Phototaxis of the Unicellular Red Alga Cyanidioschyzon merolae Is Mediated by Novel Actin-Driven Tentacles
Abstract
1. Introduction
2. Results and Discussion
3. Methods
3.1. Culture Conditions and Tentacle Induction
3.2. Inhibitor Treatment
3.3. Actin Staining
3.4. Light Microscopy
3.5. Transmission Electron Microscopy
3.6. Scanning Electron Microscopy
3.7. Gene Expression Analysis
3.8. SDS-PAGE and Immunoblotting
3.9. Bioinformatics
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Jékely, G. Evolution of phototaxis. Philos. Trans. R. Soc. B Biol. Sci. 2009, 364, 2795–2808. [Google Scholar] [CrossRef] [PubMed]
- Ueki, N.; Matsunaga, S.; Inouye, I.; Hallmann, A. How 5000 independent rowers coordinate their strokes in order to row into the sunlight: Phototaxis in the multicellular green alga volvox. BMC Biol. 2010, 8, 103. [Google Scholar] [CrossRef] [PubMed]
- Kinoshita, N.; Nagasato, C.; Motomura, T. Phototaxis and chemotaxis of brown algal swarmers. J. Plant Res. 2017, 130, 443–453. [Google Scholar] [CrossRef] [PubMed]
- Bennett, R.R.; Golestanian, R. A steering mechanism for phototaxis in chlamydomonas. J. R. Soc. Interface 2015, 12, 20141164. [Google Scholar] [CrossRef]
- Ishikawa, T. Axoneme structure from motile cilia. Cold Spring Harb. Perspect. Biol. 2016, 9, a028076. [Google Scholar] [CrossRef]
- Nultsch, W.; Schuchart, H. Photomovement of the red alga Porphyridium Cruentum (Ag.) Naegeli. Arch. Microbiol. 1980, 125, 181–188. [Google Scholar] [CrossRef]
- Pickett-Heaps, J.; West, J.; Wilson, S.; McBride, D. Time-lapse videomicroscopy of cell (spore) movement in red algae. Eur. J. Phycol. 2001, 36, 9–22. [Google Scholar] [CrossRef]
- Yang, E.C.; Scott, J.; West, J.A.; Orlova, E.; Gauthier, D.; Küpper, F.C.; Yoon, H.S.; Karsten, U. New taxa of the Porphyridiophyceae (Rhodophyta): Timspurckia oligopyrenoides gen. et sp. nov. and erythrolobus madagascarensis sp. nov. Phycologia 2010, 49, 604–616. [Google Scholar] [CrossRef]
- Ohnuma, M.; Misumi, O.; Kuroiwa, T. Phototaxis in the unicellular red algae Cyanidioschyzon merolae and Cyanidium caldarium. Cytologia 2011, 76, 295–300. [Google Scholar] [CrossRef][Green Version]
- Fujita, S.; Matsuo, T.; Ishiura, M.; Kikkawa, M. High-throughput phenotyping of Chlamydomonas swimming mutants based on nanoscale video analysis. Biophys. J. 2014, 107, 336–345. [Google Scholar] [CrossRef]
- Wan, K.Y. Coordination of eukaryotic cilia and flagella. Essays Biochem. 2018, 62, 829–838. [Google Scholar] [PubMed]
- Pollard, T.D.; Borisy, G.G. Cellular motility driven by assembly and disassembly of actin filaments. Cell 2003, 112, 453–465. [Google Scholar] [CrossRef]
- Takahashi, H.; Takano, H.; Yokoyama, A.; Hara, Y.; Kawano, S.; Toh-E, A.; Kuroiwa, T. Isolation, characterization and chromosomal mapping of an actin gene from the primitive red alga Cyanidioschyzon Merolae. Curr. Genet. 1995, 28, 484–490. [Google Scholar] [CrossRef] [PubMed]
- Matsuzaki, M.; Misumi, O.; Shin-I, T.; Maruyama, S.; Takahara, M.; Miyagishima, S.-Y.; Mori, T.; Nishida, K.; Yagisawa, F.; Nishida, K.; et al. Genome sequence of the ultrasmall unicellular red alga Cyanidioschyzon merolae. 10D Nature 2004, 428, 653–657. [Google Scholar] [CrossRef]
- Suzuki, K.; Kawazu, T.; Mita, T.; Takahashi, H.; Itoh, R.; Toda, K.; Kuroiwa, T. Cytokinesis by a contractile ring in the primitive red alga cyanidium caldarium RK-1. Eur. J. Cell Biol. 1995, 67, 170–178. [Google Scholar] [PubMed]
- Medalia, O.; Beck, M.; Ecke, M.; Weber, I.; Neujahr, R.; Baumeister, W.; Gerisch, G. Organization of actin networks in intact filopodia. Curr. Biol. 2007, 17, 79–84. [Google Scholar] [CrossRef]
