Verticillium dahliae VdTHI20, Involved in Pyrimidine Biosynthesis, Is Required for DNA Repair Functions and Pathogenicity
Abstract
:1. Introduction
2. Results
2.1. Deletion and Complementation of VdTHI20 in V. dahliae
2.2. Radial Mycelial Growth in ∆VdTHI20 Mutants Was Significantly Reduced
2.3. Exogenous Thiamine Recovered the Hyphal Growth of ΔVdTHI20 Mutants
2.4. Knockout of VdTHI20 Reduced Conidial Germination and Production and Caused Abnormal V. dahliae Hyphal Morphology
2.5. Loss of VdTHI20 Resulted in Reduced Tolerance to UV Damage
2.6. VdTHI20 Is Crucial for the Pathogenicity of V. dahliae towards Plants
2.7. Fungal Colonization and Root Infection with the ΔVdTHI20 Mutant Were Impaired
2.8. DsRNA of VdTHI20 Confers Resistance Against V. dahliae in Transgenic N. benthamiana Lines
3. Discussion
4. Materials and Methods
4.1. Fungal Strains, Plant Material and Culture Conditions
4.2. Plasmid Construction and Fungal Transformation
4.3. Confirmation of VdTHI20 Gene Disruption or the Complementation of ΔVdTHI20 and Screening for GFP-tagged Strains
4.4. Growth, Conidia Production, and Germination Assays
4.5. Phenotypic Analysis under Stress Conditions
4.6. Quantitative Real-Time PCR (qRT-PCR)
4.7. Hyphal Growth under Different Concentrations of Exogenous Thiamine
4.8. Microscopic Observation of Initial Infection
4.9. Plasmid Construction and Plant Transformation
Author Contributions
Funding
Conflicts of Interest
Abbreviations
ATMT | Agrobacterium tumefaciens-mediated transformation |
GFP | green fluorescent protein |
RNAi | RNA interference |
HIGS | host induced gene scilencing |
dpi | days post-inoculation |
MM | minimal medium |
wt | wild type |
HMP | 2-methyl-4-amino-5-hydroxymethylpyrimidine |
HET | 4-methyl-5-β-hydroxyethylthiazole |
TPP | phosphorylated thiamine |
References
- Fradin, E.F.; Thomma, B.P. Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol. Plant Pathol. 2006, 7, 71–86. [Google Scholar] [CrossRef]
- Deketelaere, S.; Tyvaert, L.; Franca, S.C.; Hofte, M. Desirable Traits of a Good Biocontrol Agent against Verticillium Wilt. Front. Microbiol. 2017, 8, 1186. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.; Zhang, Z.; Lei, Y.; Hu, G.; Liu, J.; Hao, M.; Chen, A.; Peng, Q.; Wu, J. Cotton WATs Modulate SA Biosynthesis and Local Lignin Deposition Participating in Plant Resistance Against Verticillium dahliae. Front. Plant Sci. 2019, 10, 526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, Y.F.; He, X.H.; Mo, J.C.; Sun, Q.; Yang, J.P.; Liu, J.G. Molecular research and genetic engineering of resistance to Verticillium wilt in cotton: A review. Afr. J. Biotechnol. 2009, 8, 7363–7372. [Google Scholar]
- Klosterman, S.J.; Subbarao, K.V.; Kang, S.; Veronese, P.; Gold, S.E.; Thomma, B.P.; Chen, Z.; Henrissat, B.; Lee, Y.H.; Park, J.; et al. Comparative genomics yields insights into niche adaptation of plant vascular wilt pathogens. PLoS Pathog. 2011, 7, e1002137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Klimes, A.; Dobinson, K.F.; Thomma, B.P.; Klosterman, S.J. Genomics spurs rapid advances in our understanding of the biology of vascular wilt pathogens in the genus Verticillium. Annu. Rev. Phytopathol. 2015, 53, 181–198. [Google Scholar] [CrossRef]
