MiR-302 Regulates Glycolysis to Control Cell-Cycle during Neural Tube Closure
Abstract
1. Introduction
2. Results
2.1. Metabolism and Differentiation Are Coupled During Neurulation
2.2. Single-Cell Sequencing Reveals Metabolic Contributions to Neural Tube Closure
2.3. Upper Glycolysis Is Regulated by miR-302
2.4. Loss of miR-302 Leads to Accumulation of Glycolytic Intermediates
2.5. MiR-302 Targets Pfkp, Pfkfb3, and Hk1 to Regulate Upper Glycolysis
2.6. miR-302 Targets Pfkp, Pfkfb3, and Hk1 to Regulate Cell Proliferation
3. Discussion
4. Materials and Methods
4.1. Single-Cell and Library Preparation and Sequencing
4.2. Bioinformatic Analysis
4.3. Embryo Processing and Immunofluorescence
4.4. Untargeted Metabolic Profiling
4.5. Phosphofructokinase Assay
4.6. Animal Work
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
NTDs | Neural tube defects |
References
- Anderson, M.J.; Schimmang, T.; Lewandoski, M. An FGF3-BMP signaling axis regulates caudal neural tube closure, neural crest specification and anterior-posterior axis extension. PLoS Genet. 2016, 12, e1006018. [Google Scholar]
- Bjornsson, C.S.; Apostolopoulou, M.; Tian, Y.; Temple, S. It takes a village: Constructing the neurogenic niche. Dev. Cell 2015, 32, 435–446. [Google Scholar] [CrossRef]
- Chen, Z.F.; Behringer, R.R. Twist is required in head mesenchyme for cranial neural tube morphogenesis. Genes Dev. 1995, 9, 686–699. [Google Scholar] [CrossRef]
- Copp, A.J.; Greene, N.D.E.; Murdoch, J.N. The genetic basis of mammalian neurulation. Nat. Rev. Genet. 2003, 4, 784–793. [Google Scholar] [CrossRef] [PubMed]
- Curtin, J.A.; Quint, E.; Tsipouri, V.; Arkell, R.M.; Cattanach, B.; Copp, A.J.; Henderson, D.J.; Spurr, N.; Stanier, P.; Fisher, E.M.; et al. Mutation of Celsr1 disrupts planar polarity of inner ear hair cells and causes severe neural tube defects in the mouse. Curr. Biol. 2003, 13, 1129–1133. [Google Scholar] [CrossRef]
- Echelard, Y.; Epstein, D.J.; St-Jacques, B.; Shen, L.; Mohler, J.; McMahon, J.A.; McMahon, A.P. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 1993, 75, 1417–1430. [Google Scholar] [CrossRef]
- Ewart, J.L.; Cohen, M.F.; Meyer, R.A.; Huang, G.Y.; Wessels, A.; Gourdie, R.G.; Chin, A.J.; Park, S.M.; Lazatin, B.O.; Villabon, S.; et al. Heart and neural tube defects in transgenic mice overexpressing the Cx43 gap junction gene. Development 1997, 124, 1281–1292. [Google Scholar] [PubMed]
- Hamblet, N.S.; Lijam, N.; Ruiz-Lozano, P.; Wang, J.; Yang, Y.; Luo, Z.; Mei, L.; Chien, K.R.; Sussman, D.J.; Wynshaw-Boris, A. Dishevelled 2 is essential for cardiac outflow tract development, somite segmentation and neural tube closure. Development 2002, 129, 5827–5838. [Google Scholar] [CrossRef] [PubMed]
- Hatakeyama, J.; Bessho, Y.; Katoh, K.; Ookawara, S.; Fujioka, M.; Guillemot, F.; Kageyama, R. Hes genes regulate size, shape and histogenesis of the nervous system by control of the timing of neural stem cell differentiation. Development 2004, 131, 5539–5550. [Google Scholar] [CrossRef] [PubMed]
- Ishibashi, M.; Ang, S.L.; Shiota, K.; Nakanishi, S.; Kageyama, R.; Guillemot, F. Targeted disruption of mammalian hairy and Enhancer of split homolog-1 (HES-1) leads to up-regulation of neural helix-loop-helix factors, premature neurogenesis, and severe neural tube defects. Genes Dev. 1995, 9, 3136–3148. [Google Scholar] [CrossRef]
