In Vitro Maturation with Leukemia Inhibitory Factor Prior to the Vitrification of Bovine Oocytes Improves Their Embryo Developmental Potential and Gene Expression in Oocytes and Embryos
Abstract
1. Introduction
2. Results
2.1. Effects of LIF Supplementation during IVM on Embryo Development, Total Cell Number, ICM and TE Cell Distribution and Apoptosis Rate of Blastocysts Derived from Vitrified/Warmed Oocytes
2.2. Effects of LIF Supplementation during IVM on the Percentages of TUNEL-Positive Oocytes after Vitrification/Warming
2.3. Effects of LIF Supplementation during IVM on Gene Expression of Metaphase II Oocytes and Early Embryos Derived from Vitrified/Warmed Oocytes
2.4. Effects of LIF Supplementation during IVM on Gene Expression of In Vitro-Produced Blastocysts Derived from Vitrified/Warmed Oocytes
3. Discussion
4. Materials and Methods
4.1. Chemicals and Suppliers
4.2. Oocyte Collection and In Vitro Maturation
4.3. Oocyte Vitrification and Warming
4.3.1. Vitrification Protocol
4.3.2. Warming Protocol
4.4. In Vitro Fertilization and Embryo Culture
4.5. Differential Staining of Blastocysts
4.6. TUNEL Assay in Oocytes
4.7. RNA Extraction, Reverse Transcription and Quantitative Real-Time PCR Analysis
4.8. Experimental Design
4.8.1. Effects of LIF Supplementation during IVM on Embryo Development, TCN, ICM and TE Cell Distribution and Apoptosis Rate of Blastocysts Derived from Vitrified/Warmed Oocytes
4.8.2. Effects of LIF Supplementation during IVM on the Percentages of TUNEL-Positive Oocytes after Vitrification/Warming
4.8.3. Effects of LIF Supplementation during IVM on Gene Expression of Metaphase II Oocytes and Early Embryos Derived from Vitrified/Warmed Oocytes
4.8.4. Effects of LIF Supplementation during IVM on Gene Expression of In Vitro-Produced Blastocysts Derived from Vitrified/Warmed Oocytes
4.9. Statistical Analyses
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Prentice, J.R.; Anzar, M. Cryopreservation of Mammalian oocyte for conservation of animal genetics. Vet. Med. Int. 2010, 2011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mandawala, A.A.; Harvey, S.C.; Roy, T.K.; Fowler, K.E. Cryopreservation of animal oocytes and embryos: Current progress and future prospects. Theriogenology 2016, 86, 1637–1644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mogas, T. Update on the Vitrification of Bovine Oocytes and in Vitro-Produced Embryos. Reprod. Fertil. Dev. 2019, 31, 105–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coello, A.; Pellicer, A.; Cobo, A. Vitrification of human oocytes. Minerva Ginecol. 2018, 70, 415–423. [Google Scholar]
- Albarracin, J.L.; Morato, R.; Rojas, C.; Mogas, T. Effects of vitrification in open pulled straws on the cytology of in vitro matured prepubertal and adult bovine oocytes. Theriogenology 2005, 63, 890–901. [Google Scholar] [CrossRef] [Scilit]
- Morato, R.; Izquierdo, D.; Paramio, M.T.; Mogas, T. Cryotops versus open-pulled straws (OPS) as carriers for the cryopreservation of bovine oocytes: Effects on spindle and chromosome configuration and embryo development. Cryobiology 2008, 57, 137–141. [Google Scholar] [CrossRef] [Scilit]
