deep Sequencing and High-Resolution Imaging Reveal Compartment-Specific Localization of Bdnf mRNA in Hippocampal Neurons. Sci. Signal 2013, 6, rs16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Z.J.; Kirkwood, A.; Pizzorusso, T.; Porciatti, V.; Morales, B.; Bear, M.F.; Maffei, L.; Tonegawa, S. BDNF Regulates the Maturation of Inhibition and the Critical Period of Plasticity in Mouse Visual Cortex. Cell 1999, 98, 739–755. [Google Scholar] [CrossRef] [Green Version]
- Fujieda, H.; Sasaki, H. Expression of brain-derived neurotrophic factor in cholinergic and dopaminergic amacrine cells in the rat retina and the effects of constant light rearing. Exp. Eye Res. 2008, 86, 335–343. [Google Scholar] [CrossRef]
- Jungbluth, S.; Koentges, G.; Lumsden, A. Coordination of early neural tube development by BDNF/trkB. Development 1997, 124, 1877–1885. [Google Scholar]
- Wang, Y.; Kakizaki, T.; Sakagami, H.; Saito, K.; Ebihara, S.; Kato, M.; Hirabayashi, M.; Saito, Y.; Furuya, N.; Yanagawa, Y. Fluorescent labeling of both GABAergic and glycinergic neurons in vesicular GABA transporter (VGAT)–Venus transgenic mouse. Neuroscience 2009, 164, 1031–1043. [Google Scholar] [CrossRef]
- Madisen, L.; Zwingman, T.A.; Sunkin, S.M.; Oh, S.W.; Zariwala, H.A.; Gu, H.; Ng, L.L.; Palmiter, R.D.; Hawrylycz, M.J.; Jones, A.R.; et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat. Neurosci. 2010, 13, 133–140. [Google Scholar] [CrossRef] [Green Version]
- Cox, B.C.; Liu, Z.; Lagarde, M.M.M.; Zuo, J. Conditional gene expression in the mouse inner ear using Cre-loxP. J. Assoc. Res. Otolaryngol. 2012, 13, 295–322. [Google Scholar] [CrossRef] [Green Version]
- Itami, C.; Mizuno, K.; Kohno, T.; Nakamura, S. Brain-derived neurotrophic factor requirement for activity-dependent maturation of glutamatergic synapse in developing mouse somatosensory cortex. Brain Res. 2000, 857, 141–150. [Google Scholar] [CrossRef]
- Baj, G.; Pinhero, V.; Vaghi, V.; Tongiorgi, E. Signaling pathways controlling activity-dependent local translation of BDNF and their localization in dendritic arbors. J. Cell Sci. 2016, 129, 2852–2864. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, H.; Popescu, A.; Poo, M. Essential Role of Presynaptic NMDA Receptors in Activity-Dependent BDNF Secretion and Corticostriatal LTP. Neuron 2014, 84, 1009–1022. [Google Scholar] [CrossRef] [Green Version]
- Altar, C.A.; Cai, N.; Bliven, T.; Juhasz, M.; Conner, J.M.; Acheson, A.L.; Lindsay, R.M.; Wiegand, S.J. Anterograde transport of brain-derived neurotrophic factor and its role in the brain. Nature 1997, 389, 856–860. [Google Scholar] [CrossRef]
- Boone, D.R.; Sell, S.L.; Hellmich, H.L.e. Laser capture microdissection of enriched populations of neurons or single neurons for gene expression analysis after traumatic brain injury. J. Vis. Exp. 2013, 1–7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gorski, J.A.; Talley, T.; Qiu, M.; Puelles, L.; Rubenstein, J.L.R.; Jones, K.R. Cortical excitatory neurons and glia, but not GABAergic neurons, are produced in the Emx1-expressing lineage. J. Neurosci. 2002, 22, 6309–6314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chan, C.-H. Emx1 is a Marker for Pyramidal Neurons of the Cerebral Cortex. Cereb. Cortex 2001, 11, 1191–1198. [Google Scholar] [CrossRef] [Green Version]