- Keller, R.; Davidson, L.; Edlund, A.; Elul, T.; Ezin, M.; Shook, D.; Skoglund, P. Mechanisms of convergence and extension by cell intercalation. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 2000, 355, 897–922. [Google Scholar]
- Niswander, L. In toto live imaging of mouse morphogenesis and new insights into neural tube closure. Development 2013, 140, 226–236. [Google Scholar]
- Ybot-Gonzalez, P.; Cogram, P.; Gerrelli, D.; Copp, A.J. Sonic hedgehog and the molecular regulation of mouse neural tube closure. Development 2002, 129, 2507–2517. [Google Scholar] [PubMed]
- Copp, A.J.; Stanier, P.; Greene, N.D.E. Neural tube defects: Recent advances, unsolved questions, and controversies. Lancet Neurol. 2013, 12, 799–810. [Google Scholar] [PubMed]
- Greene, N.D.E.; Copp, A.J. Neural tube defects. Annu. Rev. Neurosci. 2014, 37, 221–242. [Google Scholar] [CrossRef]
- Mitchell, L.E. Epidemiology of neural tube defects. In American Journal of Medical Genetics Part C: Seminars in Medical Genetics; Wiley Subscription Services, Inc., A Wiley Company: Hoboken, NJ, USA, 2005; Volume 135, pp. 88–94. [Google Scholar]
- Wallingford, J.B.; Niswander, L.A.; Shaw, G.M.; Finnell, R.H. The continuing challenge of understanding, preventing, and treating neural tube defects. Science 2013, 339, 1222002. [Google Scholar] [CrossRef] [PubMed]
- Hunter, E.S., III; Tugman, J.A. Inhibitors of glycolytic metabolism affect neurulation-staged mouse conceptuses in vitro. Teratology 1995, 52, 317–323. [Google Scholar] [CrossRef]
- Kibar, Z.; Vogan, K.J.; Groulx, N.; Justice, M.J.; Underhill, D.A.; Gros, P. Ltap, a mammalian homolog of Drosophila Strabismus/Van Gogh, is altered in the mouse neural tube mutant Loop-tail. Nat. Genet. 2001, 28, 251–255. [Google Scholar]
- Murdoch, J.N.; Doudney, K.; Paternotte, C.; Copp, A.J.; Stanier, P. Severe neural tube defects in the loop-tail mouse result from mutation of Lpp1, a novel gene involved in floor plate specification. Hum. Mol. Genet. 2001, 10, 2593–2601. [Google Scholar] [CrossRef]
- Murdoch, J.N.; Henderson, D.J.; Doudney, K.; Gaston-Massuet, C.; Phillips, H.M.; Paternotte, C.; Arkell, R.; Stanier, P.; Copp, A.J. Disruption of scribble (Scrb1) causes severe neural tube defects in the circletail mouse. Hum. Mol. Genet. 2003, 12, 87–98. [Google Scholar]
- Oka, C.; Nakano, T.; Wakeham, A.; de la Pompa, J.L.; Mori, C.; Sakai, T.; Okazaki, S.; Kawaichi, M.; Shiota, K.; Mak, T.W.; et al. Disruption of the mouse RBP-J kappa gene results in early embryonic death. Development 1995, 121, 3291–3301. [Google Scholar] [PubMed]
- Montcouquiol, M.; Rachel, R.A.; Lanford, P.J.; Copeland, N.G.; Jenkins, N.A.; Kelley, M.W. Identification of Vangl2 and Scrb1 as planar polarity genes in mammals. Nature 2003, 423, 173–177. [Google Scholar]
- El-hage, S.; Singh, S.M. Temporal expression of genes encoding free radical–metabolizing enzymes is associated with higher mRNA levels during in utero development in mice. Dev. Genet. 1990, 11, 149–159. [Google Scholar] [CrossRef] [PubMed]
- Gelineau-van Waes, J.; Starr, L.; Maddox, J.; Aleman, F.; Voss, K.A.; Wilberding, J.; Riley, R.T. Maternal fumonisin exposure and risk for neural tube defects: Mechanisms in an in vivo mouse model. Birth Defects Res. Part A Clin. Mol. Teratol. 2005, 73, 487–497. [Google Scholar] [CrossRef] [PubMed]