- Rogers, K.; Foster, B.; Guiterrez, E.; Diaz, F.; KR, B. Effects of Dimethyl Sulfoxide- or Glycerol-Based Vitrification Protocols on Zona Pellucida Hardening in Mature Bovine Oocytes. Reprod. Fertil. Dev. 2017, 30, 160. [Google Scholar] [CrossRef] [Scilit]
- Nazmara, Z.; Salehnia, M.; HosseinKhani, S. Mitochondrial Distribution and ATP Content of Vitrified, In vitro Matured Mouse Oocytes. Avicenna J. Med. Biotechnol. 2014, 6, 210–217. [Google Scholar]
- Spricigo, J.F.; Morato, R.; Arcarons, N.; Yeste, M.; Dode, M.A.; Lopez-Bejar, M.; Mogas, T. Assessment of the effect of adding L-carnitine and/or resveratrol to maturation medium before vitrification on in vitro-matured calf oocytes. Theriogenology 2017, 89, 47–57. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Zhang, L.; Deng, T.; Zou, P.; Wang, Y.; Quan, F.; Zhang, Y. Effects of oocyte vitrification on epigenetic status in early bovine embryos. Theriogenology 2016, 86, 868–878. [Google Scholar] [CrossRef] [Scilit]
- Anchamparuthy, V.; Pearson, R.; Gwazdauskas, F. Expression Pattern of Apoptotic Genes in Vitrified-Thawed Bovine Oocytes. Reprod. Domest. Anim. Zuchthyg. 2010, 45, e83–e90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Memili, E.; Dominko, T.; First, N.L. Onset of transcription in bovine oocytes and preimplantation embryos. Mol. Reprod. Dev. 1998, 51, 36–41. [Google Scholar] [CrossRef]
- Latham, K.E. Mechanisms and control of embryonic genome activation in mammalian embryos. Int. Rev. Cytol. 1999, 193, 71–124. [Google Scholar] [PubMed]
- Chen, J.Y.; Li, X.X.; Xu, Y.K.; Wu, H.; Zheng, J.J.; Yu, X.L. Developmental competence and gene expression of immature oocytes following liquid helium vitrification in bovine. Cryobiology 2014, 69, 428–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taupin, J.L.; Pitard, V.; Dechanet, J.; Miossec, V.; Gualde, N.; Moreau, J.F. Leukemia inhibitory factor: Part of a large ingathering family. Int. Rev. Immunol. 1998, 16, 397–426. [Google Scholar] [CrossRef] [Scilit]
- Godard, A.; Heymann, D.; Raher, S.; Anegon, I.; Peyrat, M.A.; Le Mauff, B.; Mouray, E.; Gregoire, M.; Virdee, K.; Soulillou, J.P.; et al. High and low affinity receptors for human interleukin for DA cells/leukemia inhibitory factor on human cells. Molecular characterization and cellular distribution. J. Biol. Chem. 1992, 267, 3214–3222. [Google Scholar]
- Fischer, P.; Hilfiker-Kleiner, D. Role of gp130-mediated signalling pathways in the heart and its impact on potential therapeutic aspects. Br. J. Pharmacol. 2008, 153 (Suppl. 1), S414–S427. [Google Scholar] [CrossRef] [Scilit]
- De Matos, D.G.; Miller, K.; Scott, R.; Tran, C.A.; Kagan, D.; Nataraja, S.G.; Clark, A.; Palmer, S. Leukemia inhibitory factor induces cumulus expansion in immature human and mouse oocytes and improves mouse two-cell rate and delivery rates when it is present during mouse in vitro oocyte maturation. Fertil. Steril. 2008, 90, 2367–2375. [Google Scholar] [CrossRef] [Scilit]