- Gutiérrez, R.; Romo-Parra, H.; Maqueda, J.; Vivar, C.; Ramírez, M.; Morales, M.A.; Lamas, M. Plasticity of the GABAergic phenotype of the “glutamatergic” granule cells of the rat dentate gyrus. J. Neurosci. 2003, 23, 5594–5598. [Google Scholar] [CrossRef]
- Sloviter, R.S.; Dichter, M.A.; Rachinsky, T.L.; Dean, E.; Goodman, J.H.; Sollas, A.L.; Martin, D.L. Basal expression and induction of glutamate decarboxylase GABA in excitatory granule cells of the rat and monkey hippocampal dentate gyrus. J. Comp. Neurol. 1996, 373, 593–618. [Google Scholar] [CrossRef]
- Sandler, R.; Smith, A.D. Coexistence of GABA and glutamate in mossy fiber terminals of the primate hippocampus: An ultrastructural study. J. Comp. Neurol. 1991, 303, 177–192. [Google Scholar] [CrossRef]
- Marty, S.; Berninger, B.; Carroll, P.; Thoenen, H. GABAergic Stimulation Regulates the Phenotype of Hippocampal Interneurons through the Regulation of Brain-Derived Neurotrophic Factor. Neuron 1996, 16, 565–570. [Google Scholar] [CrossRef] [Green Version]
- Xiong, H.; Futamura, T.; Jourdi, H.; Zhou, H.; Takei, N.; Diverse-Pierluissi, M.; Plevy, S.; Nawa, H. Neurotrophins induce BDNF expression through the glutamate receptor pathway in neocortical neurons. Neuropharmacology 2002, 42, 903–912. [Google Scholar] [CrossRef] [Green Version]
- Turko, P.; Groberman, K.; Kaiser, T.; Yanagawa, Y.; Vida, I. Primary Cell Culture of Purified GABAergic or Glutamatergic Neurons Established through Fluorescence-activated Cell Sorting. J. Vis. Exp. 2019. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hawrylak, N.; Chang, F.-L.F.; Greenough, W.T. Astrocytic and synaptic response to kindling in hippocampal subfield CA1. II. Synaptogenesis and astrocytic process increases to in vivo kindling. Brain Res. 1993, 603, 309–316. [Google Scholar] [CrossRef]
- Jones, T.A.; Greenough, W.T. Ultrastructural Evidence for Increased Contact between Astrocytes and Synapses in Rats Reared in a Complex Environment. Neurobiol. Learn. Mem. 1996, 65, 48–56. [Google Scholar] [CrossRef] [Green Version]
- Zeka, F.; Vanderheyden, K.; De Smet, E.; Cuvelier, C.A.; Mestdagh, P.; Vandesompele, J. Straightforward and sensitive RT-qPCR based gene expression analysis of FFPE samples. Sci. Rep. 2016, 6, 2–11. [Google Scholar] [CrossRef] [Green Version]
- Ponchel, F.; Toomes, C.; Bransfield, K.; Leong, F.T.; Douglas, S.H.; Field, S.L.; Bell, S.M.; Combaret, V.; Puisieux, A.; Mighell, A.J.; et al. Real-time PCR based on SYBR-Green I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions. BMC Biotechnol. 2003, 3, 18. [Google Scholar] [CrossRef] [Green Version]
- Yao, Z.; Qin, D.; Chen, D.; Liu, C.; Chen, W.; Liu, T.; Liu, B.; Gao, L. Development of ISSR-derived SCAR Marker and SYBR Green I Real-time PCR Method for Detection of Teliospores of Tilletia laevis Kühn. Sci. Rep. 2019, 9, 17651. [Google Scholar] [CrossRef]