- Ishibashi, M.; Akazawa, S.; Sakamaki, H.; Matsumoto, K.; Yamasaki, H.; Yamaguchi, Y.; Goto, S.; Urata, Y.; Kondo, T.; Nagataki, S. Oxygen-induced embryopathy and the significance of glutathione-dependent antioxidant system in the rat embryo during early organogenesis. Free Radic. Biol. Med. 1997, 22, 447–454. [Google Scholar] [CrossRef]
- Ornoy, A. Embryonic oxidative stress as a mechanism of teratogenesis with special emphasis on diabetic embryopathy. Reprod. Toxicol. 2007, 24, 31–41. [Google Scholar] [CrossRef]
- Weksler-Zangen, S.; Yaffe, P.; Ornoy, A. Reduced SOD activity and increased neural tube defects in embryos of the sensitive but not of the resistant Cohen diabetic rats cultured under diabetic conditions. Birth Defects Res. Part A Clin. Mol. Teratol. 2003, 67, 429–437. [Google Scholar] [CrossRef]
- Wentzel, P.; Welsh, N.; Eriksson, U.J. Developmental damage, increased lipid peroxidation, diminished cyclooxygenase-2 gene expression, and lowered prostaglandin E2 levels in rat embryos exposed to a diabetic environment. Diabetes 1999, 48, 813–820. [Google Scholar] [CrossRef]
- Fuhrmann, K.; Reiher, H.; Semmler, K.; Fischer, F.; Fischer, M.; Glöckner, E. Prevention of congenital malformations in infants of insulin-dependent diabetic mothers. Diabetes Care 1983, 6, 219–223. [Google Scholar] [CrossRef]
- Hendricks, K.A.; Nuno, O.M.; Suarez, L.; Larsen, R. Effects of hyperinsulinemia and obesity on risk of neural tube defects among Mexican Americans. Epidemiology 2001, 12, 630–635. [Google Scholar] [CrossRef]
- Miller, E.; Hare, J.W.; Cloherty, J.P.; Dunn, P.J.; Gleason, R.E.; Soeldner, J.S.; Kitzmiller, J.L. Elevated maternal hemoglobin A1c in early pregnancy and major congenital anomalies in infants of diabetic mothers. N. Engl. J. Med. 1981, 304, 1331–1334. [Google Scholar] [PubMed]
- Shaw, G.M.; Carmichael, S.L.; Laurent, C.; Siega-Riz, A.M.; The National Birth Defects Prevention Study. Periconceptional glycaemic load and intake of sugars and their association with neural tube defects in offspring. Paediatr. Perinat. Epidemiol. 2008, 22, 514–519. [Google Scholar] [CrossRef] [PubMed]
- Shaw, G.M.; Quach, T.; Nelson, V.; Carmichael, S.L.; Schaffer, D.M.; Selvin, S.; Yang, W. Neural tube defects associated with maternal periconceptional dietary intake of simple sugars and glycemic index. Am. J. Clin. Nutr. 2003, 78, 972–978. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Jia, W.; Zhao, X.; Zhao, L.; Yan, H.; Li, J.; Yang, H.; Huang, G.; Liu, J. Non-canonical roles of PFKFB3 in regulation of cell cycle through binding to CDK4. Oncogene 2018, 37, 1685–1698. [Google Scholar] [CrossRef]
- Morriss, G.M.; New, D.A.T. Effect of oxygen concentration on morphogenesis of cranial neural folds and neural crest in cultured rat embryos. Development 1979, 54, 17–35. [Google Scholar]
- Vasudevan, A.; Long, J.E.; Crandall, J.E.; Rubenstein, J.L.; Bhide, P.G. Compartment-specific transcription factors orchestrate angiogenesis gradients in the embryonic brain. Nat. Neurosci. 2008, 11, 429–439. [Google Scholar] [CrossRef]
- Walls, J.R.; Coultas, L.; Rossant, J.; Henkelman, R.M. Three-dimensional analysis of vascular development in the mouse embryo. PLoS ONE 2008, 3, e2853. [Google Scholar]
- DeBerardinis, R.J.; Lum, J.J.; Hatzivassiliou, G.; Thompson, C.B. The biology of cancer: Metabolic reprogramming fuels cell growth and proliferation. Cell Metab. 2008, 7, 11–20. [Google Scholar] [CrossRef]
