In Vivo and In Vitro Mechanical Loading of Mouse Achilles Tendons and Tenocytes—A Pilot Study
Abstract
1. Introduction
2. Results
2.1. Morphological Analysis
2.2. Gene Expression
3. Discussion
4. Limitations
5. Materials and Methods
5.1. In Vivo Mechanical Stimulation of Achilles Tendon
5.2. In Vitro Mechanical Stimulation of Mouse Tenocytes
5.3. Histological Evaluation
5.4. Phalloidin/DAPI Staining
5.5. Gene Expression Analysis
5.6. Statistics
6. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| Col1A1 | Collagen type 1α1 |
| Col3A1 | Collagen type 3α1 |
| ECM | Extracellular matrix |
| Eln | Elastin |
| GAPDH | Glyceraldehyde 3-phosphate dehydrogenase |
| IL-1β | Interleukin-1beta |
| Itga | Integrin alpha |
| Lpl | Lipoprotein lipase |
| MNE | Mean normalized expression |
| MMP | Matrix metalloproteinase |
| qRT-PCR | Quantitative real-time PCR |
| Runx2 | Runt related transcription factor 2 |
| Scx | Scleraxis |
| Sox9 | SRY (sex determining region Y)-box 9 |
| TIMP | Tissue inhibitor of metalloproteinase |
| TNF-α | Tumor necrosis factor alpha |
| Tnmd | Tenomodulin |
References
- Sarasa-Renedo, A.; Chiquet, M. Mechanical signals regulating extracellular matrix gene expression in fibroblasts. Scand. J. Med. Sci. Sports 2005, 15, 223–230. [Google Scholar] [CrossRef]
- Beckham, C.; Dimond, R.; Greenlee, T.K. The role of movement in the development of a digital flexor tendon. Am. J. Anat. 1977, 150, 443–459. [Google Scholar] [CrossRef]
- Germiller, J.A.; Lerner, A.L.; Pacifico, R.J.; Loder, R.T.; Hensinger, R.N. Muscle and tendon size relationships in a paralyzed chick embryo model of clubfoot. J. Pediatr. Orthop. 1998, 18, 314–318. [Google Scholar] [CrossRef] [PubMed]
- Mikic, B.; Johnson, T.L.; Chhabra, A.B.; Schalet, B.J.; Wong, M.; Hunziker, E.B. Differential effects of embryonic immobilization on the development of fibrocartilaginous skeletal elements. J. Rehabil. Res. Dev. 2000, 37, 127–133. [Google Scholar] [PubMed]
- Flynn, B.P.; Bhole, A.P.; Saeidi, N.; Liles, M.; Dimarzio, C.A.; Ruberti, J.W. Mechanical strain stabilizes reconstituted collagen fibrils against enzymatic degradation by mammalian collagenase matrix metalloproteinase 8 (MMP-8). PLoS ONE 2010, 5, 12337. [Google Scholar] [CrossRef] [PubMed]
- Legerlotz, K.; Jones, G.C.; Screen, H.R.C.; Riley, G.P. Cyclic loading of tendon fascicles using a novel fatigue loading system increases interleukin-6 expression by tenocytes. Scand. J. Med. Sci. Sports 2013, 23, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Lin, Z.; Ni, M.; Thien, C.; Day, R.E.; Gardiner, B.; Rubenson, J.; Kirk, T.B.; Smith, D.W.; Wang, A.; et al. Cyclic mechanical stimulation rescues achilles tendon from degeneration in a bioreactor system. J. Orthop. Res. 2015, 33, 1888–1896. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Lin, Z.; Day, R.E.; Gardiner, B.; Landao-Bassonga, E.; Rubenson, J.; Kirk, T.B.; Smith, D.W.; Lloyd, D.G.; Hardisty, G.; et al. Programmable mechanical stimulation influences tendon homeostasis in a bioreactor system. Biotechnol. Bioeng. 2013, 110, 1495–1507. [Google Scholar] [CrossRef]
