Molecular Alterations in the Stomach of Tff1-Deficient Mice: Early Steps in Antral Carcinogenesis
Abstract
:1. Introduction
2. Results
2.1. Transcriptional Alterations in Tff1KO and Wild-Type Animals (RT-PCR Analyses)
2.2. Tff1KO and Wild-Type Animals Differ in Their Gkn2 Protein Forms (Western Blot Analyses)
2.3. Tff1 Is Capable of Forming a Heteromer with Fcgbp, Particularly in the Gastric Antrum
2.4. Tff1KO Mice Show Strongly Reduced Tff2 Levels
3. Discussion
3.1. Transcriptional Alterations in Tff1KO Animals Are Indicative for Pre-Neoplastic Changes in the Antrum
3.2. A Large Portion of Murine Tff1 Occurs in a Monomeric Form: A Possible Protective Role
3.3. Tff1 Forms a Complex with Fcgbp in the Antrum
3.4. Tff1KO and Wild-Type Mice Synthesize Different Gkn2 Forms, Particularly in the Antrum
3.5. Tff1KO Mice Show Strongly Reduced Tff2 Levels
4. Materials and Methods
4.1. Animals
4.2. DNA and RNA Extraction, PCR Analysis
4.3. SDS-PAGE, Agarose Gel Electrophoresis, Western Blot Analysis, Antisera
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
FCGBP | IgG Fc binding protein |
SDS-PAGE | Sodium dodecyl sulfate-polyacrylamide gel electrophoresis |
TFF | Trefoil factor family |
References
- Rio, M.C.; Bellocq, J.P.; Daniel, J.Y.; Tomasetto, C.; Lathe, R.; Chenard, M.P.; Batzenschlager, A.; Chambon, P. Breast cancer-associated pS2 protein: Synthesis and secretion by normal stomach mucosa. Science 1988, 241, 705–708. [Google Scholar] [CrossRef] [PubMed]
- Lefebvre, O.; Wolf, C.; Kédinger, M.; Chenard, M.P.; Tomasetto, C.; Chambon, P.; Rio, M.C. The mouse one P-domain (pS2) and two P-domain (mSP) genes exhibit distinct patterns of expression. J. Cell Biol. 1993, 122, 191–198. [Google Scholar] [CrossRef] [PubMed]
- Ribieras, S.; Tomasetto, C.; Rio, M.C. The pS2/TFF1 trefoil factor, from basic research to clinical applications. Biochim. Biophys. Acta 1998, 1378, F61–F77. [Google Scholar] [CrossRef]
- Kjellev, S. The trefoil factor family—Small peptides with multiple functionalities. Cell. Mol. Life Sci. 2009, 66, 1350–1369. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, W. TFF peptides. In Handbook of Biologically Active Peptides, 2nd ed.; Kastin, A., Ed.; Elsevier: Amsterdam, The Netherlands, 2013; pp. 1338–1345. [Google Scholar]
- Westley, B.R.; Griffin, S.M.; May, F.E. Interaction between TFF1, a gastric tumor suppressor trefoil protein, and TFIZ1, a brichos domain-containing protein with homology to SP-C. Biochemistry 2005, 44, 7967–7975. [Google Scholar] [CrossRef] [PubMed]
- Kouznetsova, I.; Laubinger, W.; Kalbacher, H.; Kalinski, T.; Meyer, F.; Roessner, A.; Hoffmann, W. Biosynthesis of gastrokine-2 in the human gastric mucosa: Restricted spatial expression along the antral gland axis and differential interaction with TFF1, TFF2 and mucins. Cell. Physiol. Biochem. 2007, 20, 899–908. [Google Scholar] [CrossRef] [Green Version]
- Newton, J.L.; Allen, A.; Westley, B.R.; May, F.E. The human trefoil peptide, TFF1, is present in different molecular forms that are intimately associated with mucus in normal stomach. Gut 2000, 46, 312–320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Braga Emidio, N.; Hoffmann, W.; Brierley, S.M.; Muttenthaler, M. Trefoil Factor Family: Unresolved Questions and Clinical Perspectives. Trends Biochem. Sci. 2019, 44, 387–390. [Google Scholar] [CrossRef]