- Ptak, G.; Lopes, F.; Matsukawa, K.; Tischner, M.; Loi, P. Leukaemia inhibitory factor enhances sheep fertilization in vitro via an influence on the oocyte. Theriogenology 2006, 65, 1891–1899. [Google Scholar] [CrossRef] [Scilit]
- An, L.; Liu, J.; Du, Y.; Liu, Z.; Zhang, F.; Liu, Y.; Zhu, X.; Ling, P.; Chang, S.; Hu, Y.; et al. Synergistic effect of cysteamine, leukemia inhibitory factor, and Y27632 on goat oocyte maturation and embryo development in vitro. Theriogenology 2018, 108, 56–62. [Google Scholar] [CrossRef] [Scilit]
- Dang-Nguyen, T.Q.; Haraguchi, S.; Kikuchi, K.; Somfai, T.; Bodo, S.; Nagai, T. Leukemia inhibitory factor promotes porcine oocyte maturation and is accompanied by activation of signal transducer and activator of transcription 3. Mol. Reprod. Dev. 2014, 81, 230–239. [Google Scholar]
- Mo, X.; Wu, G.; Yuan, D.; Jia, B.; Liu, C.; Zhu, S.; Hou, Y. Leukemia inhibitory factor enhances bovine oocyte maturation and early embryo development. Mol. Reprod. Dev. 2014, 81, 608–618. [Google Scholar] [PubMed]
- Lonergan, P.; Fair, T. Maturation of Oocytes in Vitro. Annu. Rev. Anim. Biosci. 2016, 4, 255–268. [Google Scholar] [PubMed]
- Wasielak, M.; Wiesak, T.; Bogacka, I.; Jalali, B.M.; Bogacki, M. Maternal effect gene expression in porcine metaphase II oocytes and embryos in vitro: Effect of epidermal growth factor, interleukin-1beta and leukemia inhibitory factor. Zygote 2017, 25, 120–130. [Google Scholar] [PubMed]
- Van Soom, A.; Boerjan, M.; Ysebaert, M.T.; De Kruif, A. Cell allocation to the inner cell mass and the trophectoderm in bovine embryos cultured in two different media. Mol. Reprod. Dev. 1996, 45, 171–182. [Google Scholar] [PubMed]
- Loureiro, B.; Bonilla, L.; Block, J.; Fear, J.M.; Bonilla, A.Q.; Hansen, P.J. Colony-stimulating factor 2 (CSF-2) improves development and posttransfer survival of bovine embryos produced in vitro. Endocrinology 2009, 150, 5046–5054. [Google Scholar] [PubMed]
- Balboula, A.Z.; Yamanaka, K.; Sakatani, M.; Hegab, A.O.; Zaabel, S.M.; Takahashi, M. Intracellular cathepsin B activity is inversely correlated with the quality and developmental competence of bovine preimplantation embryos. Mol. Reprod. Dev. 2010, 77, 1031–1039. [Google Scholar] [PubMed]
- Graf, A.; Krebs, S.; Zakhartchenko, V.; Schwalb, B.; Blum, H.; Wolf, E. Fine mapping of genome activation in bovine embryos by RNA sequencing. Proc. Natl. Acad. Sci. USA 2014, 111, 4139–4144. [Google Scholar]
- Wrenzycki, C.; Herrmann, D.; Lucas-Hahn, A.; Korsawe, K.; Lemme, E.; Niemann, H. Messenger RNA expression patterns in bovine embryos derived from in vitro procedures and their implications for development. Reprod. Fertil. Dev. 2005, 17, 23–35. [Google Scholar]
- Xie, F.; Krisher, R.L.; Wood, J.A. Oxidative Stress during Oocyte in vitro Maturation Increases the Abundances of Dppa3 and Pou5f1 Maternal Effect Gene Transcripts in Matured Oocytes and 2-cell Embryos, Indicative of Altered Post-Transcriptional Regulation of Maternal mRNAs. In Proceedings of the Annual Meeting of the Society for the Study Reproduction, San Diego, CA, USA, 16–20 July 2016; p. 181. [Google Scholar]