- Morrison, T.B.; Weis, J.J.; Wittwer, C.T. Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification. Biotechniques 1998, 24, 954–958, 960, 962. [Google Scholar]
- Liu, Q.-R.; Lu, L.; Zhu, X.-G.; Gong, J.-P.; Shaham, Y.; Uhl, G.R. Rodent BDNF genes, novel promoters, novel splice variants, and regulation by cocaine. Brain Res. 2006, 1067, 1–12. [Google Scholar] [CrossRef]
- Menezes, J.R.L.; Luskin, M.B. Expression of neuron-specific tubulin defines a novel population in the proliferative layers of the developing telencephalon. J. Neurosci. 1994, 14, 5399–5416. [Google Scholar] [CrossRef]
- Du, X.; Serena, K.; Hwang, W.J.; Grech, A.M.; Wu, Y.W.C.; Schroeder, A.; Hill, R.A. Prefrontal cortical parvalbumin and somatostatin expression and cell density increase during adolescence and are modified by BDNF and sex. Mol. Cell. Neurosci. 2018, 88, 177–188. [Google Scholar] [CrossRef] [PubMed]
- Park, H.; Poo, M. Neurotrophin regulation of neural circuit development and function. Nat. Rev. Neurosci. 2013, 14, 7–23. [Google Scholar] [CrossRef] [PubMed]
- Lessmann, V.; Gottmann, K.; Malcangio, M. Neurotrophin secretion: Current facts and future prospects. Prog. Neurobiol. 2003, 69, 341–374. [Google Scholar] [CrossRef]
- Lee, R.; Kermani, P.; Teng, K.K.; Hempstead, B.L. Regulation of cell survival by secreted proneurotrophins. Science 2001, 294, 1945–1948. [Google Scholar] [CrossRef] [Green Version]
- Cunha, C.; Brambilla, R.; Thomas, K.L. A simple role for BDNF in learning and memory? Front. Mol. Neurosci. 2010, 3, 1. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Siao, C.-J.; Nagappan, G.; Marinic, T.; Jing, D.; McGrath, K.; Chen, Z.-Y.; Mark, W.; Tessarollo, L.; Lee, F.S.; et al. Neuronal release of proBDNF. Nat. Neurosci. 2009, 12, 113–115. [Google Scholar] [CrossRef]
- Holm, M.M.; Nieto-Gonzalez, J.L.; Vardya, I.; Vaegter, C.B.; Nykjaer, A.; Jensen, K. Mature BDNF, But Not proBDNF, Reduces Excitability of Fast-Spiking Interneurons in Mouse Dentate Gyrus. J. Neurosci. 2009, 29, 12412–12418. [Google Scholar] [CrossRef] [Green Version]
- Dougherty, K.D.; Milner, T.A. Cholinergic septal afferent terminals preferentially contact neuropeptide Y-containing interneurons compared to parvalbumin-containing interneurons in the rat dentate gyrus. J. Neurosci. 1999, 19, 10140–10152. [Google Scholar] [CrossRef] [Green Version]
- Baho, E.; Chattopadhyaya, B.; Lavertu-Jolin, M.; Mazziotti, R.; Awad, P.N.; Chehrazi, P.; Groleau, M.; Jahannault-Talignani, C.; Vaucher, E.; Ango, F.; et al. p75 neurotrophin receptor activation regulates the timing of the maturation of cortical parvalbumin interneuron connectivity and promotes Juvenile-like plasticity in adult visual cortex. J. Neurosci. 2019, 39, 4489–4510. [Google Scholar] [CrossRef] [Green Version]
- Ernfors, P.; Wetmore, C.; Olson, L.; Persson, H. Identification of cells in rat brain and peripheral tissues expressing mRNA for members of the nerve growth factor family. Neuron 1990, 5, 511–526. [Google Scholar] [CrossRef]