- Thorpe, C.T.; Chaudhry, S.; Lei, I.I.; Varone, A.; Riley, G.P.; Birch, H.L.; Clegg, P.D.; Screen, H.R.C. Tendon overload results in alterations in cell shape and increased markers of inflammation and matrix degradation. Scand. J. Med. Sci. Sports 2015, 25, 381–391. [Google Scholar] [CrossRef]
- Wang, T.; Chen, P.; Zheng, M.; Wang, A.; Lloyd, D.; Leys, T.; Zheng, Q.; Zheng, M.H. In vitro loading models for tendon mechanobiology. J. Orthop. Res. 2017, 36, 566–575. [Google Scholar] [CrossRef]
- Crockett, R.J.; Centrella, M.; McCarthy, T.L.; Grant Thomson, J. Effects of cyclic strain on rat tail tenocytes. Mol. Biol. Rep. 2010, 37, 2629–2634. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Im, H.-J.; Wang, J.H.-C. Repetitive mechanical stretching modulates IL-1beta induced COX-2, MMP-1 expression, and PGE2 production in human patellar tendon fibroblasts. Gene 2005, 363, 166–172. [Google Scholar] [CrossRef] [PubMed]
- Jiang, C.; Shao, L.; Wang, Q.; Dong, Y. Repetitive mechanical stretching modulates transforming growth factor-β induced collagen synthesis and apoptosis in human patellar tendon fibroblasts. Biochem. Cell Biol. 2012, 90, 667–674. [Google Scholar] [CrossRef]
- Tian, Y.; Gawlak, G.; O’Donnell, J.J.; Mambetsariev, I.; Birukova, A.A. Modulation of Endothelial Inflammation by Low and High Magnitude Cyclic Stretch. PLoS ONE 2016, 11, e0153387. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Zhang, A.; Richardson, D.W. Regulation of the tenogenic gene expression in equine tenocyte-derived induced pluripotent stem cells by mechanical loading and Mohawk. Stem Cell Res. 2019, 39, e101489. [Google Scholar] [CrossRef] [PubMed]
- Tsuzaki, M.; Bynum, D.; Almekinders, L.; Yang, X.; Faber, J.; Banes, A.J. ATP modulates load-inducible IL-1beta, COX 2, and MMP-3 gene expression in human tendon cells. J. Cell. Biochem. 2003, 89, 556–562. [Google Scholar] [CrossRef]
- Mousavizadeh, R.; Khosravi, S.; Behzad, H.; McCormack, R.G.; Duronio, V.; Scott, A. Cyclic Strain Alters the Expression and Release of Angiogenic Factors by Human Tendon Cells. PLoS ONE 2014, 9, e97356. [Google Scholar] [CrossRef]
- Mousavizadeh, R.; Duronio, V.; McCormack, B.; Khosravi, S.; Scott, A. Mechanical loading modulates angiogenic factors in tendon cell. Br. J. Sports Med. 2013, 47. [Google Scholar] [CrossRef]
- Li, Z.; Yang, G.; Khan, M.; Stone, D.; Woo, S.L.-Y.; Wang, J.H.-C. Inflammatory Response of Human Tendon Fibroblasts to Cyclic Mechanical Stretching. Am. J. Sports Med. 2004, 32, 435–440. [Google Scholar] [CrossRef]
- Heinemeier, K.M.; Skovgaard, D.; Bayer, M.L.; Qvortrup, K.; Kjaer, A.; Kjaer, M.; Magnusson, S.P.; Kongsgaard, M. Uphill running improves rat Achilles tendon tissue mechanical properties and alters gene expression without inducing pathological changes. J. Appl. Physiol. 2012, 113, 827–836. [Google Scholar] [CrossRef]