- Bohil, A.B.; Robertson, B.W.; Cheney, R. Myosin-X Is a molecular motor that functions in filopodia formation. Proc. Natl. Acad. Sci. USA 2006, 103, 12411–12416. [Google Scholar] [CrossRef] [PubMed]
- Tokuo, H.; Mabuchi, K.; Ikebe, M. The motor activity of myosin-x promotes actin fiber convergence at the cell periphery to initiate filopodia formation. J. Cell Biol. 2007, 179, 229–238. [Google Scholar] [CrossRef] [PubMed]
- Sinnar, S.A.; Antoku, S.; Saffin, J.-M.; Cooper, J.A.; Halpain, S. Capping protein is essential for cell migration in vivo and for filopodial morphology and dynamics. Mol. Biol. Cell 2014, 25, 2152–2160. [Google Scholar] [CrossRef]
- Lu, M.; Witke, W.; Kwiatkowski, D.J.; Kosik, K.S. Delayed retraction of filopodia in gelsolin null mice. J. Cell Biol. 1997, 138, 1279–1287. [Google Scholar] [CrossRef]
- Yang, C.; Czech, L.; Gerboth, S.; Kojima, S.-I.; Scita, G.; Svitkina, T.M. Novel roles of formin mdia2 in lamellipodia and filopodia formation in motile cells. PLoS Biol. 2007, 5, e317. [Google Scholar] [CrossRef]
- Schirenbeck, A.; Bretschneider, T.; Arasada, R.; Schleicher, M.; Faix, J. The diaphanous-related formin dDia2 is required for the formation and maintenance of filopodia. Nat. Cell Biol. 2005, 7, 619–625. [Google Scholar] [CrossRef] [PubMed]
- Vignjevic, D.M.; Kojima, S.-I.; Aratyn, Y.; Danciu, O.; Svitkina, T.; Borisy, G.G. Role of fascin in filopodial protrusion. J. Cell Biol. 2006, 174, 863–875. [Google Scholar] [CrossRef]
- Harker, A.J.; Katkar, H.H.; Bidone, T.C.; Aydin, F.; Voth, G.A.; Applewhite, D.A.; Kovar, D.R. Ena/VASP processive elongation is modulated by avidity on actin filaments bundled by the filopodia cross-linker fascin. Mol. Biol. Cell 2019, 30, 851–862. [Google Scholar] [CrossRef] [PubMed]
- Nobes, C.D.; Hall, A. Rho, Rac, and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 1995, 81, 53–62. [Google Scholar] [CrossRef]
- Pellegrin, S.; Mellor, H. The Rho Family GTPase Rif induces Filopodia through MDia2. Curr. Biol. 2005, 15, 129–133. [Google Scholar] [CrossRef] [PubMed]
- Stradal, T.E.; Scita, G. Protein complexes regulating Arp2/3-mediated actin assembly. Curr Opin Cell Biol. 2006, 18, 4–10. [Google Scholar] [CrossRef]
- Krause, M.; Dent, E.W.; Bear, J.E.; Loureiro, J.J.; Gertler, F.B. Ena/VASP proteins: regulators of the actin cytoskeleton and cell migration. Annu. Rev. Cell Dev. Biol. 2003, 19, 541–564. [Google Scholar] [CrossRef] [PubMed]
- Sigal, Y.J.; Quintero, O.A.; Cheney, R.E.; Morris, A.J. Cdc42 and ARP2/3-independent regulation of filopodia by an integral membrane lipid-phosphatase-related protein. J. Cell Sci. 2007, 120, 340–352. [Google Scholar] [CrossRef][Green Version]
- Scita, G.; Confalonieri, S.; Lappalainen, P.; Suetsugu, S. IRSp53: Crossing the road of membrane and actin dynamics in the formation of membrane protrusions. Trends Cell Biol. 2008, 18, 52–60. [Google Scholar] [CrossRef]
- Sebé-Pedrós, A.; Burkhardt, P.; Sánchez-Pons, N.; Fairclough, S.R.; Lang, B.F.; King, N.; Ruiz-Trillo, I. Insights into the origin of metazoan filopodia and microvilli. Mol. Biol. Evol. 2013, 30, 2013–2023. [Google Scholar] [CrossRef]
- Rodríguez-García, R.; Volkov, V.A.; Chen, C.-Y.; Katrukha, E.A.; Olieric, N.; Aher, A.; Grigoriev, I.; López, M.P.; Steinmetz, M.O.; Kapitein, L.C.; et al. Mechanisms of motor-independent membrane remodeling driven by dynamic microtubules. Curr. Biol. 2020, 30, 972–987. [Google Scholar] [CrossRef] [PubMed]
- Kučera, O.; Janda, D.; Siahaan, V.; Dijkstra, S.H.; Pilátová, E.; Zatecka, E.; Diez, S.; Braun, M.; Lansky, Z. Anillin propels myosin-independent constriction of actin rings. bioRxiv 2020. [Google Scholar] [CrossRef]