- Lefebvre, O.; Chenard, M.P.; Masson, R.; Linares, J.; Dierich, A.; LeMeur, M.; Wendling, C.; Tomasetto, C.; Chambon, P.; Rio, M.C. Gastric mucosa abnormalities and tumorigenesis in mice lacking the pS2 trefoil protein. Science 1996, 274, 259–262. [Google Scholar] [CrossRef]
- Tomasetto, C.; Rio, M.C. Pleiotropic effects of Trefoil Factor 1 deficiency. Cell. Mol. Life Sci. 2005, 62, 2916–2920. [Google Scholar] [CrossRef]
- Hayakawa, Y.; Fox, J.G.; Gonda, T.; Worthley, D.L.; Muthupalani, S.; Wang, T.C. Mouse models of gastric cancer. Cancers 2013, 5, 92–130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Z.; Soutto, M.; Rahman, B.; Fazili, M.W.; Peng, D.; Blanca Piazuelo, M.; Chen, H.; Kay Washington, M.; Shyr, Y.; El-Rifai, W. Integrated expression analysis identifies transcription networks in mouse and human gastric neoplasia. Genes Chromosomes Cancer 2017, 56, 535–547. [Google Scholar] [CrossRef] [PubMed]
- Soutto, M.; Belkhiri, A.; Piazuelo, M.B.; Schneider, B.G.; Peng, D.; Jiang, A.; Washington, M.K.; Kokoye, Y.; Crowe, S.E.; Zaika, A.; et al. Loss of TFF1 is associated with activation of NF-κB-mediated inflammation and gastric neoplasia in mice and humans. J. Clin. Investig. 2011, 121, 1753–1767. [Google Scholar] [CrossRef] [PubMed]
- Saukkonen, K.; Tomasetto, C.; Narko, K.; Rio, M.C.; Ristimaki, A. Cyclooxygenase-2 expression and effect of celecoxib in gastric adenomas of trefoil factor 1-deficient mice. Cancer Res. 2003, 63, 3032–3036. [Google Scholar]
- Buache, E.; Etique, N.; Alpy, F.; Stoll, I.; Muckensturm, M.; Reina-San-Martin, B.; Chenard, M.P.; Tomasetto, C.; Rio, M.C. Deficiency in trefoil factor 1 (TFF1) increases tumorigenicity of human breast cancer cells and mammary tumor development in TFF1-knockout mice. Oncogene 2011, 30, 3261–3273. [Google Scholar] [CrossRef] [Green Version]
- Tomita, H.; Takaishi, S.; Menheniott, T.R.; Yang, X.; Shibata, W.; Jin, G.; Betz, K.S.; Kawakami, K.; Minamoto, T.; Tomasetto, C.; et al. Inhibition of gastric carcinogenesis by the hormone gastrin is mediated by suppression of TFF1 epigenetic silencing. Gastroenterology 2011, 140, 879–891. [Google Scholar] [CrossRef] [Green Version]
- Prest, S.J.; May, F.E.; Westley, B.R. The estrogen-regulated protein, TFF1, stimulates migration of human breast cancer cells. FASEB J. 2002, 16, 592–594. [Google Scholar] [CrossRef]
- Fu, T.; Kalbacher, H.; Hoffmann, W. TFF1 is differentially expressed in stationary and migratory rat gastric epithelial cells (RGM-1) after in vitro wounding: Influence of TFF1 RNA interference on cell migration. Cell. Physiol. Biochem. 2013, 32, 997–1010. [Google Scholar] [CrossRef]
- Bossenmeyer-Pourie, C.; Kannan, R.; Ribieras, S.; Wendling, C.; Stoll, I.; Thim, L.; Tomasetto, C.; Rio, M.C. The trefoil factor 1 participates in gastrointestinal cell differentiation by delaying G1-S phase transition and reducing apoptosis. J. Cell Biol. 2002, 157, 761–770. [Google Scholar] [CrossRef]
- Hoffmann, W. Trefoil factor family (TFF) peptides: Regulators of mucosal regeneration and repair, and more. Peptides 2004, 25, 727–730. [Google Scholar] [CrossRef]