- Thampatty, B.P.; Wang, J.H.-C. Mechanobiology of young and aging tendons: In vivo studies with treadmill running. J. Orthop. Res. 2018, 36, 557–565. [Google Scholar] [CrossRef] [PubMed]
- Joo Kim, J.; Musson, D.S.; Matthews, B.G.; Cornish, J.; Anderson, I.A.; Shim, V.B. Applying Physiologically Relevant Strains to Tenocytes in an In Vitro Cell Device Induces In Vivo Like Behaviors. J. Biomech. Eng. 2016, 138, 121003–121012. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Wang, J.H.-C.; Lake, S.; Hill, A.; Glaser, D. The Effects of Mechanical Loading on Tendons—An In Vivo and In Vitro Model Study. PLoS ONE 2013, 8, e71740. [Google Scholar] [CrossRef] [PubMed]
- Birkhold, A.I.; Razi, H.; Duda, G.N.; Checa, S.; Willie, B.M. Tomography-Based Quantification of Regional Differences in Cortical Bone Surface Remodeling and Mechano-Response. Calcif. Tissue Int. 2017, 100, 255–270. [Google Scholar] [CrossRef]
- Birkhold, A.I.; Razi, H.; Duda, G.N.; Weinkamer, R.; Checa, S.; Willie, B.M. The Periosteal Bone Surface is Less Mechano-Responsive than the Endocortical. Sci. Rep. 2016, 6, 23480. [Google Scholar] [CrossRef]
- Checa, S.; Hesse, B.; Roschger, P.; Aido, M.; Duda, G.N.; Raum, K.; Willie, B.M. Skeletal maturation substantially affects elastic tissue properties in the endosteal and periosteal regions of loaded mice tibiae. Acta Biomater. 2015, 21, 154–164. [Google Scholar] [CrossRef]
- Holguin, N.; Brodt, M.D.; Sanchez, M.E.; Kotiya, A.A.; Silva, M.J. Adaptation of tibial structure and strength to axial compression depends on loading history in both C57BL/6 and BALB/c mice. Calcif. Tissue Int. 2013, 93, 211–221. [Google Scholar] [CrossRef]
- Razi, H.; Birkhold, A.I.; Weinkamer, R.; Duda, G.N.; Willie, B.M.; Checa, S. Aging Leads to a Dysregulation in Mechanically Driven Bone Formation and Resorption. J. Bone Miner. Res. 2015, 30, 1864–1873. [Google Scholar] [CrossRef]
- Main, R.P.; Shefelbine, S.J.; Meakin, L.B.; Silva, M.J.; van der Meulen, M.C.H.; Willie, B.M. Murine Axial Compression Tibial Loading Model to Study Bone Mechanobiology: Implementing the Model and Reporting Results. J. Orthop. Res. 2020, 38, 233–252. [Google Scholar] [CrossRef]
- Arnoczky, S.P.; Lavagnino, M.; Egerbacher, M. The mechanobiological aetiopathogenesis of tendinopathy: Is it the over-stimulation or the under-stimulation of tendon cells? Int. J. Exp. Pathol. 2007, 88, 217–226. [Google Scholar] [CrossRef]
- Lavagnino, M.; Wall, M.E.; Little, D.; Banes, A.J.; Guilak, F.; Arnoczky, S.P. Tendon mechanobiology: Current knowledge and future research opportunities. J. Orthop. Res. 2015, 33, 813–822. [Google Scholar] [CrossRef] [PubMed]
- Maffulli, N.; Longo, U.G.; Maffulli, G.D.; Rabitti, C.; Khanna, A.; Denaro, V. Marked pathological changes proximal and distal to the site of rupture in acute Achilles tendon ruptures. Knee Surg. Sport. Traumatol. Arthrosc. 2011, 19, 680–687. [Google Scholar] [CrossRef] [PubMed]