- Rideout, W.M., 3rd; Eggan, K.; Jaenisch, R. Nuclear cloning and epigenetic reprogramming of the genome. Science 2001, 293, 1093–1098. [Google Scholar]
- Smallwood, S.A.; Kelsey, G. De novo DNA methylation: A germ cell perspective. Trends Genet. 2012, 28, 33–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Doherty, A.M.; Magee, D.A.; O’Shea, L.C.; Forde, N.; Beltman, M.E.; Mamo, S.; Fair, T. DNA methylation dynamics at imprinted genes during bovine pre-implantation embryo development. BMC Dev. Biol. 2015, 15, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Doherty, A.M.; O’Shea, L.C.; Fair, T. Bovine DNA methylation imprints are established in an oocyte size-specific manner, which are coordinated with the expression of the DNMT3 family proteins. Biol. Reprod. 2012, 86, 67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaneda, M.; Okano, M.; Hata, K.; Sado, T.; Tsujimoto, N.; Li, E.; Sasaki, H. Essential role for de novo DNA methyltransferase Dnmt3a in paternal and maternal imprinting. Nature 2004, 429, 900–903. [Google Scholar] [CrossRef] [Scilit]
- Strahl, B.D.; Allis, C.D. The language of covalent histone modifications. Nature 2000, 403, 41–45. [Google Scholar] [CrossRef] [Scilit]
- Suo, L.; Meng, Q.; Pei, Y.; Fu, X.; Wang, Y.; Bunch, T.D.; Zhu, S. Effect of cryopreservation on acetylation patterns of lysine 12 of histone H4 (acH4K12) in mouse oocytes and zygotes. J. Assist. Reprod. Genet. 2010, 27, 735–741. [Google Scholar] [CrossRef] [Scilit]
- Yan, L.Y.; Yan, J.; Qiao, J.; Zhao, P.L.; Liu, P. Effects of oocyte vitrification on histone modifications. Reprod. Fertil. Dev. 2010, 22, 920–925. [Google Scholar] [CrossRef] [Scilit]
- Spinaci, M.; Vallorani, C.; Bucci, D.; Tamanini, C.; Porcu, E.; Galeati, G. Vitrification of pig oocytes induces changes in histone H4 acetylation and histone H3 lysine 9 methylation (H3K9). Vet. Res. Commun. 2012, 36, 165–171. [Google Scholar] [CrossRef] [Scilit]
- Akiyama, T.; Nagata, M.; Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc. Natl. Acad. Sci. USA 2006, 103, 7339–7344. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.C.; Yan, L.Y.; Lei, Z.L.; Miao, Y.L.; Shi, L.H.; Yang, J.W.; Wang, Q.; Ouyang, Y.C.; Sun, Q.Y.; Chen, D.Y. Changes in histone acetylation during postovulatory aging of mouse oocyte. Biol. Reprod. 2007, 77, 666–670. [Google Scholar] [CrossRef] [Scilit]
- Beaujean, N. Epigenetics, embryo quality and developmental potential. Reprod. Fertil. Dev. 2014, 27, 53–62. [Google Scholar] [CrossRef] [Scilit]
- Grosse, L.; Wurm, C.A.; Bruser, C.; Neumann, D.; Jans, D.C.; Jakobs, S. Bax assembles into large ring-like structures remodeling the mitochondrial outer membrane in apoptosis. EMBO J. 2016, 35, 402–413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.; Liu, X.; Bhalla, K.; Kim, C.N.; Ibrado, A.M.; Cai, J.; Peng, T.I.; Jones, D.P.; Wang, X. Prevention of apoptosis by Bcl-2: Release of cytochrome c from mitochondria blocked. Science 1997, 275, 1129–1132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, X.M.; Hao, H.S.; Du, W.H.; Zhao, S.J.; Wang, H.Y.; Wang, N.; Wang, D.; Liu, Y.; Qin, T.; Zhu, H.B. Melatonin inhibits apoptosis and improves the developmental potential of vitrified bovine oocytes. J. Pineal Res. 2016, 60, 132–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Men, H.; Monson, R.L.; Parrish, J.J.; Rutledge, J.J. Degeneration of cryopreserved bovine oocytes via apoptosis during subsequent culture. Cryobiology 2003, 47, 73–81. [Google Scholar] [CrossRef] [Scilit]