- Hoffmann, W. Trefoil factors TFF (trefoil factor family) peptide-triggered signals promoting mucosal restitution. Cell. Mol. Life Sci. 2005, 62, 2932–2938. [Google Scholar] [CrossRef] [PubMed]
- Playford, R.J.; Marchbank, T.; Goodlad, R.A.; Chinery, R.A.; Poulsom, R.; Hanby, A.M. Transgenic mice that overexpress the human trefoil peptide pS2 have an increased resistance to intestinal damage. Proc. Natl. Acad. Sci. USA 1996, 93, 2137–2142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vandenbroucke, K.; Hans, W.; Van Huysse, J.; Neirynck, S.; Demetter, P.; Remaut, E.; Rottiers, P.; Steidler, L. Active delivery of trefoil factors by genetically modified Lactococcus lactis prevents and heals acute colitis in mice. Gastroenterology 2004, 127, 502–513. [Google Scholar] [CrossRef] [PubMed]
- Caluwaerts, S.; Vandenbroucke, K.; Steidler, L.; Neirynck, S.; Vanhoenacker, P.; Corveleyn, S.; Watkins, B.; Sonis, S.; Coulie, B.; Rottiers, P. AG013, a mouth rinse formulation of Lactococcus lactis secreting human Trefoil Factor 1, provides a safe and efficacious therapeutic tool for treating oral mucositis. Oral Oncol. 2010, 46, 564–570. [Google Scholar] [CrossRef] [PubMed]
- Karam, S.M.; Tomasetto, C.; Rio, M.C. Trefoil factor 1 is required for the commitment programme of mouse oxyntic epithelial progenitors. Gut 2004, 53, 1408–1415. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karam, S.; Tomasetto, C.; Rio, M.C. Amplification and invasiveness of epithelial progenitors during gastric carcinogenesis in trefoil factor 1 knockout mice. Cell Prolif. 2008, 41, 923–935. [Google Scholar] [CrossRef]
- Reeves, E.P.; Ali, T.; Leonard, P.; Hearty, S.; O’Kennedy, R.; May, F.E.; Westley, B.R.; Josenhans, C.; Rust, M.; Suerbaum, S. Helicobacter pylori lipopolysaccharide interacts with TFF1 in a pH-dependent manner. Gastroenterology 2008, 135, 2043–2054. [Google Scholar] [CrossRef]
- Clyne, M.; May, F.E. The Interaction of Helicobacter pylori with TFF1 and its role in mediating the tropism of the bacteria within the stomach. Int. J. Mol. Sci. 2019, 20, 4400. [Google Scholar] [CrossRef] [Green Version]
- Albert, T.K.; Laubinger, W.; Müller, S.; Hanisch, F.G.; Kalinski, T.; Meyer, F.; Hoffmann, W. Human intestinal TFF3 forms disulfide-linked heteromers with the mucus-associated FCGBP protein and is released by hydrogen sulfide. J. Proteome Res. 2010, 9, 3108–3117. [Google Scholar] [CrossRef]
- Houben, T.; Harder, S.; Schlüter, H.; Kalbacher, H.; Hoffmann, W. Different Forms of TFF3 in the Human Saliva: Heterodimerization with IgG Fc Binding Protein (FCGBP). Int. J. Mol. Sci. 2019, 20, 5000. [Google Scholar] [CrossRef] [Green Version]
- Hoffmann, W. Current status on stem cells and cancers of the gastric epithelium. Int. J. Mol. Sci. 2015, 16, 19153–19169. [Google Scholar] [CrossRef] [PubMed]