- Booker, S.A.; Vida, I. Morphological diversity and connectivity of hippocampal interneurons. Cell Tissue Res. 2018, 373, 619–641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Freund, T.F.; Buzsáki, G. Interneurons of the hippocampus. Hippocampus 1998, 6, 347–470. [Google Scholar] [CrossRef]
- Zhao, X.; Chen, X.Q.; Han, E.; Hu, Y.; Paik, P.; Ding, Z.; Overman, J.; Lau, A.L.; Shahmoradian, S.H.; Chiu, W.; et al. TRiC subunits enhance BDNF axonal transport and rescue striatal atrophy in Huntington’s disease. Proc. Natl. Acad. Sci. USA 2016, 113, E5655–E5664. [Google Scholar] [CrossRef] [Green Version]
- Caleo, M.; Cenni, M.C. Anterograde Transport of Neurotrophic Factors: Possible Therapeutic Implications. Mol. Neurobiol. 2004, 29, 179–196. [Google Scholar] [CrossRef]
- Dieni, S.; Matsumoto, T.; Dekkers, M.; Rauskolb, S.; Ionescu, M.S.; Deogracias, R.; Gundelfinger, E.D.; Kojima, M.; Nestel, S.; Frotscher, M.; et al. BDNF and its pro-peptide are stored in presynaptic dense core vesicles in brain neurons. J. Cell Biol. 2012, 196, 775–788. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hashimoto, K. Brain-derived neurotrophic factor as a biomarker for mood disorders: An historical overview and future directions. Psychiatry Clin. Neurosci. 2010, 64, 341–357. [Google Scholar] [CrossRef]
- Hashimoto, K. Sigma-1 receptor chaperone and brain-derived neurotrophic factor: Emerging links between cardiovascular disease and depression. Prog. Neurobiol. 2013, 100, 15–29. [Google Scholar] [CrossRef]
- Lu, B.; Pang, P.T.; Woo, N.H. The yin and yang of neurotrophin action. Nat. Rev. Neurosci. 2005, 6, 603–614. [Google Scholar] [CrossRef] [Green Version]
- Gibon, J.; Buckley, S.M.; Unsain, N.; Kaartinen, V.; Séguéla, P.; Barker, P.A. proBDNF and p75NTR control excitability and persistent firing of cortical pyramidal neurons. J. Neurosci. 2015, 35, 9741–9753. [Google Scholar] [CrossRef] [Green Version]
- Goebbels, S.; Bormuth, I.; Bode, U.; Hermanson, O.; Schwab, M.H.; Nave, K.-A. Genetic targeting of principal neurons in neocortex and hippocampus of NEX-Cre mice. Genesis 2006, 44, 611–621. [Google Scholar] [CrossRef]
- Henneberger, C.; Jüttner, R.; Rothe, T.; Grantyn, R. Postsynaptic action of BDNF on GABAergic synaptic transmission in the superficial layers of the mouse superior colliculus. J. Neurophysiol. 2002, 88, 595–603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elmariah, S.B.; Hughes, E.G.; Oh, E.J.; Balice-Gordon, R.J. Neurotrophin signaling among neurons and glia during formation of tripartite synapses. Neuron Glia Biol. 2004, 1, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Langlois, A.; Diabira, D.; Ferrand, N.; Porcher, C.; Gaiarsa, J.L. NMDA-dependent switch of proBDNF actions on developing GABAergic synapses. Cereb. Cortex 2013, 23, 1085–1096. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Woo, N.H.; Lu, B. Regulation of Cortical Interneurons by Neurotrophins: From Development to Cognitive Disorders. Neurosci. 2006, 12, 43–56. [Google Scholar] [CrossRef]