- Klatte-Schulz, F.; Minkwitz, S.; Schmock, A.; Bormann, N.; Kurtoglu, A.; Tsitsilonis, S.; Manegold, S.; Wildemann, B. Different Achilles Tendon Pathologies Show Distinct Histological and Molecular Characteristics. Int. J. Mol. Sci. 2018, 19, 404. [Google Scholar] [CrossRef] [PubMed]
- Pingel, J.; Lu, Y.; Starborg, T.; Fredberg, U.; Langberg, H.; Nedergaard, A.; Weis, M.; Eyre, D.; Kjaer, M.; Kadler, K.E. 3-D ultrastructure and collagen composition of healthy and overloaded human tendon: Evidence of tenocyte and matrix buckling. J. Anat. 2014, 224, 548–555. [Google Scholar] [CrossRef] [PubMed]
- Stoll, C.; John, T.; Endres, M.; Rosen, C.; Kaps, C.; Kohl, B.; Sittinger, M.; Ertel, W.; Schulze-Tanzil, G. Extracellular matrix expression of human tenocytes in three-dimensional air-liquid and PLGA cultures compared with tendon tissue: Implications for tendon tissue engineering. J. Orthop. Res. 2010, 28, 1170–1177. [Google Scholar] [CrossRef]
- Gonzales, D.A.; Ferng, A.S.; Geffre, C.P.; Borg, J.L.; Miller, M.; Szivek, J.A. Mechanical loading of adipose derived stromal cells causes cell alignment. J. Biomed. Sci. Eng. 2011, 4, 357–361. [Google Scholar] [CrossRef]
- Grenier, G.; Rémy-Zolghadri, M.; Larouche, D.; Gauvin, R.; Baker, K.; Bergeron, F.; Dupuis, D.; Langelier, E.; Rancourt, D.; Auger, F.A.; et al. Tissue Reorganization in Response to Mechanical Load Increases Functionality. Tissue Eng. 2005, 11, 90–100. [Google Scholar] [CrossRef]
- Cardwell, R.D.; Kluge, J.A.; Thayer, P.S.; Guelcher, S.A.; Dahlgren, L.A.; Kaplan, D.L.; Goldstein, A.S. Static and Cyclic Mechanical Loading of Mesenchymal Stem Cells on Elastomeric, Electrospun Polyurethane Meshes. J. Biomech. Eng. 2015, 137, 071010. [Google Scholar] [CrossRef]
- Nam, H.Y.; Pingguan-Murphy, B.; Abbas, A.A.; Merican, A.M.; Kamarul, T. Uniaxial Cyclic Tensile Stretching at 8% Strain Exclusively Promotes Tenogenic Differentiation of Human Bone Marrow-Derived Mesenchymal Stromal Cells. Stem Cells Int. 2019, 2019, 9723025. [Google Scholar] [CrossRef]
- Scott, A.; Sampaio, A.; Abraham, T.; Duronio, C.; Underhill, T.M. Scleraxis expression is coordinately regulated in a murine model of patellar tendon injury. J. Orthop. Res. 2011, 29, 289–296. [Google Scholar] [CrossRef]
- Schweitzer, R.; Chyung, J.H.; Murtaugh, L.C.; Brent, A.E.; Rosen, V.; Olson, E.N.; Lassar, A.; Tabin, C.J. Analysis of the tendon cell fate using Scleraxis, a specific marker for tendons and ligaments. Development 2001, 128, 3855–3866. [Google Scholar] [PubMed]
- Docheva, D.; Hunziker, E.B.; Fässler, R.; Brandau, O. Tenomodulin is necessary for tenocyte proliferation and tendon maturation. Mol. Cell. Biol. 2005, 25, 699–705. [Google Scholar] [CrossRef] [PubMed]
- Mendias, C.L.; Gumucio, J.P.; Bakhurin, K.I.; Lynch, E.B.; Brooks, S. V Physiological loading of tendons induces scleraxis expression in epitenon fibroblasts. J. Orthop. Res. 2012, 30, 606–612. [Google Scholar] [CrossRef] [PubMed]