- Bluguermann, C.; Romorini, L.; Evseenko, D.; Garate, X.; Neiman, G.; Sevlever, G.E.; Scassa, M.E.; Miriuka, S.G. Leukemia Inhibitory Factor Increases Survival of Pluripotent Stem Cell-Derived Cardiomyocytes. J. Cardiovasc. Transl. Res. 2018, 11, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Morton, S.D.; Cadamuro, M.; Brivio, S.; Vismara, M.; Stecca, T.; Massani, M.; Bassi, N.; Furlanetto, A.; Joplin, R.E.; Floreani, A.; et al. Leukemia inhibitory factor protects cholangiocarcinoma cells from drug-induced apoptosis via a PI3K/AKT-dependent Mcl-1 activation. Oncotarget 2015, 6, 26052–26064. [Google Scholar] [CrossRef] [Scilit]
- Yang, M.Y.; Rajamahendran, R. Expression of Bcl-2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim. Reprod. Sci. 2002, 70, 159–169. [Google Scholar] [CrossRef] [Scilit]
- Hardy, K.; Handyside, A.H.; Winston, R.M. The human blastocyst cell number, death and allocation during late preimplantation development in vitro. Development 1989, 107, 597–604. [Google Scholar]
- Ikwegbue, P.C.; Masamba, P.; Oyinloye, B.E.; Kappo, A.P. Roles of Heat Shock Proteins in Apoptosis, Oxidative Stress, Human Inflammatory Diseases, and Cancer. Pharmaceuticals 2018, 11, 2. [Google Scholar] [CrossRef] [Scilit]
- Shahedi, A.; Hosseini, A.; Khalili, M.; Yeganeh, F. Effects of Vitrification on Nuclear Maturation and Gene Expression of Immature Human Oocytes. Res. Mol. Med. 2017, 5, 27–33. [Google Scholar]
- Turathum, B.; Saikhun, K.; Sangsuwan, P.; Kitiyanant, Y. Effects of vitrification on nuclear maturation, ultrastructural changes and gene expression of canine oocytes. Reprod. Biol. Endocrinol. RB E 2010, 8, 70. [Google Scholar] [PubMed]
- Pan, Y.; Cui, Y.; Baloch, A.R.; Fan, J.; He, J.; Zhang, Y.; Zheng, H.; Li, G.; Yu, S. Association of heat shock protein 90 with the developmental competence of immature oocytes following Cryotop and solid surface vitrification in yaks (Bos grunniens). Cryobiology 2015, 71, 33–39. [Google Scholar] [PubMed]
- Stephanou, A.; Brar, B.; Heads, R.; Knight, R.D.; Marber, M.S.; Pennica, D.; Latchman, D.S. Cardiotrophin-1 induces heat shock protein accumulation in cultured cardiac cells and protects them from stressful stimuli. J. Mol. Cell. Cardiol. 1998, 30, 849–855. [Google Scholar] [PubMed]
- Stephanou, A.; Latchman, D.S. Transcriptional regulation of the heat shock protein genes by STAT family transcription factors. Gene Expr. 1999, 7, 311–319. [Google Scholar]
- Stephanou, A.; Amin, V.; Isenberg, D.A.; Akira, S.; Kishimoto, T.; Latchman, D.S. Interleukin 6 activates heat-shock protein 90 beta gene expression. Biochem. J. 1997, 321 Pt 1, 103–106. [Google Scholar]