- Iosue, C.L.; Attanasio, N.; Shaik, N.F.; Neal, E.M.; Leone, S.G.; Cali, B.J.; Peel, M.T.; Grannas, A.M.; Wykoff, D.D. Partial Decay of Thiamine Signal Transduction Pathway Alters Growth Properties of Candida glabrata. PLoS ONE 2016, 11, e0152042. [Google Scholar] [CrossRef] [Green Version]
- Kawasaki, Y.; Nosaka, K.; Kaneko, Y.; Nishimura, H.; Iwashima, A. Regulation of thiamine biosynthesis in Saccharomyces cerevisiae. J. Bacteriol. 1990, 172, 6145–6147. [Google Scholar] [CrossRef] [Green Version]
- Jurgenson, C.T.; Begley, T.P.; Ealick, S.E. The structural and biochemical foundations of thiamin biosynthesis. Annu. Rev. Biochem. 2009, 78, 569–603. [Google Scholar] [CrossRef]
- Wightman, R.; Meacock, P.A. The THI5 gene family of Saccharomyces cerevisiae: Distribution of homologues among the hemiascomycetes and functional redundancy in the aerobic biosynthesis of thiamin from pyridoxine. Microbiology 2003, 149, 1447–1460. [Google Scholar] [CrossRef] [Green Version]
- Llorente, B.; Fairhead, C.; Dujon, B. Genetic redundancy and gene fusion in the genome of the Baker’s yeast Saccharomyces cerevisiae: Functional characterization of a three-member gene family involved in the thiamine biosynthetic pathway. Mol. Microbiol. 1999, 32, 1140–1152. [Google Scholar] [CrossRef] [PubMed]
- Kawasaki, Y.; Onozuka, M.; Mizote, T.; Nosaka, K. Biosynthesis of hydroxymethylpyrimidine pyrophosphate in Saccharomyces cerevisiae. Curr. Genet. 2005, 47, 156–162. [Google Scholar] [CrossRef] [PubMed]
- French, J.B.; Begley, T.P.; Ealick, S.E. Structure of trifunctional THI20 from yeast. Acta Crystallogr. Sect. D Biol. Crystallogr. 2011, 67, 784–791. [Google Scholar] [CrossRef] [PubMed]
- Machado, C.R.; Praekelt, U.M.; de Oliveira, R.C.; Barbosa, A.C.; Byrne, K.L.; Meacock, P.A.; Menck, C.F. Dual role for the yeast THI4 gene in thiamine biosynthesis and DNA damage tolerance. J. Mol. Biol. 1997, 273, 114–121. [Google Scholar] [CrossRef]
- Nosaka, K.; Nishimura, H.; Kawasaki, Y.; Tsujihara, T.; Iwashima, A. Isolation and characterization of the THI6 gene encoding a bifunctional thiamin-phosphate pyrophosphorylase/hydroxyethylthiazole kinase from Saccharomyces cerevisiae. J. Biol. Chem. 1994, 269, 30510–30516. [Google Scholar]
- Nosaka, K.; Kaneko, Y.; Nishimura, H.; Iwashima, A. Isolation and characterization of a thiamin pyrophosphokinase gene, THI80, from Saccharomyces cerevisiae. J. Biol. Chem. 1993, 268, 17440–17447. [Google Scholar]
- Enjo, F.; Nosaka, K.; Ogata, M.; Iwashima, A.; Nishimura, H. Isolation and characterization of a thiamin transport gene, THI10, from Saccharomyces cerevisiae. J. Biol. Chem. 1997, 272, 19165–19170. [Google Scholar] [CrossRef] [Green Version]
- Nosaka, K.; Kaneko, Y.; Nishimura, H.; Iwashima, A. A possible role for acid phosphatase with thiamin-binding activity encoded by PHO3 in yeast. Fems Microbiol. Lett. 1989, 51, 55–59. [Google Scholar] [CrossRef] [Green Version]
- Hoppenau, C.E.; Tran, V.-T.; Kusch, H.; Aßhauer, K.P.; Landesfeind, M.; Meinicke, P.; Popova, B.; Braus-Stromeyer, S.A.; Braus, G.H. Verticillium dahliae VdTHI4, involved in thiazole biosynthesis, stress response and DNA repair functions, is required for vascular disease induction in tomato. Environ. Exp. Bot. 2014, 108, 14–22. [Google Scholar] [CrossRef]