- Maeda, T.; Sakabe, T.; Sunaga, A.; Sakai, K.; Rivera, A.L.; Keene, D.R.; Sasaki, T.; Stavnezer, E.; Iannotti, J.; Schweitzer, R.; et al. Conversion of mechanical force into TGF-β-mediated biochemical signals. Curr. Biol. 2011, 21, 933–941. [Google Scholar] [CrossRef]
- Huisman, E.; Lu, A.; McCormack, R.G.; Scott, A. Enhanced collagen type I synthesis by human tenocytes subjected to periodic in vitro mechanical stimulation. BMC Musculoskelet. Disord. 2014, 15, 386. [Google Scholar] [CrossRef]
- Klatte-Schulz, F.; Gerhardt, C.; Scheibel, M.; Wildemann, B.; Pauly, S. Relationship between muscle fatty infiltration and the biological characteristics and stimulation potential of tenocytes from rotator cuff tears. J. Orthop. Res. 2014, 32, 129–137. [Google Scholar] [CrossRef]
- Bi, Y.; Ehirchiou, D.; Kilts, T.M.; Inkson, C.A.; Embree, M.C.; Sonoyama, W.; Li, L.; Leet, A.I.; Seo, B.-M.; Zhang, L.; et al. Identification of tendon stem/progenitor cells and the role of the extracellular matrix in their niche. Nat. Med. 2007, 13, 1219–1227. [Google Scholar] [CrossRef]
- Klatte-Schulz, F.; Pauly, S.; Scheibel, M.; Greiner, S.; Gerhardt, C.; Schmidmaier, G.; Wildemann, B. Influence of age on the cell biological characteristics and the stimulation potential of male human tenocyte-like cells. Eur. Cell. Mater. 2012, 24, 74–89. [Google Scholar] [CrossRef]
- Heinemeier, K.M.; Olesen, J.L.; Haddad, F.; Langberg, H.; Kjaer, M.; Baldwin, K.M.; Schjerling, P. Expression of collagen and related growth factors in rat tendon and skeletal muscle in response to specific contraction types. J. Physiol. 2007, 582, 1303–1316. [Google Scholar] [CrossRef]
- Archambault, J.M.; Hart, D.A.; Herzog, W. Response of rabbit Achilles tendon to chronic repetitive loading. Connect. Tissue Res. 2001, 42, 13–23. [Google Scholar] [CrossRef]
- Legerlotz, K.; Schjerling, P.; Langberg, H.; Brüggemann, G.-P.; Niehoff, A. The effect of running, strength, and vibration strength training on the mechanical, morphological, and biochemical properties of the Achilles tendon in rats. J. Appl. Physiol. 2007, 102, 564–572. [Google Scholar] [CrossRef] [PubMed]
- Lo, I.K.Y.; Marchuk, L.L.; Hollinshead, R.; Hart, D.A.; Frank, C.B. Matrix Metalloproteinase and Tissue Inhibitor of Matrix Metalloproteinase mRNA Levels are Specifically Altered in Torn Rotator Cuff Tendons. Am. J. Sports Med. 2004, 32, 1223–1229. [Google Scholar] [CrossRef] [PubMed]
- Riley, G.P.; Curry, V.; DeGroot, J.; van El, B.; Verzijl, N.; Hazleman, B.L.; Bank, R.A. Matrix metalloproteinase activities and their relationship with collagen remodelling in tendon pathology. Matrix Biol. 2002, 21, 185–195. [Google Scholar] [CrossRef]
- Sun, H.B.; Andarawis-Puri, N.; Li, Y.; Fung, D.T.; Lee, J.Y.; Wang, V.M.; Basta-Pljakic, J.; Leong, D.J.; Sereysky, J.B.; Ros, S.J.; et al. Cycle-dependent matrix remodeling gene expression response in fatigue-loaded rat patellar tendons. J. Orthop. Res. 2010, 28, 1380–1386. [Google Scholar] [CrossRef]