- Chung, S.; Dzeja, P.P.; Faustino, R.S.; Perez-Terzic, C.; Behvar, A.; Terzic, A. Mitochondrial oxidative metabolism is required for the cardiac differentiation of stem cells. Nat. Clin. Pract. Cardiovasc. Med. 2007, 4, S60–S67. [Google Scholar] [CrossRef]
- Kondoh, H.; Lleonart, M.E.; Nakashima, Y.; Yokode, M.; Tanaka, M.; Bernard, D.; Gil, J.; Beach, D. A high glycolytic flux supports the proliferative potential of murine embryonic stem cells. Antioxid. Redox Signal. 2007, 9, 293–299. [Google Scholar] [CrossRef]
- Bertrand, P.C.; O’Kusky, J.R.; Innis, M.S. Maternal dietary (n-3) fatty acid deficiency alters neurogenesis in the embryonic rat brain. J. Nutr. 2006, 136, 1570–1575. [Google Scholar] [CrossRef] [PubMed]
- Parchem, R.J.; Moore, N.; Fish, J.L.; Parchem, J.G.; Braga, T.T.; Shenoy, A.; Oldham, M.C.; Rubenstein, J.L.R.; Schneider, R.A.; Blelloch, R. MiR-302 is required for timing of neural differentiation, neural tube closure, and embryonic viability. Cell Rep. 2015, 12, 760–773. [Google Scholar] [CrossRef] [PubMed]
- Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [PubMed]
- Bernstein, E.; Kim, S.Y.; Carmell, M.A.; Murchison, E.P.; Alcorn, H.; Li, M.Z.; Hannon, G.J. Dicer is essential for mouse development. Nat. Genet. 2003, 35, 215–217. [Google Scholar] [CrossRef] [PubMed]
- Ebert, M.S.; Sharp, P.A. Roles for microRNAs in conferring robustness to biological processes. Cell 2012, 149, 515–524. [Google Scholar] [CrossRef] [PubMed]
- Park, C.Y.; Choi, Y.S.; McManus, M.T. Analysis of microRNA knockouts in mice. Hum. Mol. Genet. 2010, 19, R169–R175. [Google Scholar] [CrossRef]
- Vidigal, J.A.; Ventura, A. The biological functions of miRNAs: Lessons from in vivo studies. Trends Cell Biol. 2015, 25, 137–147. [Google Scholar] [CrossRef]
- Wang, Y.; Medvid, R.; Melton, C.; Jaenisch, R.; Blelloch, R. DGCR8 is essential for microRNA biogenesis and silencing of embryonic stem cell self-renewal. Nat. Genet. 2007, 39, 380–385. [Google Scholar] [CrossRef]
- Houbaviy, H.B.; Murray, M.F.; Sharp, P.A. Embryonic stem cell-specific MicroRNAs. Dev. Cell 2003, 5, 351–358. [Google Scholar] [CrossRef]
- Jouneau, A.; Ciaudo, C.; Sismeiro, O.; Brochard, V.; Jouneau, L.; Vandormael-Pournin, S.; Coppée, J.-Y.; Zhou, Q.; Heard, E.; Antoniewski, C.; et al. Naive and primed murine pluripotent stem cells have distinct miRNA expression profiles. RNA 2012, 18, 253–264. [Google Scholar] [CrossRef]
- Stadler, B.; Ivanovska, I.; Mehta, K.; Song, S.; Nelson, A.; Tan, Y.; Mathieu, J.; Darby, C.; Blau, C.A.; Ware, C.; et al. Characterization of microRNAs involved in embryonic stem cell states. Stem Cells Dev. 2010, 19, 935–950. [Google Scholar] [CrossRef] [PubMed]
- Suh, M.-R.; Lee, Y.; Kim, J.Y.; Kim, S.; Moon, S.; Lee, J.Y.; Cha, K.; Chunga, H.M.; Yoonc, H.S.; Moon, S.Y.; et al. Human embryonic stem cells express a unique set of microRNAs. Dev. Biol. 2004, 270, 488–498. [Google Scholar] [CrossRef]
- Kim, T.-H.; Goodman, J.; Anderson, K.V.; Niswander, L. Phactr4 regulates neural tube and optic fissure closure by controlling PP1-, Rb-, and E2F1-regulated cell-cycle progression. Dev. Cell 2007, 13, 87–102. [Google Scholar] [CrossRef] [PubMed]