- Qi, X.; Su, X.; Guo, H.; Qi, J.; Cheng, H. VdThit, a Thiamine Transport Protein, Is Required for Pathogenicity of the Vascular Pathogen Verticillium dahliae. Mol. Plant-Microbe Interact. Mpmi 2016, 29, 545–559. [Google Scholar] [CrossRef] [Green Version]
- Haas, A.L.; Laun, N.P.; Begley, T.P. Thi20, a remarkable enzyme from Saccharomyces cerevisiae with dual thiamin biosynthetic and degradation activities. Bioorganic Chem. 2005, 33, 338–344. [Google Scholar] [CrossRef] [PubMed]
- Ahn, I.P.; Kim, S.; Lee, Y.H. Vitamin B1 functions as an activator of plant disease resistance. Plant Physiol. 2005, 138, 1505–1515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rapala-Kozik, M.; Kowalska, E.; Ostrowska, K. Modulation of thiamine metabolism in Zea mays seedlings under conditions of abiotic stress. J. Exp. Bot. 2008, 59, 4133–4143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rapala-Kozik, M.; Wolak, N.; Kujda, M.; Banas, A.K. The upregulation of thiamine (vitamin B1) biosynthesis in Arabidopsis thaliana seedlings under salt and osmotic stress conditions is mediated by abscisic acid at the early stages of this stress response. BMC Plant Biol. 2012, 12, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tunc-Ozdemir, M.; Miller, G.; Song, L.; Kim, J.; Sodek, A.; Koussevitzky, S.; Misra, A.N.; Mittler, R.; Shintani, D. Thiamin confers enhanced tolerance to oxidative stress in Arabidopsis. Plant Physiol. 2009, 151, 421–432. [Google Scholar] [CrossRef] [Green Version]
- Goyer, A. Thiamine in plants: Aspects of its metabolism and functions. Phytochemistry 2010, 71, 1615–1624. [Google Scholar] [CrossRef]
- Ruiz-Roldan, C.; Puerto-Galan, L.; Roa, J.; Castro, A.; Di Pietro, A.; Roncero, M.I.; Hera, C. The Fusarium oxysporum sti35 gene functions in thiamine biosynthesis and oxidative stress response. Fungal Genet. Biol. 2008, 45, 6–16. [Google Scholar] [CrossRef]
- Onozuka, M.; Konno, H.; Kawasaki, Y.; Akaji, K.; Nosaka, K. Involvement of thiaminase II encoded by the THI20 gene in thiamin salvage of Saccharomyces cerevisiae. Fems Yeast Res. 2008, 8, 266–275. [Google Scholar] [CrossRef] [Green Version]
- Jurgenson, C.T.; Chatterjee, A.; Begley, T.P.; Ealick, S.E. Structural insights into the function of the thiamin biosynthetic enzyme Thi4 from Saccharomyces cerevisiae. Biochemistry 2006, 45, 11061–11070. [Google Scholar] [CrossRef]
- Tijsterman, M.; Ketting, R.F.; Plasterk, R.H. The genetics of RNA silencing. Annu. Rev. Genet. 2002, 36, 489–519. [Google Scholar] [CrossRef]
- Hannon, G.J. RNA interference. Nature 2002, 418, 244–251. [Google Scholar] [CrossRef]
- Baulcombe, D. RNA silencing. Trends Biochem. Sci. 2005, 30, 290–293. [Google Scholar] [CrossRef]
- Younis, A.; Siddique, M.I.; Kim, C.K.; Lim, K.B. RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding. Int. J. Biol. Sci. 2014, 10, 1150–1158. [Google Scholar] [CrossRef]
- Fang, X.; Qi, Y. RNAi in Plants: An Argonaute-Centered View. Plant Cell 2016, 28, 272–285. [Google Scholar] [CrossRef] [Green Version]