- Huisman, E.; Lu, A.; Jamil, S.; Mousavizadeh, R.; McCormack, R.; Roberts, C.; Scott, A. Influence of repetitive mechanical loading on MMP2 activity in tendon fibroblasts. J. Orthop. Res. 2016, 34, 1991–2000. [Google Scholar] [CrossRef]
- Del Buono, A.; Oliva, F.; Longo, U.G.; Rodeo, S.A.; Orchard, J.; Denaro, V.; Maffulli, N. Metalloproteases and rotator cuff disease. J. Shoulder Elb. Surg. 2012, 21, 200–208. [Google Scholar] [CrossRef]
- Minkwitz, S.; Schmock, A.; Kurtoglu, A.; Tsitsilonis, S.; Manegold, S.; Wildemann, B.; Klatte-Schulz, F. Time-dependent alterations of MMPs, TIMPs and tendon structure in human achilles tendons after acute rupture. Int. J. Mol. Sci. 2017, 18, 2199. [Google Scholar] [CrossRef]
- Silva, S.M.; Jerônimo, M.S.; Silva-Pereira, I.; Bocca, A.L.; Sousa, J.B. Expression of metalloproteinases and interleukins on anastomoses in septic rats. J. Surg. Res. 2013, 183, 777–782. [Google Scholar] [CrossRef]
- Fanjul-Fernández, M.; Folgueras, A.R.; Fueyos, A.; Balbín, M.; Suárez, M.F.; Fernández-García, M.S.; Shapiro, S.D.; Freije, J.M.P.; López-Otín, C. Matrix metalloproteinase Mmp-1a is dispensable for normal growth and fertility in mice and promotes lung cancer progression by modulating inflammatory responses. J. Biol. Chem. 2013, 288, 14647–14656. [Google Scholar] [CrossRef]
- Foley, C.J.; Luo, C.; O’Callaghan, K.; Hinds, P.W.; Covic, L.; Kuliopulos, A. Matrix metalloprotease-1a promotes tumorigenesis and metastasis. J. Biol. Chem. 2012, 287, 24330–24338. [Google Scholar] [CrossRef]
- Tressel, S.L.; Kaneider, N.C.; Kasuda, S.; Foley, C.; Koukos, G.; Austin, K.; Agarwal, A.; Covic, L.; Opal, S.M.; Kuliopulos, A. A matrix metalloprotease-PAR1 system regulates vascular integrity, systemic inflammation and death in sepsis. EMBO Mol. Med. 2011, 3, 370–384. [Google Scholar] [CrossRef]
- Morita, W.; Dakin, S.G.; Snelling, S.J.B.; Carr, A.J. Cytokines in tendon disease: A systematic review. Bone Jt. Res. 2017, 6, 656–664. [Google Scholar] [CrossRef]
- Stolk, M.; Klatte-Schulz, F.; Schmock, A.; Minkwitz, S.; Wildemann, B.; Seifert, M. New insights into tenocyte-immune cell interplay in an in vitro model of inflammation. Sci. Rep. 2017, 7, 9801. [Google Scholar] [CrossRef]
- John, T.; Lodka, D.; Kohl, B.; Ertel, W.; Jammrath, J.; Conrad, C.; Stoll, C.; Busch, C.; Schulze-Tanzil, G. Effect of pro-inflammatory and immunoregulatory cytokines on human tenocytes. J. Orthop. Res. 2010, 28, 1071–1077. [Google Scholar] [CrossRef]
- Popov, C.; Burggraf, M.; Kreja, L.; Ignatius, A.; Schieker, M.; Docheva, D. Mechanical stimulation of human tendon stem/progenitor cells results in upregulation of matrix proteins, integrins and MMPs, and activation of p38 and ERK1/2 kinases. BMC Mol. Biol. 2015, 16, 6. [Google Scholar] [CrossRef]
- Jones, E.; Legerlotz, K.; Riley, G. Mechanical regulation of integrins in human tenocytes in collagen and fibrin matrices. Orthop. Proc. 2014, 96-B, 161. [Google Scholar]