- Pijuan-Sala, B.; Griffiths, J.A.; Guibentif, C.; Hiscock, T.W.; Jawaid, W.; Calero-Nieto, F.J.; Mulas, C.; Ibarra-Soria, X.; Tyser, R.C.V.; Ho, D.L.L.; et al. A single-cell molecular map of mouse gastrulation and early organogenesis. Nature 2019, 566, 490–495. [Google Scholar] [PubMed]
- Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007, 131, 861–872. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Tam, W.; Tong, G.Q.; Wu, Q.; Chan, H.; Soh, B.; Lou, Y.; Yang, J.; Ma, Y.; Chai, L.; et al. Sall4 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1. Nat. Cell Biol. 2006, 8, 1114–1123. [Google Scholar] [CrossRef] [PubMed]
- Ohtsuji, M.; Katsuoka, F.; Kobayashi, A.; Aburatani, H.; Hayes, J.D.; Yamamoto, M. Nrf1 and Nrf2 play distinct roles in activation of antioxidant response element-dependent genes. J. Biol. Chem. 2008, 283, 33554–33562. [Google Scholar] [CrossRef] [PubMed]
- Boot, M.J.; Steegers-Theunissen, R.P.M.; Poelmann, R.E.; van Iperen, L.; Lindemans, J.; Gittenberger-De Groot, A.C. Folic acid and homocysteine affect neural crest and neuroepithelial cell outgrowth and differentiation in vitro. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 2003, 227, 301–308. [Google Scholar] [CrossRef]
- Kim, J.-W.; Tchernyshyov, I.; Semenza, G.L.; Dang, C.V. HIF-1-mediated expression of pyruvate dehydrogenase kinase: A metabolic switch required for cellular adaptation to hypoxia. Cell Metab. 2006, 3, 177–185. [Google Scholar] [CrossRef]
- Zheng, H.; Fu, J.; Xue, P.; Zhao, R.; Dong, J.; Liu, D.; Yamamoto, M.; Tong, Q.; Teng, W.; Qu, W.; et al. CNC-bZIP protein Nrf1-dependent regulation of glucose-stimulated insulin secretion. Antioxid. Redox Signal. 2015, 22, 819–831. [Google Scholar] [CrossRef]
- Majewski, N.; Nogueira, V.; Bhaskar, P.; Coy, P.E.; Skeen, J.E.; Gottlob, K.; Chandel, N.S.; Thompson, C.B.; Robey, R.B.; Hay, N. Hexokinase-mitochondria interaction mediated by Akt is required to inhibit apoptosis in the presence or absence of Bax and Bak. Mol. Cell 2004, 16, 819–830. [Google Scholar] [CrossRef] [PubMed]
- Gottlob, K.; Majewski, N.; Kennedy, S.; Kandel, E.; Robey, R.B.; Hay, N. Inhibition of early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis and mitochondrial hexokinase. Genes Dev. 2001, 15, 1406–1418. [Google Scholar] [PubMed]
- Wilson, J.E. Isozymes of mammalian hexokinase: Structure, subcellular localization and metabolic function. J. Exp. Biol. 2003, 206, 2049–2057. [Google Scholar] [CrossRef] [PubMed]
- Koster, J.F.; Slee, R.G.; van Berkel, T.J.C. Isoenzymes of human phosphofructokinase. Clin. Chem. Acta 1980, 103, 169–173. [Google Scholar]
- Chesney, J.; Mitchell, R.; Benigni, F.; Bacher, M.; Spiegel, L.; Al-Abed, Y.; Han, J.H.; Metz, C.; Bucala, R. An inducible gene product for 6-phosphofructo-2-kinase with an AU-rich instability element: Role in tumor cell glycolysis and the Warburg effect. Proc. Natl. Acad. Sci. USA 1999, 96, 3047–3052. [Google Scholar] [CrossRef] [PubMed]
- Oskam, R.; Rijksen, G.; Staal, G.E.J.; Vora, S. Isozymic composition and regulatory properties of phosphofructokinase from well-differentiated and anaplastic medullary thyroid carcinomas of the rat. Cancer Res. 1985, 45, 135–142. [Google Scholar] [PubMed]
- Okar, D.A.; Lange, A.J. Fructose-2, 6-bisphosphate and control of carbohydrate metabolism in eukaryotes. Biofactors 1999, 10, 1–14. [Google Scholar]