- Mamta, B.; Rajam, M.V. RNAi technology: A new platform for crop pest control. Physiol. Mol. Biol. Plants: Int. J. Funct. Plant Biol. 2017, 23, 487–501. [Google Scholar] [CrossRef]
- Baum, J.A.; Bogaert, T.; Clinton, W.; Heck, G.R.; Feldmann, P.; Ilagan, O.; Johnson, S.; Plaetinck, G.; Munyikwa, T.; Pleau, M.; et al. Control of coleopteran insect pests through RNA interference. Nat. Biotechnol. 2007, 25, 1322–1326. [Google Scholar] [CrossRef]
- Jiang, C.J.; Shimono, M.; Maeda, S.; Inoue, H.; Mori, M.; Hasegawa, M.; Sugano, S.; Takatsuji, H. Suppression of the rice fatty-acid desaturase gene OsSSI2 enhances resistance to blast and leaf blight diseases in rice. Mol. Plant-Microbe Interact. 2009, 22, 820–829. [Google Scholar] [CrossRef] [Green Version]
- Schwind, N.; Zwiebel, M.; Itaya, A.; Ding, B.; Wang, M.B.; Krczal, G.; Wassenegger, M. RNAi-mediated resistance to Potato spindle tuber viroid in transgenic tomato expressing a viroid hairpin RNA construct. Mol. Plant Pathol. 2009, 10, 459–469. [Google Scholar] [CrossRef]
- Zhu, J.Q.; Liu, S.; Ma, Y.; Zhang, J.Q.; Qi, H.S.; Wei, Z.J.; Yao, Q.; Zhang, W.Q.; Li, S. Improvement of pest resistance in transgenic tobacco plants expressing dsRNA of an insect-associated gene EcR. PLoS ONE 2012, 7, e38572. [Google Scholar] [CrossRef] [Green Version]
- Dou, T.; Shao, X.; Hu, C.; Liu, S.; Sheng, O.; Bi, F.; Deng, G.; Ding, L.; Li, C.; Dong, T.; et al. Host-induced gene silencing of Foc TR4 ERG6/11 genes exhibits superior resistance to Fusarium wilt of banana. Plant Biotechnol. J. 2019. [Google Scholar] [CrossRef] [Green Version]
- Chaudhary, S.; Dutta, T.K.; Tyagi, N.; Shivakumara, T.N.; Papolu, P.K.; Chobhe, K.A.; Rao, U. Host-induced silencing of Mi-msp-1 confers resistance to root-knot nematode Meloidogyne incognita in eggplant. Transgenic Res. 2019, 28, 327–340. [Google Scholar] [CrossRef]
- Inderbitzin, P.; Bostock, R.M.; Davis, R.M.; Usami, T.; Platt, H.W.; Subbarao, K.V. Phylogenetics and taxonomy of the fungal vascular wilt pathogen Verticillium, with the descriptions of five new species. PLoS ONE 2011, 6, e28341. [Google Scholar] [CrossRef]
- DeVay, J.E.; Weir, B.L.; Wakeman, R.J.; Stapleton, J.J. Effects of Verticillium dahliae Infection of Cotton Plants (Gossypium hirsutum) on Potassium Levels in Leaf Petioles. Plant Dis. 1997, 81, 1089–1092. [Google Scholar] [CrossRef] [Green Version]
- Zhang, T.; Zhao, Y.L.; Zhao, J.H.; Wang, S.; Jin, Y.; Chen, Z.Q.; Fang, Y.Y.; Hua, C.L.; Ding, S.W.; Guo, H.S. Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen. Nat. Plants 2016, 2, 16153. [Google Scholar] [CrossRef]
- Su, X.; Rehman, L.; Guo, H.; Li, X.; Zhang, R.; Cheng, H. AAC as a Potential Target Gene to Control Verticillium dahliae. Genes 2017, 8, 25. [Google Scholar] [CrossRef] [Green Version]
- Su, X.; Rehman, L.; Guo, H.; Li, X.; Cheng, H. The oligosaccharyl transferase subunit STT3 mediates fungal development and is required for virulence in Verticillium dahliae. Curr. Genet. 2018, 64, 235–246. [Google Scholar] [CrossRef]
- Wang, J.; Tian, L.; Zhang, D.D.; Short, D.P.G.; Zhou, L.; Song, S.S.; Liu, Y.; Wang, D.; Kong, Z.Q.; Cui, W.Y.; et al. SNARE-Encoding Genes VdSec22 and VdSso1 Mediate Protein Secretion Required for Full Virulence in Verticillium dahliae. Mol. Plant-Microbe Interact. 2018, 31, 651–664. [Google Scholar] [CrossRef] [Green Version]