- Hayakawa, Y.; Fox, J.G.; Wang, T.C. The origins of gastric cancer from gastric stem cells: Lessons from mouse models. Cell. Mol. Gastroenterol. Hepatol. 2017, 3, 331–338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Menheniott, T.R.; Peterson, A.J.; O’Connor, L.; Lee, K.S.; Kalantzis, A.; Kondova, I.; Bontrop, R.E.; Bell, K.M.; Giraud, A.S. A novel gastrokine, Gkn3, marks gastric atrophy and shows evidence of adaptive gene loss in humans. Gastroenterology 2010, 138, 1823–1835. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Menheniott, T.R.; Kurklu, B.; Giraud, A.S. Gastrokines: Stomach-specific proteins with putative homeostatic and tumor suppressor roles. Am. J. Physiol. Gastrointest. Liver Physiol. 2013, 304, G109–G121. [Google Scholar] [CrossRef] [Green Version]
- Sakitani, K.; Hayakawa, Y.; Deng, H.; Ariyama, H.; Kinoshita, H.; Konishi, M.; Ono, S.; Suzuki, N.; Ihara, S.; Niu, Z. CXCR4-expressing Mist1+ progenitors in the gastric antrum contribute to gastric cancer development. Oncotarget 2017, 8, 111012–111025. [Google Scholar] [CrossRef] [Green Version]
- Hayakawa, Y.; Jin, G.; Wang, H.; Chen, X.; Westphalen, C.B.; Asfaha, S.; Renz, B.W.; Ariyama, H.; Dubeykovskaya, Z.A.; Takemoto, Y.; et al. CCK2R identifies and regulates gastric antral stem cell states and carcinogenesis. Gut 2015, 64, 544–553. [Google Scholar] [CrossRef] [Green Version]
- McCracken, K.W.; Aihara, E.; Martin, B.; Crawford, C.M.; Broda, T.; Treguier, J.; Zhang, X.; Shannon, J.M.; Montrose, M.H.; Wells, J.M. Wnt/β-catenin promotes gastric fundus specification in mice and humans. Nature 2017, 541, 182–187. [Google Scholar] [CrossRef] [Green Version]
- Kouznetsova, I.; Chwieralski, C.E.; Bälder, R.; Hinz, M.; Braun, A.; Krug, N.; Hoffmann, W. Induced trefoil factor family 1 expression by trans-differentiating Clara cells in a murine asthma model. Am. J. Respir. Cell Mol. Biol. 2007, 36, 286–295. [Google Scholar] [CrossRef] [Green Version]
- Riemer, J.; Bulleid, N.; Herrmann, J.M. Disulfide formation in the ER and mitochondria: Two solutions to a common process. Science 2009, 324, 1284–1287. [Google Scholar] [CrossRef]
- Reddy, P.; Sparvoli, A.; Fagioli, C.; Fassina, G.; Sitia, R. Formation of reversible disulfide bonds with the protein matrix of the endoplasmic reticulum correlates with the retention of unassembled Ig light chains. EMBO J. 1996, 15, 2077–2085. [Google Scholar] [CrossRef]
- Kannan, R.; Tomasetto, C.; Staub, A.; Bossenmeyer-Pourie, C.; Thim, L.; Nielsen, P.F.; Rio, M.C. Human pS2/trefoil factor 1: Production and characterization in Pichia pastoris. Protein Expr. Purif. 2001, 21, 92–98. [Google Scholar] [CrossRef] [PubMed]
- Stürmer, R.; Reising, J.; Hoffmann, W. The TFF peptides xP1 and xP4 appear in distinctive forms in the Xenopus laevis gastric mucosa: Indications for different protective functions. Int. J. Mol. Sci. 2019, 20, 6052. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jakowlew, S.B.; Breathnach, R.; Jeltsch, J.M.; Masiakowski, P.; Chambon, P. Sequence of the pS2 mRNA induced by estrogen in the human breast cancer cell line MCF-7. Nucleic Acids Res. 1984, 12, 2861–2878. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoffmann, W.; Hauser, F. The P-domain or trefoil motif: A role in renewal and pathology of mucous epithelia? Trends Biochem. Sci. 1993, 18, 239–243. [Google Scholar] [CrossRef]
- Chadwick, M.P.; Westley, B.R.; May, F.E. Homodimerization and hetero-oligomerization of the single-domain trefoil protein pNR-2/pS2 through cysteine 58. Biochem. J. 1997, 327, 117–123. [Google Scholar] [CrossRef] [Green Version]