- Tanner, L.B.; Goglia, A.G.; Wei, M.H.; Sehgal, T.; Parsons, L.R.; Park, J.O.; White, E.; Toettcher, J.E.; Rabinowitz, J.D. Four key steps control glycolytic flux in mammalian cells. Cell Syst. 2018, 7, 49–62. [Google Scholar] [CrossRef]
- Zhang, R.; Xu, J.; Zhao, J.; Bai, J.H. Proliferation and invasion of colon cancer cells are suppressed by knockdown of TOP2A. J. Cell. Biochem. 2018, 119, 7256–7263. [Google Scholar] [CrossRef]
- Becker, K.A.; Prachi, N.; Ghule, J.A.; Therrien, J.B.; Lian, J.L.; Stein, A.J.; van Wijnen, A.J.; Stein, G.S. Self-renewal of human embryonic stem cells is supported by a shortened G1 cell cycle phase. J. Cell. Physiol. 2006, 209, 883–893. [Google Scholar]
- Yalcin, A.; Clem, B.F.; Simmons, A.; Lane, A.; Nelson, K.; Clem, A.L.; Brock, E.; Siow, D.; Wattenberg, B.; Telang, S.; et al. Nuclear targeting of 6-phosphofructo-2-kinase (PFKFB3) increases proliferation via cyclin-dependent kinases. J. Biol. Chem. 2009, 284, 24223–24232. [Google Scholar] [CrossRef] [PubMed]
- Smithells, R.W.; Sheppard, S.; Schorah, C.J. Vitamin dificiencies and neural tube defects. Arch. Dis. Child. 1976, 51, 944–950. [Google Scholar] [CrossRef] [PubMed]
- Fame, R.M.; Shannon, M.L.; Chau, K.F.; Head, J.P.; Lehtinen, M.K. A concerted metabolic shift in early forebrain alters the CSF proteome and depends on MYC downregulation for mitochondrial maturation. Development 2019, 146, dev182857. [Google Scholar] [CrossRef] [PubMed]
- Takashima, Y.; Guo, G.; Loos, R.; Nichols, J.; Ficz, G.; Krueger, F.; Oxley, D.; Santos, F.; Clarke, J.; Mansfield, W.; et al. Resetting transcription factor control circuitry toward ground-state pluripotency in human. Cell 2014, 158, 1254–1269. [Google Scholar] [CrossRef]
- Sperber, H.; Mathieu, J.; Wang, Y.; Ferreccio, A.; Hesson, J.; Xu, Z.; Fischer, K.A.; Devi, A.; Detraux, D.; Gu, H.; et al. The metabolome regulates the epigenetic landscape during naive-to-primed human embryonic stem cell transition. Nat. Cell Biol. 2015, 17, 1523–1535. [Google Scholar]
- Zhou, W.; Choi, M.; Margineantu, D.; Margaretha, L.; Hesson, J.; Cavanaugh, C.; Blau, C.A.; Horwitz, M.S.; Hockenbery, D.; Ware, C.; et al. HIF1α induced switch from bivalent to exclusively glycolytic metabolism during ESC-to-EpiSC/hESC transition. EMBO J. 2012, 31, 2103–2116. [Google Scholar] [CrossRef]
- Parchem, R.J.; Ye, J.; Judson, R.L.; LaRussa, M.F.; Krishnakumar, R.; Blelloch, A.; Oldham, M.C.; Blelloch, R. Two miRNA clusters reveal alternative paths in late-stage reprogramming. Cell Stem Cell 2014, 14, 617–631. [Google Scholar]
- Calvo, M.N.; Bartrons, R.; Castano, E.; Perales, J.C.; Navarro-Sabate, A.; Manzano, A. PFKFB3 gene silencing decreases glycolysis, induces cell-cycle delay and inhibits anchorage-independent growth in HeLa cells. FEBS Lett. 2006, 580, 3308–3314. [Google Scholar] [CrossRef]
- Pearce, E.L.; Poffenberger, M.C.; Chang, C.H.; Jones, R.G. Fueling immunity: Insights into metabolism and lymphocyte function. Science 2013, 342, 1242454. [Google Scholar]
- Rempel, A.; Mathupala, S.P.; Griffin, C.A.; Hawkins, A.L.; Pedersen, P.L. Glucose catabolism in cancer cells: Amplification of the gene encoding type II hexokinase. Cancer Res. 1996, 56, 2468–2471. [Google Scholar]