- Song, Y.; Thomma, B. Host-induced gene silencing compromises Verticillium wilt in tomato and Arabidopsis. Mol. Plant Pathol. 2018, 19, 77–89. [Google Scholar] [CrossRef] [Green Version]
- Nowara, D.; Gay, A.; Lacomme, C.; Shaw, J.; Ridout, C.; Douchkov, D.; Hensel, G.; Kumlehn, J.; Schweizer, P. HIGS: Host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell 2010, 22, 3130–3141. [Google Scholar] [CrossRef] [Green Version]
- Panwar, V.; McCallum, B.; Bakkeren, G. Host-induced gene silencing of wheat leaf rust fungus Puccinia triticina pathogenicity genes mediated by the Barley stripe mosaic virus. Plant Mol. Biol. 2013, 81, 595–608. [Google Scholar] [CrossRef]
- Koch, A.; Biedenkopf, D.; Furch, A.; Weber, L.; Rossbach, O.; Abdellatef, E.; Linicus, L.; Johannsmeier, J.; Jelonek, L.; Goesmann, A.; et al. An RNAi-Based Control of Fusarium graminearum Infections Through Spraying of Long dsRNAs Involves a Plant Passage and Is Controlled by the Fungal Silencing Machinery. PLoS Pathog. 2016, 12, e1005901. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Weiberg, A.; Lin, F.M.; Thomma, B.P.H.J.; Huang, H.D.; Jin, H.L. Bidirectional cross-kingdom RNAi and fungal uptake of external RNAs confer plant protection. Nat. Plants 2016, 2. [Google Scholar] [CrossRef]
- Zhang, T.; Jin, Y.; Zhao, J.H.; Gao, F.; Zhou, B.J.; Fang, Y.Y.; Guo, H.S. Host-Induced Gene Silencing of the Target Gene in Fungal Cells Confers Effective Resistance to the Cotton Wilt Disease Pathogen Verticillium dahliae. Mol. Plant 2016, 9, 939–942. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, Q.; Qiao, L.; Wang, M.; He, B.; Lin, F.M.; Palmquist, J.; Huang, S.D.; Jin, H. Plants send small RNAs in extracellular vesicles to fungal pathogen to silence virulence genes. Science 2018, 360, 1126–1129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Irwin, C.R.; Farmer, A.; Willer, D.O.; Evans, D.H. In-Fusion® Cloning with Vaccinia Virus DNA Polymerase. In Vaccinia Virus and Poxvirology: Methods and Protocols; Isaacs, S.N., Ed.; Humana Press: Totowa, NJ, USA, 2012; pp. 23–35. [Google Scholar]
- Mullins, E.D.; Chen, X.; Romaine, P.; Raina, R.; Geiser, D.M.; Kang, S. Agrobacterium-Mediated Transformation of Fusarium oxysporum: An Efficient Tool for Insertional Mutagenesis and Gene Transfer. Phytopathology 2001, 91, 173–180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tzima, A.K.; Paplomatas, E.J.; Rauyaree, P.; Ospina-Giraldo, M.D.; Kang, S. VdSNF1, the sucrose nonfermenting protein kinase gene of Verticillium dahliae, is required for virulence and expression of genes involved in cell-wall degradation. Mol. Plant-Microbe Interact. 2011, 24, 129–142. [Google Scholar] [CrossRef] [Green Version]
- Qi, X.; Su, X.; Guo, H.; Qi, J.; Cheng, H. A ku70 null mutant improves gene targeting frequency in the fungal pathogen Verticillium dahliae. World J. Microbiol. Biotechnol. 2015, 31, 1889–1897. [Google Scholar] [CrossRef]
- Tzima, A.K.; Paplomatas, E.J.; Tsitsigiannis, D.I.; Kang, S. The G protein beta subunit controls virulence and multiple growth- and development-related traits in Verticillium dahliae. Fungal Genet. Biol. 2012, 49, 271–283. [Google Scholar] [CrossRef]