- Rizos, D.; Ward, F.; Boland, M.P.; Lonergan, P. Effect of culture system on the yield and quality of bovine blastocysts as assessed by survival after vitrification. Theriogenology 2001, 56, 1–16. [Google Scholar]
- Arcarons, N.; Vendrell-Flotats, M.; Yeste, M.; Mercade, E.; Lopez-Bejar, M.; Mogas, T. Cryoprotectant role of exopolysaccharide of Pseudomonas sp. ID1 in the vitrification of IVM cow oocytes. Reprod. Fertil. Dev. 2019, 31, 1507–1519. [Google Scholar]
- Ascari, I.J.; Alves, N.G.; Jasmin, J.; Lima, R.R.; Quintao, C.C.R.; Oberlender, G.; Moraes, E.A.; Camargo, L.S.A. Addition of insulin-like growth factor I to the maturation medium of bovine oocytes subjected to heat shock: Effects on the production of reactive oxygen species, mitochondrial activity and oocyte competence. Domest. Anim. Endocrinol. 2017, 60, 50–60. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−(ΔΔCT) Method. Methods 2001, 25, 402–408. [Google Scholar]






| D8 Blastocyst | ||||||||
|---|---|---|---|---|---|---|---|---|
| n | Cleavage Rate | D7 Blastocyst | D8 Blastocyst | nD8 | Non-Expanded | Expanded | Hatched | |
| Control | 275 | 90.42 ± 3.15 a | 27.16 ± 7.33 a | 37.42 ± 9.39 a | 105 | 13.01 ± 6.01 a,b | 35.84 ± 9.42 a | 51.15 ± 13.16 a,b |
| LIF | 293 | 77.85 ± 8.72 a,b | 26.53 ± 8.89 a,b | 31.13 ± 5.80 a,b | 90 | 6.66 ± 7.86 a | 32.59 ± 8.00 a | 60.75 ± 10.98 a |
| VIT | 200 | 70.95 ± 14.3 b | 13.8 ± 12.07 b | 17.48 ± 8.80 b | 33 | 30.00 ± 26.47 b | 31.67 ± 7.64 a | 38.33 ± 18.93 b |
| LIF-VIT | 223 | 72.81 ± 13.67 b | 16.70 ± 7.21 a,b | 25.85 ± 8.90 a,b | 47 | 16.05 ± 11.47 a,b | 44.00 ± 15.16 a | 39.96 ± 14.36 b |
| Day 8 Blastocysts | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| n | TCN ± SD | ICM Cell Number ± SD | TE Cell Number ± SD | AR ± SD | |||||||||||
| Bl | Exp | Hd | Bl | Exp | Hd | Bl | Exp | Hd | Bl | Exp | Hd | Bl | Exp | Hd | |
| Control (n = 30) | 9 | 10 | 11 | 92.4 ± 8.0 a,d | 150.1 ± 9.9 a,e | 189.3 ± 12.8 a,f | 9.1 ± 3.1 a,d | 17.2 ± 2.9 a,e | 27.4 ± 5.4 a,f | 83.3 ± 3.6 a,d | 132.9 ± 6.6 a,e | 161.9 ± 14.9 a,f | 9.7 ± 0.5 a,d | 4.5 ± 0.3 a,e | 4.2 ± 0.7 a,e |
| LIF (n = 30) | 8 | 11 | 11 | 96.7 ± 5.7 a,d | 147.8 ± 8.5 a,e | 197.4 ± 10.6 a,f | 13.5 ± 1.9 b,d | 21.6 ± 3.5 b,e | 34.9 ± 4.2 b,f | 83.2 ± 4.2 a,d | 127.2 ± 8.1 a,e | 162.5 ± 11.6 a,f | 8.9 ± 1.2 a,d | 3.8 ± 0.2 a,e | 4.1 ± 0.9 a,e |
| VIT (n = 19) | 5 | 8 | 6 | 72.2 ± 8.1 b,d | 129.5 ± 17.0 b,e | 177.1 ± 18.9 b,f | 10.1 ± 3.6 a,b,d | 20.5 ± 6.2 a,b,e | 22.6 ± 9.2 a,b,f | 62.4 ± 8.5 b,d | 106.9 ± 15.1 b,e | 154.4 ± 18.0 b,f | 16.2 ± 2.6 b,d | 12.1 ± 2.3 b,e | 13.0 ± 1.2 b,e |
| LIF-VIT (n = 24) | 7 | 8 | 9 | 91.3 ± 9.0 a,b,d | 139.5 ± 15.2 a,b,e | 182.2 ± 17.5 a,b,f | 12.7 ± 4.2 a,b,d | 22.3 ± 5.0 a,b,e | 30.3 ± 7.1 a,b,f | 78.6 ± 7.1 a,b,d | 117.2 ± 12.3 a,b,e | 151.9 ± 15.6 a,b,f | 17.4 ± 2.3 c,d | 10.6 ± 3.6 c,e | 8.9 ± 1.9 c,e |
| Symbol | NCBI Gene Name | Gene Bank Accession Number | Primer Set Sequences (5′-3′) | Amplicon Size (bp) |
|---|---|---|---|---|
| BAX | BCL2-associated X, apoptosis regulator | NM_173894.1 | F: GAGAGGTCTTTTTCCGAGTGGC | 237 |
| R: TGTCCCAAAGTAGGAGAGGAG | ||||