- Schulze, A.; Harris, A.L. How cancer metabolism is tuned for proliferation and vulnerable to disruption. Nature 2012, 491, 364–373. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhang, P.; Zhong, J.; Tan, M.; Ge, J.; Tao, L.; Li, Y.; Zhu, Y.; Wu, L.; Qiu, J.; et al. The platelet isoform of phosphofructokinase contributes to metabolic reprogramming and maintains cell proliferation in clear cell renal cell carcinoma. Oncotarget 2016, 7, 27142. [Google Scholar] [CrossRef]
- Bando, H.; Atsumi, T.; Nishio, T.; Niwa, H.; Mishima, S.; Shimizu, C.; Yoshioka, N.; Bucala, R.; Koike, T. Phosphorylation of the 6-phosphofructo-2-kinase/fructose 2, 6-bisphosphatase/PFKFB3 family of glycolytic regulators in human cancer. Clin. Cancer Res. 2005, 11, 5784–5792. [Google Scholar] [CrossRef]
- Folmes, C.D.L.; Nelson, T.J.; Martinez-Fernandez, A.; Arrell, D.K.; Zlatkovic Lindor, J.; Dzeja, P.P.; Ikeda, Y.; Perez-Terzic, C.; Terzic, A. Somatic oxidative bioenergetics transitions into pluripotency-dependent glycolysis to facilitate nuclear reprogramming. Cell Metab. 2011, 14, 264–271. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Zeng, J.; Xie, R.; Schulz, M.J.; Tedesco, R.; Qu, J.; Erhard, K.F.; Mack, J.F.; Raha, K.; Rendina, A.R.; et al. Discovery of a novel 2, 6-disubstituted glucosamine series of potent and selective hexokinase 2 inhibitors. ACS Med. Chem. Lett. 2016, 7, 217–222. [Google Scholar] [CrossRef] [PubMed]
- Patra, K.C.; Wang, Q.; Bhaskar, P.T.; Miller, L.; Wang, Z.; Wheaton, W.; Chandel, N.; Laakso, M.; Muller, W.J.; Allen, E.L.; et al. Hexokinase 2 is required for tumor initiation and maintenance and its systemic deletion is therapeutic in mouse models of cancer. Cancer Cell 2013, 24, 213–228. [Google Scholar] [CrossRef] [PubMed]
- Vander Heiden, M.G.; Cantley, L.C.; Thompson, C.B. Understanding the Warburg effect: The metabolic requirements of cell proliferation. Science 2009, 324, 1029–1033. [Google Scholar] [PubMed]
- Xu, S.; Catapang, A.; Braas, D.; Stiles, L.; Doh, H.M.; Lee, J.T.; Graeber, T.G.; Damoiseaux, R.; Shirihai, O.; Herschman, H.R. A precision therapeutic strategy for hexokinase 1-null, hexokinase 2-positive cancers. Cancer Metab. 2018, 6, 7. [Google Scholar] [CrossRef] [PubMed]
- Suazo, J.; Pardo, R.; Castillo, S.; Martin, L.M.; Rojas, F.; Santos, J.L.; Rotter, K.; Solar, M.; Tapia, E. Family-based association study between SLC2A1, HK1, and LEPR polymorphisms with myelomeningocele in Chile. Reprod. Sci. 2013, 20, 1207–1214. [Google Scholar] [CrossRef] [PubMed]
- Dunaway, G.A.; Kasten, T.P.; Sebo, T.; Trapp, R.J.B.J. Analysis of the phosphofructokinase subunits and isoenzymes in human tissues. Biochem. J. 1988, 251, 677–683. [Google Scholar] [CrossRef]
- Sánchez-Martínez, C.; Aragón, J.J. Analysis of phosphofructokinase subunits and isozymes in ascites tumor cells and its original tissue, murine mammary gland. FEBS Lett. 1997, 409, 86–90. [Google Scholar] [CrossRef]
- Kessler, R.; Eschrich, K. Splice isoforms of ubiquitous 6-phosphofructo-2-kinase/fructose-2, 6-bisphosphatase in human brain. Mol. Brain Res. 2001, 87, 190–195. [Google Scholar] [CrossRef]
- Okar, D.A.; Lange, A.J.; Manzano, À.; Navarro-Sabatè, A.; Riera, L.; Bartrons, R. PFK-2/FBPase-2: Maker and breaker of the essential biofactor fructose-2, 6-bisphosphate. Trends Biochem. Sci. 2001, 26, 30–35. [Google Scholar] [CrossRef]
- Van Schaftingen, E.; Hue, L.; Hers, H. Fructose 2, 6-bisphosphate, the probably structure of the glucose-and glucagon-sensitive stimulator of phosphofructokinase. Biochem. J. 1980, 192, 897–901. [Google Scholar] [CrossRef] [PubMed]