- Bonewald, L. Use it or lose it to age: A review of bone and muscle communication. Bone 2019, 120, 212–218. [Google Scholar] [CrossRef]
- Boudaoud, A.; Burian, A.; Borowska-Wykręt, D.; Uyttewaal, M.; Wrzalik, R.; Kwiatkowska, D.; Hamant, O. FibrilTool, an ImageJ plug-in to quantify fibrillar structures in raw microscopy images. Nat. Protoc. 2014, 9, 457–463. [Google Scholar] [CrossRef]




| Gene | Accession No. | Sequence Forward Primer | Sequence Reverse Primer |
|---|---|---|---|
| Scx | No information provided | No information provided | |
| Tnmd | NM_022322 | TGTACTGGATCAATCCCACTCT | GCTCATTCTGGTCAATCCCCT |
| COL1A1 | NM_007742.3 | GGTCCACAAGGTTTCCAAGG | GTTCCAGGC AATCCACGAG |
| COL3A1 | NM_009930.2 | GCTGGAGTTGGAGGTGAAAA | GCAGCCTTGGTTAGGATCAA |
| MMP2 | NM_008610.3 | TGACCTTGACCAGAACACCA | TACTTTTAAGGCCCGAGCAA |
| MMP3 | NM_010809.2 | TGGAGATGCTCACTTTGACG | ATGGAAACGGGACAAGTCTG |
| TIMP1 | NM_001044384.1 | CCTTTGCATCTCTGGCATCT | CATTTCCCACAGCCTTGAAT |
| TIMP2 | NM_011594.3 | TACCAGATGGGCTGTGAGTG | GGGTCCTCGATGTCAAGAAA |
| Runx2 | NM_009820.5 | CGAAATGCCTCCGCTGTTAT | TGTCTGTGCCTTCTTGGTTCC |
| Sox9 | NM_011448.4 | GCAAGCAAAGGAGACCAAAA | CGCTGGTATTCAGGGAGGTA |
| Lpl | NM_008509.2 | GCCAAGAGAAGCAGCAAGAT | TCCACCTCCGTGTAAATCAAG |
| Itga1 | NM_001033228.3 | GGCCAACCCAAAGCAAGAAC | CACATGCCAGAAATCCTCCCT |
| Itga2 | NM_008396.2 | GTAGTTGTGACCGATGGCGA | ACCCAAGAACTGCTATGCCG |
| Eln | NM_007925.4 | CTGGTGTTGGTCTTCCAGGT | GCTTTGACTCCTGTGCCAGT |
| TNF-α | NM_013693.3 | ACTGGCAGAAGAGGCACTCC | GGCTACAGGCTTGTCACTCG |
| IL-1β | NM_008361.4 | TGGTGTGTGACGTTCCCATT | TCGTTGCTTGGTTCTCCTTG |
| GAPDH | NM_001289726.1 | AGGTCGGTGTGAACGGATTT | TGAATTTGCCGTGAGTGGAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fleischhacker, V.; Klatte-Schulz, F.; Minkwitz, S.; Schmock, A.; Rummler, M.; Seliger, A.; Willie, B.M.; Wildemann, B. In Vivo and In Vitro Mechanical Loading of Mouse Achilles Tendons and Tenocytes—A Pilot Study. Int. J. Mol. Sci. 2020, 21, 1313. https://doi.org/10.3390/ijms21041313
Fleischhacker V, Klatte-Schulz F, Minkwitz S, Schmock A, Rummler M, Seliger A, Willie BM, Wildemann B. In Vivo and In Vitro Mechanical Loading of Mouse Achilles Tendons and Tenocytes—A Pilot Study. International Journal of Molecular Sciences. 2020; 21(4):1313. https://doi.org/10.3390/ijms21041313
Chicago/Turabian StyleFleischhacker, Viviane, Franka Klatte-Schulz, Susann Minkwitz, Aysha Schmock, Maximilian Rummler, Anne Seliger, Bettina M. Willie, and Britt Wildemann. 2020. "In Vivo and In Vitro Mechanical Loading of Mouse Achilles Tendons and Tenocytes—A Pilot Study" International Journal of Molecular Sciences 21, no. 4: 1313. https://doi.org/10.3390/ijms21041313
APA StyleFleischhacker, V., Klatte-Schulz, F., Minkwitz, S., Schmock, A., Rummler, M., Seliger, A., Willie, B. M., & Wildemann, B. (2020). In Vivo and In Vitro Mechanical Loading of Mouse Achilles Tendons and Tenocytes—A Pilot Study. International Journal of Molecular Sciences, 21(4), 1313. https://doi.org/10.3390/ijms21041313