- Tosco, A.; Monti, M.C.; Fontanella, B.; Montefusco, S.; D’Andrea, L.; Ziaco, B.; Baldantoni, D.; Rio, M.C.; Marzullo, L. Copper binds the carboxy-terminus of trefoil protein 1 (TFF1), favoring its homodimerization and motogenic activity. Cell. Mol. Life Sci. 2010, 67, 1943–1955. [Google Scholar] [CrossRef]
- Ying, J.; Clavreul, N.; Sethuraman, M.; Adachi, T.; Cohen, R.A. Thiol oxidation in signaling and response to stress: Detection and quantification of physiological and pathophysiological thiol modifications. Free Radic. Biol. Med. 2007, 43, 1099–1108. [Google Scholar] [CrossRef] [Green Version]
- Gilbert, H.F. Molecular and cellular aspects of thiol-disulfide exchange. In Advances in Enzymology and Related Areas of Molecular Biology; Meister, A., Ed.; John Wiley & Sons: New York, NY, USA, 1990; Volume 63, pp. 69–172. [Google Scholar]
- Poole, L.B. The basics of thiols and cysteines in redox biology and chemistry. Free Radic. Biol. Med. 2015, 80, 148–157. [Google Scholar] [CrossRef] [Green Version]
- Grasberger, H.; El-Zaatari, M.; Dang, D.T.; Merchant, J.L. Dual oxidases control release of hydrogen peroxide by the gastric epithelium to prevent Helicobacter felis infection and inflammation in mice. Gastroenterology 2013, 145, 1045–1054. [Google Scholar] [CrossRef] [Green Version]
- Kennett, E.C.; Chuang, C.Y.; Degendorfer, G.; Whitelock, J.M.; Davies, M.J. Mechanisms and consequences of oxidative damage to extracellular matrix. Biochem. Soc. Trans. 2011, 39, 1279–1287. [Google Scholar] [CrossRef]
- Suzuki, H.; Nishizawa, T.; Tsugawa, H.; Mogami, S.; Hibi, T. Roles of oxidative stress in stomach disorders. J. Clin. Biochem. Nutr. 2012, 50, 35–39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turner, H.L.; Turner, J.R. Good fences make good neighbors: Gastrointestinal mucosal structure. Gut Microbes 2010, 1, 22–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khoder, G.; Al-Yassir, F.; Al Menhali, A.; Saseedharan, P.; Sugathan, S.; Tomasetto, C.; Karam, S.M. Probiotics Upregulate Trefoil Factors and Downregulate Pepsinogen in the Mouse Stomach. Int. J. Mol. Sci. 2019, 20, 3901. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Znalesniak, E.B.; Fu, T.; Guttek, K.; Händel, U.; Reinhold, D.; Hoffmann, W. Increased cerebral Tff1 expression in two murine models of neuroinflammation. Cell. Physiol. Biochem. 2016, 39, 2287–2296. [Google Scholar] [CrossRef]
- Ebert, M.P.; Hoffmann, J.; Haeckel, C.; Rutkowski, K.; Schmid, R.M.; Wagner, M.; Adler, G.; Schulz, H.U.; Roessner, A.; Hoffmann, W.; et al. Induction of TFF1 gene expression in pancreas overexpressing transforming growth factor alpha. Gut 1999, 45, 105–111. [Google Scholar] [CrossRef] [Green Version]
- Znalesniak, E.B.; Fu, T.; Salm, F.; Händel, U.; Hoffmann, W. Transcriptional responses in the murine spleen after Toxoplasma gondii infection: Inflammasome and mucus-associated genes. Int. J. Mol. Sci. 2017, 18, 1245. [Google Scholar] [CrossRef] [Green Version]
- Torres, L.F.; Karam, S.M.; Wendling, C.; Chenard, M.P.; Kershenobich, D.; Tomasetto, C.; Rio, M.C. Trefoil factor 1 (TFF1/pS2) deficiency activates the unfolded protein response. Mol. Med. 2002, 8, 273–282. [Google Scholar] [CrossRef] [Green Version]