- Münster-Wandowski, A.; Heilmann, H.; Bolduan, F.; Trimbuch, T.; Yanagawa, Y.; Vida, I. Distinct localization of SNAP47 protein in GABAergic and glutamatergic neurons in the mouse and the rat hippocampus. Front. Neuroanat. 2017, 11, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Nagai, T.; Ibata, K.; Park, E.S.; Kubota, M.; Mikoshiba, K.; Miyawaki, A. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat. Biotechnol. 2002, 20, 87–90. [Google Scholar] [CrossRef]
- Ridler, T.W.; Calvard, S. Picture Thresholding Using an Iterative Selection Method. IEEE Trans. Syst. Man Cybern. 1978, smc-8, 630–632. [Google Scholar]
- Amaral, D.G.; Witter, M.P. The three-dimensional organization of the hippocampal formation: A review of anatomical data. Neuroscience 1989, 31, 571–591. [Google Scholar] [CrossRef]
- Burbach, G.J.; Dehn, D.; Del Turco, D.; Deller, T. Quantification of layer-specific gene expression in the hippocampus: Effective use of laser microdissection in combination with quantitative RT-PCR. J. Neurosci. Methods 2003, 131, 83–91. [Google Scholar] [CrossRef]
- Phillips, H.S.; Hains, J.M.; Armanini, M.; Laramee, G.R.; Johnson, S.A.; Winslow, J.W. BDNF mRNA is decreased in the hippocampus of individuals with Alzheimer’s disease. Neuron 1991, 7, 695–702. [Google Scholar] [CrossRef]
- Holsinger, R.M.D.; Schnarr, J.; Henry, P.; Castelo, V.T.; Fahnestock, M. Quantitation of BDNF mRNA in human parietal cortex by competitive reverse transcription-polymerase chain reaction: Decreased levels in Alzheimer’s disease. Mol. Brain Res. 2000, 76, 347–354. [Google Scholar] [CrossRef]
- Michalski, B.; Fahnestock, M. Pro-brain-derived neurotrophic factor is decreased in parietal cortex in Alzheimer’s disease. Mol. Brain Res. 2003, 111, 148–154. [Google Scholar] [CrossRef]
- Peng, S.; Wuu, J.; Mufson, E.J.; Fahnestock, M. Precursor form of brain-derived neurotrophic factor and mature brain-derived neurotrophic factor are decreased in the pre-clinical stages of Alzheimer’s disease. J. Neurochem. 2005, 93, 1412–1421. [Google Scholar] [CrossRef] [PubMed]
- Garcia, K.L.P.; Yu, G.; Nicolini, C.; Michalski, B. Altered balance of proteolytic isoforms of pro-BDNF in Autism. J. Neuropathol. Exp. Neurol. 2012, 71, 289–297. [Google Scholar] [CrossRef] [Green Version]
- Zuccato, C.; Cattaneo, E. Brain-derived neurotrophic factor in neurodegenerative diseases. Nat. Rev. Neurol. 2009, 5, 311–322. [Google Scholar] [CrossRef]
Region | mBDNF + GM130 (%) | proBDNF + lamin (%) |
---|---|---|
DG (hilus) | 11.0 | 48.1 |
CA3 (radiatum) | 17.7 | 68.5 |
CA3 (oriens) | 23.7 | 49.5 |
CA1 (radiatum) | 40.7 | 43,.6 |
CA1 (oriens) | 40.1 | 72.9 |
Average | 26.6 ± 6.0 * | 56.5 ± 5.9 * |
Animals | YFP+ Neuron Number | proBDNF and YFP+ Neuron Number | Percentage of YFP Neurons Containing proBDNF (%) |
---|---|---|---|
Animal I | 142 * | 137 * | 96.5 |
Animal II | 179 * | 150 * | 83.0 |
Total | 321 * | 287 * | 89.4 |
CA1 + CA3, Pyramidal Cell Layer | DG, Granule Cell Layer | CA1 + CA3, Stratum Oriens and Radiatum | CA1 + CA3 Neuropil | |
---|---|---|---|---|
Mean ΔCp | Glutamatergic Neurons | Glutamatergic Neurons | GABAergic INs | Cell Body-Free |
Exon-IX BDNF | 0.690 ± 0.393 * | 0.585 ± 0.049 * | 0.120 ± 0.073 * | n.d. |