- Van Schaftingen, E.; Hue, L.; Hers, H. Study of the fructose 6-phosphate/fructose 1, 6-bi-phosphate cycle in the liver in vivo. Biochem. J. 1980, 192, 263–271. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Van Schaftingen, E.; Jett, M.; Hue, L.; Hers, H. Control of liver 6-phosphofructokinase by fructose 2, 6-bisphosphate and other effectors. Proc. Natl. Acad. Sci. USA 1981, 78, 3483–3486. [Google Scholar] [CrossRef]
- Atsumi, T.; Chesney, J.; Metz, C.; Leng, L.; Donnelly, S.; Makita, Z.; Mitchell, R.; Bucala, R. High expression of inducible 6-phosphofructo-2-kinase/fructose-2, 6-bisphosphatase (iPFK-2; PFKFB3) in human cancers. Cancer Res. 2002, 62, 5881–5887. [Google Scholar]
- Seabra, L.; Warenius, H. Proteomic co-expression of cyclin-dependent kinases 1 and 4 in human cancer cells. Eur. J. Cancer 2007, 43, 1483–1492. [Google Scholar] [CrossRef]
- Verba, K.A.; Wang, R.Y.; Arakawa, A.; Liu, Y.; Shirouzu, M.; Yokoyama, S.; Agard, D.A. Atomic structure of Hsp90-Cdc37-Cdk4 reveals that Hsp90 traps and stabilizes an unfolded kinase. Science 2016, 352, 1542–1547. [Google Scholar]
- Smith, J.R.; Clarke, P.A.; de Billy, E.; Workman, P. Silencing the cochaperone CDC37 destabilizes kinase clients and sensitizes cancer cells to HSP90 inhibitors. Oncogene 2009, 28, 157–169. [Google Scholar]
- Butler, A.; Hoffman, P.; Smibert, P.; Papalexi, E.; Satija, R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat. Biotechnol. 2018, 36, 411–420. [Google Scholar] [CrossRef] [PubMed]
- Broad Institute. Browse Gene Sets. Available online: https://www.gsea-msigdb.org/gsea/msigdb/genesets.jsp?collection=C5 (accessed on 14 May 2020).
- Lewis, B.P.; Burge, C.B.; Bartel, D.P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005, 120, 15–20. [Google Scholar] [CrossRef] [PubMed]
Genotyping Primer | Sequence | Expected Band Sizes |
---|---|---|
miR-302 GFP forward | CAGGACCTACTTTCCCCAGAGCTG | 274 bp wildtype and 547 bp GFP mutant. |
miR-302 GFP wildtype reverse | GAACCCACCCACAAGGCAACTAG | |
miR-302 GFP mutant reverse | GAAGATGGTGCGCTCCTGGACGTAGC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Keuls, R.A.; Kojima, K.; Lozzi, B.; Steele, J.W.; Chen, Q.; Gross, S.S.; Finnell, R.H.; Parchem, R.J. MiR-302 Regulates Glycolysis to Control Cell-Cycle during Neural Tube Closure. Int. J. Mol. Sci. 2020, 21, 7534. https://doi.org/10.3390/ijms21207534
Keuls RA, Kojima K, Lozzi B, Steele JW, Chen Q, Gross SS, Finnell RH, Parchem RJ. MiR-302 Regulates Glycolysis to Control Cell-Cycle during Neural Tube Closure. International Journal of Molecular Sciences. 2020; 21(20):7534. https://doi.org/10.3390/ijms21207534
Chicago/Turabian StyleKeuls, Rachel A., Karin Kojima, Brittney Lozzi, John W. Steele, Qiuying Chen, Steven S. Gross, Richard H. Finnell, and Ronald J. Parchem. 2020. "MiR-302 Regulates Glycolysis to Control Cell-Cycle during Neural Tube Closure" International Journal of Molecular Sciences 21, no. 20: 7534. https://doi.org/10.3390/ijms21207534
APA StyleKeuls, R. A., Kojima, K., Lozzi, B., Steele, J. W., Chen, Q., Gross, S. S., Finnell, R. H., & Parchem, R. J. (2020). MiR-302 Regulates Glycolysis to Control Cell-Cycle during Neural Tube Closure. International Journal of Molecular Sciences, 21(20), 7534. https://doi.org/10.3390/ijms21207534