- Kouznetsova, I.; Kalinski, T.; Meyer, F.; Hoffmann, W. Self-renewal of the human gastric epithelium: New insights from expression profiling using laser microdissection. Mol. Biosyst. 2011, 7, 1105–1112. [Google Scholar] [CrossRef]
- Li, C.; Wang, R.; Su, B.; Luo, Y.; Terhune, J.; Beck, B.; Peatman, E. Evasion of mucosal defenses during Aeromonas hydrophila infection of channel catfish (Ictalurus punctatus) skin. Dev. Comp. Immunol. 2013, 39, 447–455. [Google Scholar] [CrossRef]
- Kobayashi, K.; Ogata, H.; Morikawa, M.; Iijima, S.; Harada, N.; Yoshida, T.; Brown, W.R.; Inoue, N.; Hamada, Y.; Ishii, H.; et al. Distribution and partial characterisation of IgG Fc binding protein in various mucin producing cells and body fluids. Gut 2002, 51, 169–176. [Google Scholar] [CrossRef] [Green Version]
- Schwartz, J.L. Fcgbp—A Potential Viral Trap in RV144. Open AIDS J. 2014, 8, 21–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lang, T.; Klasson, S.; Larsson, E.; Johansson, M.E.; Hansson, G.C.; Samuelsson, T. Searching the Evolutionary Origin of Epithelial Mucus Protein Components-Mucins and FCGBP. Mol. Biol. Evol. 2016, 33, 1921–1936. [Google Scholar] [CrossRef] [PubMed]
- Johansson, M.E.; Gustafsson, J.K.; Sjoberg, K.E.; Petersson, J.; Holm, L.; Sjovall, H.; Hansson, G.C. Bacteria penetrate the inner mucus layer before inflammation in the dextran sulfate colitis model. PLoS ONE 2010, 5, e12238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, O.; Yoon, J.H.; Choi, W.S.; Ashktorab, H.; Smoot, D.T.; Nam, S.W.; Lee, J.Y.; Park, W.S. Heterodimeric interaction between GKN2 and TFF1 entails synergistic antiproliferative and pro-apoptotic effects on gastric cancer cells. Gastric Cancer 2017, 20, 772–783. [Google Scholar] [CrossRef] [Green Version]
- May, F.E.; Griffin, S.M.; Westley, B.R. The trefoil factor interacting protein TFIZ1 binds the trefoil protein TFF1 preferentially in normal gastric mucosal cells but the co-expression of these proteins is deregulated in gastric cancer. Int. J. Biochem. Cell Biol. 2009, 41, 632–640. [Google Scholar] [CrossRef] [Green Version]
- Menheniott, T.R.; O’Connor, L.; Chionh, Y.T.; Dabritz, J.; Scurr, M.; Rollo, B.N.; Ng, G.Z.; Jacobs, S.; Catubig, A.; Kurklu, B.; et al. Loss of gastrokine-2 drives premalignant gastric inflammation and tumor progression. J. Clin. Investig. 2016, 126, 1383–1400. [Google Scholar] [CrossRef] [Green Version]
- Toback, F.G.; Walsh-Reitz, M.M.; Musch, M.W.; Chang, E.B.; Del Valle, J.; Ren, H.; Huang, E.; Martin, T.E. Peptide fragments of AMP-18, a novel secreted gastric antrum mucosal protein, are mitogenic and motogenic. Am. J. Physiol. Gastrointest. Liver Physiol. 2003, 285, G344–G353. [Google Scholar] [CrossRef] [Green Version]
- Kouznetsova, I.; Peitz, U.; Vieth, M.; Meyer, F.; Vestergaard, E.M.; Malfertheiner, P.; Roessner, A.; Lippert, H.; Hoffmann, W. A gradient of TFF3 (trefoil factor family 3) peptide synthesis within the normal human gastric mucosa. Cell Tissue Res. 2004, 316, 155–165. [Google Scholar] [CrossRef]