- Kreimer, G. The green algal eyespot apparatus: a primordial visual system and more? Curr. Genet. 2008, 55, 19–43. [Google Scholar] [CrossRef]
- Misumi, O.; Matsuzaki, M.; Nozaki, H.; Miyagishima, S.-Y.; Mori, T.; Nishida, K.; Yagisawa, F.; Yoshida, Y.; Kuroiwa, H.; Kuroiwa, T. Cyanidioschyzon Merolae Genome. A tool for facilitating comparable studies on organelle biogenesis in photosynthetic eukaryotes. Plant Physiol. 2005, 137, 567–585. [Google Scholar] [CrossRef] [PubMed]
- Spurr, A.R. A low-viscosity epoxy resin embedding medium for electron microscopy. J. Ultrastruct. Res. 1969, 26, 31–43. [Google Scholar] [CrossRef]
- Dyballa, N.; Metzger, S. fast and sensitive colloidal coomassie g-250 staining for proteins in polyacrylamide gels. J. Vis. Exp. 2009. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]





| 1 | 2 | 3 | 4 | 5 | 6 | |
|---|---|---|---|---|---|---|
| 1: CMM237C actin | 100 | 50.93 | 23.78 | 28.57 | 31.01 | 36.17 |
| 2: CMS412C | 100 | 25.17 | 27.20 | 29.48 | 31.61 | |
| 3: CMJ223C | 100 | 21.02 | 27.02 | 27.24 | ||
| 4: CMS185C | 100 | 23.32 | 23.70 | |||
| 5: CML073C | 100 | 27.89 | ||||
| 6: CMR270C | 100 |
| Protein | C. merolae Analogue | |
|---|---|---|
| actin | CMM237C | |
| myosin-X [17,18] | none | |
Actin remodelling factors | actin-related proteins [12] | CMS412C, CMJ223C, CMS185C, CML073C, CMR270C |
| other ARP2/3 complex proteins (p16, p20, p21, p34, and p40) [12] | none | |
| cofilin | CMN147C | |
| profilin | CMP220C | |
| villin | none | |
| thymosin | none | |
| capping protein CP [19] | none | |
| gelsolin [20] | none | |
| F-actin-crosslinking proteins | diaphanous-related formin-2 [21,22] | CMN212C |
| formin | CMN049C | |
| fascin [23,24] | CMD091C | |
| anillin | none | |
| Rho GTPases and other signalling factors | CDC42 [25] | CMJ091C, CMH183C, and multiple putative candidates |
| RIF, Rho in filopodia [26] | multiple putative candidates | |
| WASP/WAVE [27] | none | |
| ENA/VASP [24,28] | none | |
| LPR1, lipid phosphatase-related protein-1 [29] | none | |
| I-BAR proteins [30] | insulin receptor substrate p53 | none |
| MIM | none | |
| ABBA | none | |
| IRTKS | none |
| Forward Primer | Reverse Primer | |
|---|---|---|
| CMM237C: | ATTGGGAGTGAGCGTTTCAG | ATTTGCGGTGTACCACAGAG |
| CMS412C: | CCGTATGGTCGCATCTCTTC | GCTGCCAAGTCTGTTAGGTC |
| CMJ223C: | TGCTGGCTTTGCGGGTAGTG | AGTTCTTGGCGGGTCTCCTG |
| CMS185C: | GCGGACGGCTCCTGAATAAC | GACTCGGGTGCGAGGAAATG |
| CML073C: | ATTGGGCAGAGTCAACGAAG | TTTAGTACGCGCCAGTCAAG |
| CMR270C: | GGCGTTGTTCTCGACTGTGG | CGTCAAGCGGCTCTATTCGG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maschmann, S.; Ruban, K.; Wientapper, J.; Walter, W.J. Phototaxis of the Unicellular Red Alga Cyanidioschyzon merolae Is Mediated by Novel Actin-Driven Tentacles. Int. J. Mol. Sci. 2020, 21, 6209. https://doi.org/10.3390/ijms21176209
Maschmann S, Ruban K, Wientapper J, Walter WJ. Phototaxis of the Unicellular Red Alga Cyanidioschyzon merolae Is Mediated by Novel Actin-Driven Tentacles. International Journal of Molecular Sciences. 2020; 21(17):6209. https://doi.org/10.3390/ijms21176209
Chicago/Turabian StyleMaschmann, Sascha, Karin Ruban, Johanna Wientapper, and Wilhelm J. Walter. 2020. "Phototaxis of the Unicellular Red Alga Cyanidioschyzon merolae Is Mediated by Novel Actin-Driven Tentacles" International Journal of Molecular Sciences 21, no. 17: 6209. https://doi.org/10.3390/ijms21176209
APA StyleMaschmann, S., Ruban, K., Wientapper, J., & Walter, W. J. (2020). Phototaxis of the Unicellular Red Alga Cyanidioschyzon merolae Is Mediated by Novel Actin-Driven Tentacles. International Journal of Molecular Sciences, 21(17), 6209. https://doi.org/10.3390/ijms21176209