Emx1 | 1.890 ± 0.946 * | 0.027 ± 0.004 * | 0.000 ± 0.008 * | n.d. |
GAD67 | 0.080 ± 0.060 * | 1.376 ± 0.169 * | 3.350 ± 0.935 * | n.d. |
P0, 7–9 DIV Cultures | P14-P22 FACS | |||
---|---|---|---|---|
Mean ΔCp | Glutamatergic Neurons | GABAergic Neurons | Glutamatergic Neurons | GABAergic Neurons |
Exon IX BDNF | 0.047 ± 0.013 * | 0.009 ± 0.004 * | 0.066 ± 0.024 * | 0.020 ± 0.010 * |
Emx1 | 0.007 ± 0.005 * | 0 * | 0.003 ± 0.000 * | 0 * |
GAD67 | 0.008 ± 0.005 * | 1.239 ± 0.405 * | 0.028 ± 0.000 * | 0.136 ± 0.034 * |
Antibody | Supplier and Cat. No. | Host | Dilution | Immunogen |
---|---|---|---|---|
BDNF Protein Forms | ||||
proBDNF | Merck MABN110 | Mouse | 1:1000 | Precursor BDNF ~34 kDa GST-tagged recombinant protein corresponding to human pro-BDNF |
mBDNF | Bioss bs-4989R | Rabbit | 1:200 | mature BDNF ~13 kDa keyhole limpet hemocyanin (KLH)-conjugated synthetic peptide derived from human BDNF |
GABAergic marker protein | ||||
GAD65/67 | Merck ABN904 | Rabbit | 1:200 | KLH-conjugated linear peptide corresponding to 14 amino acids from the C-terminal region of human glutamate decarboxylase 2 (GAD2) |
Glutamatergic somatic marker protein | ||||
Emx1 | Abcam Ab224343 | Rabbit | 1:1000 | Recombinant fragment corresponding to human Emx1 amino acids 76–162 |
Astrocytic marker | ||||
GFAP | SySy 173011 | Mouse | 1:1000 | Recombinant protein corresponding to amino acids 1–432 from human GFAP |
Perinuclear marker | ||||
Lamin-B1 | Abcam ab16048 | Rabbit | 1:500 | Synthetic peptide corresponding to mouse lamin-B1 amino acids 400–500 (internal sequence) conjugated to KLH |
Golgi marker | ||||
GM130 | BD Bioscences 610823 | Mouse | 1:100 | Rat GM130 amino acids 869–982 |
Gene | Primer Sequence | Efficiency | |
---|---|---|---|
Forward Primer (5’–3’) | Reverse Primer (5’–3’) | ||
Class III β-tubulin | gcgcatcagcgtatactacaa | catggttccaggttccaagt | 1.93 |
BDNF exon IX | gcctttggagcctcctctac | gcggcatccaggtaatttt | 1.95 |
GAD67 | tgcggacatatgtgagaaataca | ttccgggacatgagcagt | 1.898 |
Emx1 | ctctccgagacgcaggtg | ctcagactccggcccttc | 2.005 |
GFAP | tcgagatcgccacctacag | gtctgtacaggaatggtgatgc | 2.001 |
Real-time PCR conditions | |||
Initial denaturation | 95 °C—10’ | ||
Cycling (x55) | 95 °C—10’’ 60 °C—30’’ 72 °C—15’’ |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tomás, F.J.B.; Turko, P.; Heilmann, H.; Trimbuch, T.; Yanagawa, Y.; Vida, I.; Münster-Wandowski, A. BDNF Expression in Cortical GABAergic Interneurons. Int. J. Mol. Sci. 2020, 21, 1567. https://doi.org/10.3390/ijms21051567
Tomás FJB, Turko P, Heilmann H, Trimbuch T, Yanagawa Y, Vida I, Münster-Wandowski A. BDNF Expression in Cortical GABAergic Interneurons. International Journal of Molecular Sciences. 2020; 21(5):1567. https://doi.org/10.3390/ijms21051567
Chicago/Turabian StyleTomás, Federico José Barreda, Paul Turko, Heike Heilmann, Thorsten Trimbuch, Yuchio Yanagawa, Imre Vida, and Agnieszka Münster-Wandowski. 2020. "BDNF Expression in Cortical GABAergic Interneurons" International Journal of Molecular Sciences 21, no. 5: 1567. https://doi.org/10.3390/ijms21051567