- Heuer, F.; Stürmer, R.; Heuer, J.; Kalinski, T.; Lemke, A.; Meyer, F.; Hoffmann, W. Different forms of TFF2, a lectin of the human gastric mucus barrier: In vitro binding studies. Int. J. Mol. Sci. 2019, 20, 5871. [Google Scholar] [CrossRef] [Green Version]
- Thim, L. Trefoil peptides: From structure to function. Cell. Mol. Life Sci. 1997, 53, 888–903. [Google Scholar] [CrossRef]
- Otto, W.R.; Rao, J.; Cox, H.M.; Kotzian, E.; Lee, C.Y.; Goodlad, R.A.; Lane, A.; Gorman, M.; Freemont, P.A.; Hansen, H.F.; et al. Effects of pancreatic spasmolytic polypeptide (PSP) on epithelial cell function. Eur. J. Biochem. 1996, 235, 64–72. [Google Scholar] [CrossRef] [PubMed]
- Hertel, S.C.; Chwieralski, C.E.; Hinz, M.; Rio, M.C.; Tomasetto, C.; Hoffmann, W. Profiling trefoil factor family (TFF) expression in the mouse: Identification of an antisense TFF1-related transcript in the kidney and liver. Peptides 2004, 25, 755–762. [Google Scholar] [CrossRef] [PubMed]
- Ribieras, S.; Lefebvre, O.; Tomasetto, C.; Rio, M.C. Mouse trefoil factor genes: Genomic organization, sequences and methylation analyses. Gene 2001, 266, 67–75. [Google Scholar] [CrossRef]
- Hoffmann, W.; Jagla, W. Cell type specific expression of secretory TFF peptides: Colocalization with mucins and synthesis in the brain. Int. Rev. Cytol. 2002, 213, 147–181. [Google Scholar] [PubMed]
- Tu, S.; Chi, A.L.; Lim, S.; Cui, G.; Dubeykovskaya, Z.; Ai, W.; Fleming, J.V.; Takaishi, S.; Wang, T.C. Gastrin regulates the TFF2 promoter through gastrin-responsive cis-acting elements and multiple signaling pathways. Am. J. Physiol. Gastrointest. Liver Physiol. 2007, 292, G1726–G1737. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoffmann, W. TFF2, a MUC6-binding lectin stabilizing the gastric mucus barrier and more. Int. J. Oncol. 2015, 47, 806–816. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soutto, M.; Romero-Gallo, J.; Krishna, U.; Piazuelo, M.B.; Washington, M.K.; Belkhiri, A.; Peek, R.M., Jr.; El-Rifai, W. Loss of TFF1 promotes Helicobacter pylori-induced β-catenin activation and gastric tumorigenesis. Oncotarget 2015, 6, 17911–17922. [Google Scholar] [CrossRef] [Green Version]
- Fu, T.; Znalesniak, E.B.; Kalinski, T.; Möhle, L.; Biswas, A.; Salm, F.; Dunay, I.R.; Hoffmann, W. TFF peptides play a role in the immune response following oral infection of mice with Toxoplasma gondii. Eur. J. Microbiol. Immunol. 2015, 5, 221–231. [Google Scholar] [CrossRef] [Green Version]
- Jagla, W.; Wiede, A.; Kölle, S.; Hoffmann, W. Differential expression of the TFF-peptides xP1 and xP4 in the gastrointestinal tract of Xenopus laevis. Cell Tissue Res. 1998, 291, 13–18. [Google Scholar] [CrossRef]
- Stürmer, R.; Müller, S.; Hanisch, F.G.; Hoffmann, W. Porcine gastric TFF2 is a mucus constituent and differs from pancreatic TFF2. Cell. Physiol. Biochem. 2014, 33, 895–904. [Google Scholar] [CrossRef]
- Jagla, W.; Wiede, A.; Dietzmann, K.; Rutkowski, K.; Hoffmann, W. Co-localization of TFF3 peptide and oxytocin in the human hypothalamus. FASEB J. 2000, 14, 1126–1131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilhelm, B.; Keppler, C.; Henkeler, A.; Schilli-Westermann, M.; Linder, D.; Aumuller, G.; Seitz, J. Identification and characterization of an IgG binding protein in the secretion of the rat coagulating gland. Biol. Chem. 2002, 383, 1959–1965. [Google Scholar] [CrossRef] [PubMed]