| BCL2L1 | BCL2-like 1 | BC147863.1 | F: CCACTTAGGACCCACTTCTGAC | 188 |
| R: GGGTGCTTCCTACAGCTACAGT | ||||
| DNMT3A | DNA methyltransferase 3 alpha | NM_001206502.1 | F: CCTCAGCTCCCCCTACTTATTC | 199 |
| R: AGCTGTGAGCTTACTCCTGAGC | ||||
| DPPA3 | Developmental pluripotency associated 3 | NM_001111108.2 | F: TGGCTACTCTTCATCCCCTACA | 230 |
| R: TCTAGGGTCCAGGTTGGGTT | ||||
| GADPH | Glyceraldehyde-3-phosphate dehydrogenase | NM_001034034.2 | F: AGTCCACTGGGGTCTTCACTAC | 243 |
| R: CAGTGGTCATAAGTCCCTCCAC | ||||
| HDAC1 | Histone deacetylase 1 | NM_001037444.2 | F: CTGAGGAGATGACCAAGTACC | 167 |
| R: CCACCAGTAGACAGCTGACAGA | ||||
| HSPA1A | Heat shock protein family A (Hsp70) member 1A | NM_203322.3 | F: GCAGGTGTGTAACCCCATCA | 181 |
| R: CAGGGCAAGACCAAAGTCCA | ||||
| HSP90AA1 | Heat shock protein 90 alpha family class A member 1 | NM_001012670.2 | F: GTGGAGACTTTCGCCTTCCA | 223 |
| R: TGGTGAGGGTTCGATCTTGC | ||||
| H2AFZ | H2A histone family, member Z | NM_174809.2 | F: GCGTATTACCCCTCGTCACTTG | 227 |
| R: GTCCACTGGAATCACCAACACTG | ||||
| KAT2A | Lysine acetyltransferase 2A | XM_015468132.1 | F: AGGATGTGGCTACCTACAAGG | 190 |
| R: GCACCAGCTTGTCCTTCTCTAC | ||||
| NPM2 | Nucleophosmin/Nucleoplasmin 2 | NM_001168706.1 | F: GGACCTGTGTTCCTCTGTGG | 153 |
| R: CTTCACTTGTTTGACGGGCG | ||||
| ZAR1 | Zygote arrest 1 | NM_001076203.1 | F: GGGAGATGCAAAGGCAAACG | 216 |
| R: CCAAACAACAGCCTTCCACG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vendrell-Flotats, M.; García-Martínez, T.; Martínez-Rodero, I.; Lopez-Bejar, M.; LaMarre, J.; Yeste, M.; Mogas, T. In Vitro Maturation with Leukemia Inhibitory Factor Prior to the Vitrification of Bovine Oocytes Improves Their Embryo Developmental Potential and Gene Expression in Oocytes and Embryos. Int. J. Mol. Sci. 2020, 21, 7067. https://doi.org/10.3390/ijms21197067
Vendrell-Flotats M, García-Martínez T, Martínez-Rodero I, Lopez-Bejar M, LaMarre J, Yeste M, Mogas T. In Vitro Maturation with Leukemia Inhibitory Factor Prior to the Vitrification of Bovine Oocytes Improves Their Embryo Developmental Potential and Gene Expression in Oocytes and Embryos. International Journal of Molecular Sciences. 2020; 21(19):7067. https://doi.org/10.3390/ijms21197067
Chicago/Turabian StyleVendrell-Flotats, Meritxell, Tania García-Martínez, Iris Martínez-Rodero, Manel Lopez-Bejar, Jonathan LaMarre, Marc Yeste, and Teresa Mogas. 2020. "In Vitro Maturation with Leukemia Inhibitory Factor Prior to the Vitrification of Bovine Oocytes Improves Their Embryo Developmental Potential and Gene Expression in Oocytes and Embryos" International Journal of Molecular Sciences 21, no. 19: 7067. https://doi.org/10.3390/ijms21197067
APA StyleVendrell-Flotats, M., García-Martínez, T., Martínez-Rodero, I., Lopez-Bejar, M., LaMarre, J., Yeste, M., & Mogas, T. (2020). In Vitro Maturation with Leukemia Inhibitory Factor Prior to the Vitrification of Bovine Oocytes Improves Their Embryo Developmental Potential and Gene Expression in Oocytes and Embryos. International Journal of Molecular Sciences, 21(19), 7067. https://doi.org/10.3390/ijms21197067