Gene | Protein Function | References |
---|---|---|
THI4 | HET-P synthesis; Stress response and DNA repair | [14,19] |
THI5/THI11/THI12/THI13 | HMP-P synthesis | [10] |
THI6 | Thiamin-phosphate pyrophosphorylase and hydroxyethylthiazole kinase | [15] |
THI10 | Thiamine transport protein | [17] |
THI20 | HMP-PP synthesis and thiamine degradation | [11,12,21] |
THI21/THI22 | HMP-PP synthesis | [11,12] |
THI80 | Thiamin pyrophosphokinase | [16] |
VdThit | Thiamine transport protein; Vegetable growth, reproduction and invasive hyphal growth | [20] |
PHO3 | Thiamin phosphates hydrolysis | [18] |
Primer Name Sequences (5′→3′) | |
---|---|
Thi20-5F | GTACCCAATTCGAATTC ATTGTGTTTGAGGAGGACACCGAT |
Thi20-5R | CAAGACAGCCCGCAAAC TCTCCTTGAGAAAACGAGTGA |
Thi20-3F | CCCAGAATGCACAGGT TGTTGATGTCGGTGTCATCGTC |
Thi20-3R | GACGGTATCGATAAGCTT TGTTGGAAAAAGGTCAGTCAT |
C-TrpC-F | TTGAAGGAGCATTTTTGGGC |
C-TrpC-R | ATCGATGCTTGGGTAGAATAGGT |
C-VdThi20-F | AAAAGTACTATGGCACAGCAGATGGGCCG |
C-VdThi20-R | AAACTGCAGTCTACTGGCACGGGAACATCT |
C-Nos-F | AGATGCCGACCGGGATCCACTT |
C-Nos-R | TTATCTTTGCGAACCCAGGG |
neo-F | GTTTGCGGGCTGTCTTGACG |
neo-R | TACCTGTGCATTCTGGGTAA |
Thi20-J-F | GCGCAGGACACAAAGGGCGT |
Thi20-J-R | AGCGTGCCGTTGCCGAGACC |
noe-J-F | ATGATTGAACAAGATGGATT |
noe-J-R | TCAGAAGAACTCGTCAAGAA |
Thit-F | CTCGTGACTTTATCGGGTTTCT |
Thit-R | GGCGGATGAGCTGGAATTAT |
VdBt-F | TTCCCCCGTCTCCACTTCTTCATG |
VdBt-R | GACGAGATCGT TCATGTTGAACTC |
Nb-actin-F | GGACCTTTATGGAAACATTGTGCTCAGT |
Nb-actin-R | CCAAGATAGAACCTCCAATCCAGACAC |
Vd-F | CCGCCGGTCCATCAGTCTCTCTGTTTATAC |
Vd-R | CGCCTGCGGGACTCCGATGCGAGCTGTAAC |
TransThi20F | GGGGACAAGTTTGTACAAAAAAGCAGGCTCGCAACCATTGTCAAGCACA |
TransThi20R | GGGGACCACTTTGTACAAGAAAGCTGGGTTTCCAGTACACGTTGCCCTC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qin, T.; Hao, W.; Sun, R.; Li, Y.; Wang, Y.; Wei, C.; Dong, T.; Wu, B.; Dong, N.; Wang, W.; et al. Verticillium dahliae VdTHI20, Involved in Pyrimidine Biosynthesis, Is Required for DNA Repair Functions and Pathogenicity. Int. J. Mol. Sci. 2020, 21, 1378. https://doi.org/10.3390/ijms21041378
Qin T, Hao W, Sun R, Li Y, Wang Y, Wei C, Dong T, Wu B, Dong N, Wang W, et al. Verticillium dahliae VdTHI20, Involved in Pyrimidine Biosynthesis, Is Required for DNA Repair Functions and Pathogenicity. International Journal of Molecular Sciences. 2020; 21(4):1378. https://doi.org/10.3390/ijms21041378
Chicago/Turabian StyleQin, Tengfei, Wei Hao, Runrun Sun, Yuqing Li, Yuanyuan Wang, Chunyan Wei, Tao Dong, Bingjie Wu, Na Dong, Weipeng Wang, and et al. 2020. "Verticillium dahliae VdTHI20, Involved in Pyrimidine Biosynthesis, Is Required for DNA Repair Functions and Pathogenicity" International Journal of Molecular Sciences 21, no. 4: 1378. https://doi.org/10.3390/ijms21041378
APA StyleQin, T., Hao, W., Sun, R., Li, Y., Wang, Y., Wei, C., Dong, T., Wu, B., Dong, N., Wang, W., Sun, J., Yang, Q., Zhang, Y., Yang, S., & Wang, Q. (2020). Verticillium dahliae VdTHI20, Involved in Pyrimidine Biosynthesis, Is Required for DNA Repair Functions and Pathogenicity. International Journal of Molecular Sciences, 21(4), 1378. https://doi.org/10.3390/ijms21041378