Genes | Accession No. | Primer No. | Primer Pairs | Nucleotide Positions | Tm | Size (bp) | Intron Spanning |
---|---|---|---|---|---|---|---|
Actb | NM_007393.5 | MB2658 MB2659 | CACTGTCGAGTCGCGTCCA TGACCCATTCCCACCATCAC | 29–47 255–236 | 60 °C | 227 | yes |
Agr2 | NM_011783.2 | MB2778 MB2779 | ACGAATGCCCACACAGTCAA GCGTAGAGCCGGTTTGAGTA | 288–307 504–485 | 60 °C | 217 | yes |
Cckbr | NM_007627.5 | MB2674 MB2675 | GCTGAGTGGGACTTCACAGG TTGGTGACCGTTCTTAGGCG | 271–290 563–544 | 60 °C | 293 | yes |
Cxcl1 | NM_008176.3 | MB2628 MB2629 | GGCTGGGATTCACCTCAAGAA GTGTTGTCAGAAGCCAGCGT | 183–203 420–401 | 60 °C | 238 | yes |
Cxcl5 | NM_009141.3 | MB2636 MB2637 | CAGTCATAGCCGCAACGGAG AGAAAATCCGTGGGTGGAGA | 276–295 617–598 | 60 °C | 342 | yes |
Gast | NM_010257.4 | MB2450 MB2451 | CGCCACAACAGCCAACTATT TTCGATGGTGAGAGGCTGAG | 19–38 229–210 | 60 °C | 211 | yes |
Gkn1 | NM_025466.1 | MB2454 MB2455 | CCGCCATGAAGCTCACAATG CCAGGCCCTTTACCCTTCTG | 39–58 372–353 | 60 °C | 334 | yes |
Gkn2 | NM_025467.1 | MB2456 MB2457 | AACATCCACTCAGGCTCGTG CTGTCGAATAGGCGACCCAA | 185–204 454–435 | 60 °C | 270 | yes |
Irx3 | NM_001253822.1 | MB2708 MB2709 | AGCCGGAGAGTGGAACAGG GACATGCTTGCAACTCGTCAC | 1799–1817 2041–2021 | 60 °C | 243 | yes |
Mist1/ Bhlha15 | NM_010800.4 | MB2536 MB2537 | GTGGCTAAAGCTACGTGTCC CTCCAGGCTGGTTTTCCCAG | 8–27 122–103 | 60 °C | 115 | yes |
Muc5ac | NM_010844.3 | MB2700 MB2701 | CCGCGTCAATGGAAAGTTGT CTGGAGGGTTGCATTGAGGT | 3739–3758 4059–4040 | 60 °C | 321 | yes |
Muc6 | NM_001330001.2 | MB2718 MB2719 | GTTCCAGATGCAGCCTGTCT CATAGCTGAACGTGCGGTTG | 1612–1631 2105–2086 | 60 °C | 494 | yes |
Pdia3 | NM_007952.2 | MB2744 MB2745 | CTAGTCGAGTTCTTCGCCCC AAAAACCCACCACTGAGGCA | 282–301 615–596 | 60 °C | 334 | yes |
Pdx1 | NM_008814.4 | MB2464 MB2465 | ATCTCCCCATACGAAGTGCC GTTCCGCTGTGTAAGCACCT | 335–354 572–553 | 60 °C | 238 | yes |
Tff2 | NM_009363.3 | MB2306 MB2307 | CTGGTAGAGGGCGAGAAACC TCTTGCGAGCTGACACTTCC | 92–111 302–283 | 60 °C | 211 | yes |
Troy/ Tnfrsf19 | NM_013869.5 | MB2684 MB2685 | TCTCCTAGTTCGCCTGCCTT AAGAGCACCGTCCTGTGTAG | 572–591 806–787 | 60 °C | 235 | yes |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Znalesniak, E.B.; Salm, F.; Hoffmann, W. Molecular Alterations in the Stomach of Tff1-Deficient Mice: Early Steps in Antral Carcinogenesis. Int. J. Mol. Sci. 2020, 21, 644. https://doi.org/10.3390/ijms21020644
Znalesniak EB, Salm F, Hoffmann W. Molecular Alterations in the Stomach of Tff1-Deficient Mice: Early Steps in Antral Carcinogenesis. International Journal of Molecular Sciences. 2020; 21(2):644. https://doi.org/10.3390/ijms21020644
Chicago/Turabian StyleZnalesniak, Eva B., Franz Salm, and Werner Hoffmann. 2020. "Molecular Alterations in the Stomach of Tff1-Deficient Mice: Early Steps in Antral Carcinogenesis" International Journal of Molecular Sciences 21, no. 2: 644. https://doi.org/10.3390/ijms21020644
APA StyleZnalesniak, E. B., Salm, F., & Hoffmann, W. (2020). Molecular Alterations in the Stomach of Tff1-Deficient Mice: Early Steps in Antral Carcinogenesis. International Journal of Molecular Sciences, 21(2), 644. https://doi.org/10.3390/ijms21020644